grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for marker "BE606541_208-6D" from the experiment "Haplotype polymorphism in polyploid wheats and their diploid ancestors".

E.g., Germplasm PI 350731, Marker/locus BE496863_82-7B.

Items 1 to 25 of 42.       of 2 | Next

[ Download ]

Accession Name


& subtaxa

Country of


View All Genotypes on
CIMMYT 161725_0 CIMMYT   Mexico 1 BE606541_208-6D C View all "CIMMYT 161725_0" genotypes
CIMMYT 161725_0 CIMMYT   Mexico 1 BE606541_208-6D --AAGCCTCCGTCCCGCCCC View all "CIMMYT 161725_0" genotypes
CIMMYT 62056_4 CIMMYT   Mexico 1 BE606541_208-6D GTAAGCCTCCGTCCCGCCCC View all "CIMMYT 62056_4" genotypes
CIMMYT 62056_4 CIMMYT   Mexico 1 BE606541_208-6D A View all "CIMMYT 62056_4" genotypes
CIMMYT 62052_4 CIMMYT   Mexico 1 BE606541_208-6D C View all "CIMMYT 62052_4" genotypes
CIMMYT 62052_4 CIMMYT   Mexico 1 BE606541_208-6D GTAAGCCTCCGTCCCGCCCC View all "CIMMYT 62052_4" genotypes
RL5406 Eric Kerber   Unknown 1 BE606541_208-6D C View all "RL5406" genotypes
RL5406 Eric Kerber   Unknown 1 BE606541_208-6D GTAAGCCTCCGTCCCGCCCC View all "RL5406" genotypes
RL5405 Eric Kerber   Unknown 1 BE606541_208-6D C View all "RL5405" genotypes
RL5405 Eric Kerber   Unknown 1 BE606541_208-6D --------CCG--------- View all "RL5405" genotypes
RL5403 Eric Kerber   Unknown 1 BE606541_208-6D C View all "RL5403" genotypes
RL5403 Eric Kerber   Unknown 1 BE606541_208-6D -------------------- View all "RL5403" genotypes
RL5402 Eric Kerber   Unknown 1 BE606541_208-6D C View all "RL5402" genotypes
RL5402 Eric Kerber   Unknown 1 BE606541_208-6D --AAGCCTCCGTCCCGCCCC View all "RL5402" genotypes
W7984 CIMMYT   Mexico 1 BE606541_208-6D GTAAGCCTCCGTCCCGCCCC View all "W7984" genotypes
W7984 CIMMYT   Mexico 1 BE606541_208-6D A View all "W7984" genotypes
405a Iran spelta Iran 1 BE606541_208-6D A View all "405a" genotypes
405a Iran spelta Iran 1 BE606541_208-6D GTAAGCCTCCGTCCCGCCCC View all "405a" genotypes
Chinese Spring China   China 1 BE606541_208-6D A View all "Chinese Spring" genotypes
Chinese Spring China   China 1 BE606541_208-6D GTAAGCCTCCGTCCCGCCCC View all "Chinese Spring" genotypes
PI 119325 Turkey   Turkey 1 BE606541_208-6D A View all "PI 119325" genotypes
PI 119325 Turkey   Turkey 1 BE606541_208-6D GTAAGCCTCCGTCCCGCCCC View all "PI 119325" genotypes
PI 119325 Turkey   Turkey 1 BE606541_208-6D A View all "PI 119325" genotypes
PI 119325 Turkey   Turkey 1 BE606541_208-6D GTAAGCCTCCGTCCCGCCCC View all "PI 119325" genotypes
Yecora Rojo CIMMYT   Mexico 1 BE606541_208-6D ---AGCCTCCGTCCCGCCCC View all "Yecora Rojo" genotypes
[ Download ]