grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for marker "BE606541_566-6B" from the experiment "Haplotype polymorphism in polyploid wheats and their diploid ancestors".

E.g., Germplasm PI 350731, Marker/locus BE496863_82-7B.

Items 1 to 25 of 44.       of 2 | Next

[ Download ]

Accession Name


& subtaxa

Country of


View All Genotypes on
RL5402 Eric Kerber   Unknown 1 BE606541_566-6B C View all "RL5402" genotypes
RL5402 Eric Kerber   Unknown 1 BE606541_566-6B -------------------- View all "RL5402" genotypes
405a Iran spelta Iran 1 BE606541_566-6B A View all "405a" genotypes
405a Iran spelta Iran 1 BE606541_566-6B -------------------- View all "405a" genotypes
Chinese Spring China   China 1 BE606541_566-6B ------AAATTCGGGTGGCG View all "Chinese Spring" genotypes
Chinese Spring China   China 1 BE606541_566-6B C View all "Chinese Spring" genotypes
PI 119325 Turkey   Turkey 1 BE606541_566-6B A View all "PI 119325" genotypes
PI 119325 Turkey   Turkey 1 BE606541_566-6B -------------------- View all "PI 119325" genotypes
PI 119325 Turkey   Turkey 1 BE606541_566-6B C View all "PI 119325" genotypes
PI 119325 Turkey   Turkey 1 BE606541_566-6B -------------------- View all "PI 119325" genotypes
Yecora Rojo CIMMYT   Mexico 1 BE606541_566-6B C View all "Yecora Rojo" genotypes
Yecora Rojo CIMMYT   Mexico 1 BE606541_566-6B -------------------- View all "Yecora Rojo" genotypes
IWA 10993 Iran   Iran 1 BE606541_566-6B A View all "IWA 10993" genotypes
IWA 10993 Iran   Iran 1 BE606541_566-6B -------------------- View all "IWA 10993" genotypes
PI 410595 Pakistan compactum Pakistan 1 BE606541_566-6B C View all "PI 410595" genotypes
PI 410595 Pakistan compactum Pakistan 1 BE606541_566-6B -------------------- View all "PI 410595" genotypes
PI 350731 Austria compactum Austria 1 BE606541_566-6B C View all "PI 350731" genotypes
PI 350731 Austria compactum Austria 1 BE606541_566-6B -----CAAATTCGGGTGGCG View all "PI 350731" genotypes
PI 166792 Turkey   Turkey 1 BE606541_566-6B C View all "PI 166792" genotypes
PI 166792 Turkey   Turkey 1 BE606541_566-6B CTTGGCAAATTCGGGTGGCG View all "PI 166792" genotypes
PI 166305 Turkey compactum Turkey 1 BE606541_566-6B C View all "PI 166305" genotypes
PI 166305 Turkey compactum Turkey 1 BE606541_566-6B -------------------- View all "PI 166305" genotypes
PI 166698 Turkey   Turkey 1 BE606541_566-6B C View all "PI 166698" genotypes
G 2040 "Diyarbakir, Turkey" dicoccoides Turkey 1 BE606541_566-6B -------------------- View all "G 2040" genotypes
G 2040 "Diyarbakir, Turkey" dicoccoides Turkey 1 BE606541_566-6B C View all "G 2040" genotypes
[ Download ]