grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for marker "STS022" from the experiment "Genome-wide patterns of nucleotide polymorphism in domesticated rice".

E.g., Germplasm "IRGC9542", RA4969, Basmati 1, Marker/locus RM22.

Items 1 to 25 of 96.       of 4 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Germplasm
ARC 13829 IRGC42469     RA4947 STS022 TGTTGGATCATTATTACAAGAGTGCTGTTTGGCACTGAATAAATTGCATC
CCTAGTTGAACATAAGAGTCAATCTTTGCTTTTCCTCCAGTTAAGCGAGC
TAAGAAGTACGTATATCATACCTGAGCCTGCCTTTTCTTTGCTCTTATGA
AGCTTGCTGGAAAAAACTCACACCATATTATTGAGGCAACTTTCAAAGCA
TTTGCTAGAGCCCTTCGACAAGCAACAGAATATGACTTGCGCCGACGCGG
CACTGTCCCCAGGTTCGTTTTAGCTTATTGCAAATAGCGTTTAGGAAATT
CTATGTTGTGCCCAACTACACTGTTGATGCCTGATTCAAAAACTTTACAC
CTGCTAAGCATATGGTTTATCTCTGACCTGTGCTGATATTGAAACATTAA
CGTATCTTTCTTGACTTGATCGCAGCTCAAAAGGTGTGTTGTCAAGGTCA
TAGTGTTGCAGGTTTGGAAAACAAGGGGTGCATGCTACTGTTCCTTGTAG
ATTGCAATATTCAAAGGAAACAAATGGAATGGCCTCTACAGCT
View all "ARC 13829" genotypes
Basmati 217 IRGC53637     RA4993 STS022 TGTTGGATCATTATTACAAGAGTGCTGTTTGGCACTGAATAAATTGCATC
CCTAGTTGAACATAAGAGTCAATCTTTGCTTTTCCTCCAGTTAAGCAAGC
TAAGAAGTACGTATATCATACCTGAGCCTGCCTTTTCTTTGCTCTTATGA
AGCTTGCTGGAAAAAACTCACACCATATTATTGAGGCAACTTTCAAAGCA
TTTGCTAGAGCCCTTCGACAAGCAACAGAATATGACTTGCGCCGACGCGG
CACTGTCCCCAGGTTCGTTTTAGCTTATTGCAAATAGCGTTTAGGAAATT
CTATGTTGTGCCCAACTACACTGTTGATGCCTGATTCAAAAACTTCACAC
CTGCTAAGCATATGGTTTATCTCTGACCTTTGCTGATATTGAAACATTAA
CGTATCTTTCTTGACTTGATCGCAGCTCAAAAGGTGTGTTGTCAAGGTCA
TAGTGTTGCAGGTTTGGAAAACAAGGGGTGCATGCTACTGTTCCTTGTAG
ATTGCAATATTCAAAGGAAACAAATGGAATGGCCTCTACAGCT
View all "Basmati 217" genotypes
DA13 IRGC5857     RA4887 STS022 TGTTGGATCATTATTACAAGAGTGCTGTTTGGCACTGAATAAATTGCATC
CCTAGTTGAACATAAGAGTCAATCTTTGCTTTTCCTCCAGTTAAGCAAGC
TAAGAAGTACGTATATCATACCTGAGCCTGCCTTTTCTTTGCTCTTATGA
AGCTTGCTGGAAAAAACTCACACCATATTATTGAGGCAACTTTCAAAGCA
TTTGCTAGAGCCCTTCGACAAGCAACAGAATATGACTTGCGCCGACGCGG
CACTGTCCCCAGGTTCGTTTTAGCTTATTGCAAATAGCGTTTAGGAAATT
CTATGTTGTGCCCAACTACACTGTTGATGCCTGATTCAAAAACTTCACAC
CTGCTAAGCATATGGTTTATCTCTGACCTTTGCTGATATTGAAACATTAA
CGTATCTTTCTTGACTTGATCGCAGCTCAAAAGGTGTGTTGTCAAGGTCA
TAGTGTTGCAGGTTTGGAAAACAAGGGGTGCATGCTACTGTTCCTTGTAG
ATTGCAATATTCAAAGGAAACAAATGGAATGGCCTCTACAGCT
View all "DA13" genotypes
Dom Sufid IRGC12880 aromatic   RA4929 STS022 TGTTGGATCATTATTACAAGAGTGCTGTTTGGCACTGAATAAATTGCATC
CCTAGTTGAACATAAGAGTCAATCTTTGCTTTTCCTCCAGTTAAGCGAGC
TAAGAAGTACGTATATCATACCTGAGCCTGCCTTTTCTTTGCTCTTATGA
AGCTTGCTGGAAAAAACTCACACCATATTATTGAGGCAACTTTCAAAGCA
TTTGCTAGAGCCCTTCGACAAGCAACAGAATATGACTTGCGCCGACGCGG
CACTGTCCCCAGGTTCGTTTTAGCTTATTGCAAATAGCGTTTAGGAAATT
CTATGTTGTGCCCAACTACACTGTTGATGCCTGATTCAAAAACTTCACAC
CTGCTAAGCATATGGTTTATCTCTGACCTTTGCTGATATTGAAACATTAA
CGTATCTTTCTTGACTTGATCGCAGCTCAAAAGGTGTGTTGTCAAGGTCA
TAGTGTTGCAGGTTTGGAAAACAAGGGGTGCATGCTACTGTTCCTTGTAG
ATTGCAATATTCAAAGGAAACAAATGGAATGGCCTCTACAGCT
View all "Dom Sufid" genotypes
DV85 IRGC8839     RA5323 STS022 TGTTGGATCATTATTACAAGAGTGCTGTTTGGCACTGAATAAATTGCATC
CCTAGTTGAACATAAGAGTCAATCTTTGCTTTTCCTCCAGTTAAGCGAGC
TAAGAAGTACGTATATCATACCTGAGCCTGCCTTTTCTTTGCTCTTATGA
AGCTTGCTGGAAAAAACTCACACCATATTATTGAGGCAACTTTCAAAGCA
TTTGCTAGAGCCCTTCGACAAGCAACAGAATATGACTTGCGCCGACGCGG
CACTGTCCCCAGGTTCGTTTTAGCTTATTGCAAATAGCGTTTAGGAAATT
CTATGTTGTGCCCAACTACACTGTTGATGCCTGATTCAAAAACTTCACAC
CTGCTAAGCATATGGTTTATCTCTGACCTTTGCTGATATTGAAACATTAA
CGTATCTTTCTTGACTTGATCGCAGCTCAAAAGGTGTGTTGTCAAGGTCA
TAGTGTTGCAGGTTTGGAAAACAAGGGGTGCATGCTACTGTTCCTTGTAG
ATTGCAATATTCAAAGGAAACAAATGGAATGGCCTCTACAGCT
View all "DV85" genotypes
Pankhari 203 IRGC5999     RA4888 STS022 TGTTGGATCATTATTACAAGAGTGCTGTTTGGCACTGAATAAATTGCATC
CCTAGTTGAACATAAGAGTCAATCTTTGCTTTTCCTCCAGTTAAGCAAGC
TAAGAAGTACGTATATCATACCTGAGCCTGCCTTTTCTTTGCTCTTATGA
AGCTTGCTGGAAAAAACTCACACCATATTATTGAGGCAACTTTCAAAGCA
TTTGCTAGAGCCCTTCGACAAGCAACAGAATATGACTTGCGCCGACGCGG
CACTGTCCCCAGGTTCGTTTTAGCTTATTGCAAATAGCGTTTAGGAAATT
CTATGTTGTGCCCAACTACACTGTTGATGCCTGATTCAAAAACTTCACAC
CTGCTAAGCATATGGTTTATCTCTGACCTTTGCTGATATTGAAACATTAA
CGTATCTTTCTTGACTTGATCGCAGCTCAAAAGGTGTGTTGTCAAGGTCA
TAGTGTTGCAGGTTTGGAAAACAAGGGGTGCATGCTACTGTTCCTTGTAG
ATTGCAATATTCAAAGGAAACAAATGGAATGGCCTCTACAGCT
View all "Pankhari 203" genotypes
BJ1 IRGC45195     RA5345 STS022 TGTTGGATCATTATTACAAGAGTGCTGTTTGGCACTGAATAAATTGCATC
CCTAGTTGAACATAAGAGTCAATCTTTGCTTTTCCTCCAGTTAAGCGAGC
TAAGAAGTACGTATATCATACCTGAGCCTGCCTTTTCTTTGCTCTTATGA
AGCTTGCTGGAAAAAACTCACACCATATTATTGAGGCAACTTTCAAAGCA
TTTGCTAGAGCCCTTCGACAAGCAACAGAATATGACTTGCGCCGACGCGG
CACTGTCCCCAGGTTCGTTTTAGCTTATTGCAAATAGCGTTTAGGAAATT
CTATGTTGTGCCCAACTACACTGTTGATGCCTGATTCAAAAACTTCACAC
CTGCTAAGCATATGGTTTATCTCTGACCTGTGCTGATATTGAAACATTAA
CGTATCTTTCTTGACTTGATCGCAGCTCAAAAGGTGTGTTGTCAAGGTCA
TAGTGTTGCAGGTTTGGAAAACAAGGGGTGCATGCTACTGTTCCTTGTAG
ATTGCAATATTCAAAGGAAACAAATGGAATGGCCTCTACAGCT
View all "BJ1" genotypes
Dhala Shaitta PI180060     RA5361 STS022 TGTTGGATCATTATTACAAGAGTGCTGTTTGGCACTGAATAAATTGCATC
CCTAGTTGAACATAAGAGTCAATCTTTGCTTTTCCTCCAGTTAAGCGAGC
TAAGAAGTACGTATATCATACCTGAGCCTGCCTTTTCTTTGCTCTTATGA
AGCTTGCTGGAAAAAACTCACACCATATTATTGAGGCAACTTTCAAAGCA
TTTGCTAGAGCCCTTCGACAAGCAACAGAATATGACTTGCGCCGACGCGG
CACTGTCCCCAGGTTCGTTTTAGCTTATTGCAAATAGCGTTTAGGAAATT
CTATGTTGTGCCCAACTACACTGTTGATGCCTGATTCAAAAACTTCACAC
CTGCTAAGCATATGGTTTATCTCTGACCTTTGCTGATATTGAAACATTAA
CGTATCTTTCTTGACTTGATCGCAGCTCAAAAGGTGTGTTGTCAAGGTCA
TAGTGTTGCAGGTTTGGAAAACAAGGGGTGCATGCTACTGTTCCTTGTAG
ATTGCAATATTCAAAGGAAACAAATGGAATGGCCTCTACAGCT
View all "Dhala Shaitta" genotypes
Davao IRGC8244 japonica   RA4901 STS022 TGTTGGATCATTATTACAAGAGTGCTGTTTGGCACTGAATAAATTGCATC
CCTAGTTGAACATAAGAGTCAATCTTTGCTTTTCCTCCAGTTAAGCGAGC
TAAGAAGTACGTATATCATACCTGAGCCTGCCTTTTCTTTGCTCTTATGA
AGCTTGCTGGAAAAAACTCACACCATATTATTGAGGCAACTTTCAAAGCA
TTTGCTAGAGCCCTTCGACAAGCAACAGAATATGACTTGCGCCGACGCGG
CACTGTCCCCAGGTTCGTTTTAGCTTATTGCAAATAGCGTTTAGGAAATT
CTATGTTGTGCCCAACTACACTGTTGATGCCTGATTCAAAAACTTCACAC
CTGCTAAGCATATGGTTTATCTCTGACCTTTGCTGATATTGAAACATTAA
CGTATCTTTCTTGACTTGATCGCAGCTCAAAAGGTGTGTTGTCAAGGTCA
TAGTGTTGCAGGTTTGGAAAACAAGGGGTGCATGCTACTGTTCCTTGTAG
ATTGCAATATTCAAAGGAAACAAATGGAATGGCCTCTACAGCT
View all "Davao" genotypes
Jhona 349 IRGC6307     RA4979 STS022 TGTTGGATCATTATTACAAGAGTGCTGTTTGGCACTGAATAAATTGCATC
CCTAGTTGAACATAAGAGTCAATCTTTGCTTTTCCTCCAGTTAAGCGAGC
TAAGAAGTACGTATATCATACCTGAGCCTGCCTTTTCTTTGCTCTTATGA
AGCTTGCTGGAAAAAACTCACACCATATTATTGAGGCAACTTTCAAAGCA
TTTGCTAGAGCCCTTCGACAAGCAACAGAATATGACTTGCGCCGACGCGG
CACTGTCCCCAGGTTCGTTTTAGCTTATTGCAAATAGCGTTTAGGAAATT
CTATGTTGTGCCCAACTACACTGTTGATGCCTGATTCAAAAACTTCACAC
CTGCTAAGCATATGGTTTATCTCTGACCTTTGCTGATATTGAAACATTAA
CGTATCTTTCTTGACTTGATCGCAGCTCAAAAGGTGTGTTGTCAAGGTCA
TAGTGTTGCAGGTTTGGAAAACAAGGGGTGCATGCTACTGTTCCTTGTAG
ATTGCAATATTCAAAGGAAACAAATGGAATGGCCTCTACAGCT
View all "Jhona 349" genotypes
Kasalath HO1195     RA5339 STS022 TGTTGGATCATTATTACAAGAGTGCTGTTTGGCACTGAATAAATTGCATC
CCTAGTTGAACATAAGAGTCAATCTTTGCTTTTCCTCCAGTTAAGCGAGC
TAAGAAGTACGTATATCATACCTGAGCCTGCCTTTTCTTTGCTCTTATGA
AGCTTGCTGGAAAAAACTCACACCATATTATTGAGGCAACTTTCAAAGCA
TTTGCTAGAGCCCTTCGACAAGCAACAGAATATGACTTGCGCCGACGCGG
CACTGTCCCCAGGTTCGTTTTAGCTTATTGCAAATAGCGTTTAGGAAATT
CTATGTTGTGCCCAACTACACTGTTGATGCCTGATTCAAAAACTTCACAC
CTGCTAAGCATATGGTTTATCTCTGACCTTTGCTGATATTGAAACATTAA
CGTATCTTTCTTGACTTGATCGCAGCTCAAAAGGTGTGTTGTCAAGGTCA
TAGTGTTGCAGGTTTGGAAAACAAGGGGTGCATGCTACTGTTCCTTGTAG
ATTGCAATATTCAAAGGAAACAAATGGAATGGCCTCTACAGCT
View all "Kasalath" genotypes
Phudugey IRGC32399     RA4939 STS022 TGTTGGATCATTATTACAAGAGTGCTGTTTGGCACTGAATAAATTGCATC
CCTAGTTGAACATAAGAGTCAATCTTTGCTTTTCCTCCAGTTAAGCGAGC
TAAGAAGTACGTATATCATACCTGAGCCTGCCTTTTCTTTGCTCTTATGA
AGCTTGCTGGAAAAAACTCACACCATATTATTGAGGCAACTTTCAAAGCA
TTTGCTAGAGCCCTTCGACAAGCAACAGAATATGACTTGCGCCGACGCGG
CACTGTCCCCAGGTTCGTTTTAGCTTATTGCAAATAGCGTTTAGGAAATT
CTATGTTGTGCCCAACTACACTGTTGATGCCTGATTCAAAAACTTCACAC
CTGCTAAGCATATGGTTTATCTCTGACCTTTGCTGATATTGAAACATTAA
CGTATCTTTCTTGACTTGATCGCAGCTCAAAAGGTGTGTTGTCAAGGTCA
TAGTGTTGCAGGTTTGGAAAACAAGGGGTGCATGCTACTGTTCCTTGTAG
ATTGCAATATTCAAAGGAAACAAATGGAATGGCCTCTACAGCT
View all "Phudugey" genotypes
9311 RA5531 indica   RA5531 STS022 TGTTGGATCATTATTACAAGAGTGCTGTTTGGCACTGAATAAATTGCATC
CCTAGTTGAACATAAGAGTCAATCTTTGCTTTTCCTCCAGTTAAGCGAGC
TAAGAAGTACGTATATCATACCTGAGCCTGCCTTTTCTTTGCTCTTATGA
AGCTTGCTGGAAAAAACTCACACCATATTATTGAGGCAACTTTCAAAGCA
TTTGCTAGAGCCCTTCGACAAGCAACAGAATATGACTTGCGCCGACGCGG
CACTGTCCCCAGGTTCGTTTTAGCTTATTGCAAATAGCGTTTAGGAAATT
CTATGTTGTGCCCAACTACACTGTTGATGCCTGATTCAAAAACTTCACAC
CTGCTAAGCATATGGTTTATCTCTGACCTGTGCTGATATTGAAACATTAA
CGTATCTTTCTTGACTTGATCGCAGCTCAAAAGGTGTGTTGTCAAGGTCA
TAGTGTTGCAGGTTTGGAAAACAAGGGGTGCATGCTACTGTTCCTTGTAG
ATTGCAATATTCAAAGGAAACAAATGGAATGGCCTCTACAGCT
View all "9311" genotypes
Ai-Chiao-Hong IRGC51250 indica   RA4967 STS022 TGTTGGATCATTATTACAAGAGTGCTGTTTGGCACTGAATAAATTGCATC
CCTAGTTGAACATAAGAGTCAATCTTTGCTTTTCCTCCAGTTAAGCGAGC
TAAGAAGTACGTATATCATACCTGAGCCTGCCTTTTCTTTGCTCTTATGA
AGCTTGCTGGAAAAAACTCACACCATATTATTGAGGCAACTTTCAAAGCA
TTTGCTAGAGCCCTTCGACAAGCAACAGAATATGACTTGCGCCGACGCGG
CACTGTCCCCAGGTTCGTTTTAGCTTATTGCAAATAGCGTTTAGGAAATT
CTATGTTGTGCCCAACTACACTGTTGATGCCTGATTCAAAAACTTCACAC
CTGCTAAGCATATGGTTTATCTCTGACCTTTGCTGATATTGAAACATTAA
CGTATCTTTCTTGACTTGATCGCAGCTCAAAAGGTGTGTTGTCAAGGTCA
TAGTGTTGCAGGTTTGGAAAACAAGGGGTGCATGCTACTGTTCCTTGTAG
ATTGCAATATTCAAAGGAAACAAATGGAATGGCCTCTACAGCT
View all "Ai-Chiao-Hong" genotypes
Badkalamkati IRGC45011 indica   RA4991 STS022 TGTTGGATCATTATTACAAGAGTGCTGTTTGGCACTGAATAAATTGCATC
CCTAGTTGAACATAAGAGTCAATCTTTGCTTTTCCTCCAGTTAAGCGAGC
TAAGAAGTACGTATATCATACCTGAGCCTGCCTTTTCTTTGCTCTTATGA
AGCTTGCTGGAAAAAACTCACACCATATTATTGAGGCAACTTTCAAAGCA
TTTGCTAGAGCCCTTCGACAAGCAACAGAATATGACTTGCGCCGACGCGG
CACTGTCCCCAGGTTCGTTTTAGCTTATTGCAAATAGCGTTTAGGAAATT
CTATGTTGTGCCCAACTACACTGTTGATGCCTGATTCAAAAACTTCACAC
CTGCTAAGCATATGGTTTATCTCTGACCTGTGCTGATATTGAAACATTAA
CGTATCTTTCTTGACTTGATCGCAGCTCAAAAGGTGTGTTGTCAAGGTCA
TAGTGTTGCAGGTTTGGAAAACAAGGGGTGCATGCTACTGTTCCTTGTAG
ATTGCAATATTCAAAGGAAACAAATGGAATGGCCTCTACAGCT
View all "Badkalamkati" genotypes
Binulawan IRGC26872 indica   RA4871 STS022 TGTTGGATCATTATTACAAGAGTGCTGTTTGGCACTGAATAAATTGCATC
CCTAGTTGAACATAAGAGTCAATCTTTGCTTTTCCTCCAGTTAAGCGAGC
TAAGAAGTACGTATATCATACCTGAGCCTGCCTTTTCTTTGCTCTTATGA
AGCTTGCTGGAAAAAACTCACACCATATTATTGAGGCAACTTTCAAAGCA
TTTGCTAGAGCCCTTCGACAAGCAACAGAATATGACTTGCGCCGACGCGG
CACTGTCCCCAGGTTCGTTTTAGCTTATTGCAAATAGCGTTTAGGAAATT
CTATGTTGTGCCCAACTACACTGTTGATGCCTGATTCAAAAACTTCACAC
CTGCTAAGCATATGGTTTATCTCTGACCTGTGCTGATATTGAAACATTAA
CGTATCTTTCTTGACTTGATCGCAGCTCAAAAGGTGTGTTGTCAAGGTCA
TAGTGTTGCAGGTTTGGAAAACAAGGGGTGCATGCTACTGTTCCTTGTAG
ATTGCAATATTCAAAGGAAACAAATGGAATGGCCTCTACAGCT
View all "Binulawan" genotypes
Cere Air IRGC43369 indica   RA4953 STS022 TGTTGGATCATTATTACAAGAGTGCTGTTTGGCACTGAATAAATTGCATC
CCTAGTTGAACATAAGAGTCAATCTTTGCTTTTCCTCCAGTTAAGCAAGC
TAAGAAGTACGTATATCATACCTGAGCCTGCCTTTTCTTTGCTCTTATGA
AGCTTGCTGGAAAAAACTCACACCATATTATTGAGGCAACTTTCAAAGCA
TTTGCTAGAGCCCTTCGACAAGCAACAGAATATGACTTGCGCCGACGCGG
CACTGTCCCCAGGTTCGTTTTAGCTTATTGCAAATAGCGTTTAGGAAATT
CTATGTTGTGCCCAACTACACTGTTGATGCCTGATTCAAAAACTTCACAC
CTGCTAAGCATATGGTTTATCTCTGACCTTTGCTGATATTGAAACATTAA
CGTATCTTTCTTGACTTGATCGCAGCTCAAAAGGTGTGTTGTCAAGGTCA
TAGTGTTGCAGGTTTGGAAAACAAGGGGTGCATGCTACTGTTCCTTGTAG
ATTGCAATATTCAAAGGAAACAAATGGAATGGCCTCTACAGCT
View all "Cere Air" genotypes
Chau IRGC56036 indica   RA4974 STS022 TGTTGGATCATTATTACAAGAGTGCTGTTTGGCACTGAATAAATTGCATC
CCTAGTTGAACATAAGAGTCAATCTTTGCTTTTCCTCCAGTTAAGCGAGC
TAAGAAGTACGTATATCATACCTGAGCCTGCCTTTTCTTTGCTCTTATGA
AGCTTGCTGGAAAAAACTCACACCATATTATTGAGGCAACTTTCAAAGCA
TTTGCTAGAGCCCTTCGACAAGCAACAGAATATGACTTGCGCCGACGCGG
CACTGTCCCCAGGTTCGTTTTAGCTTATTGCAAATAGCGTTTAGGAAATT
CTATGTTGTGCCCAACTACACTGTTGATGCCTGATTCAAAAACTTTACAC
CTGCTAAGCATATGGTTTATCTCTGACCTGTGCTGATATTGAAACATTAA
CGTATCTTTCTTGACTTGATCGCAGCTCAAAAGGTGTGTTGTCAAGGTCA
TAGTGTTGCAGGTTTGGAAAACAAGGGGTGCATGCTACTGTTCCTTGTAG
ATTGCAATATTCAAAGGAAACAAATGGAATGGCCTCTACAGCT
View all "Chau" genotypes
Chhote Dhan IRGC58930 indica   RA4978 STS022 TGTTGGATCATTATTACAAGAGTGCTGTTTGGCACTGAATAAATTGCATC
CCTAGTTGAACATAAGAGTCAATCTTTGCTTTTCCTCCAGTTAAGCGAGC
TAAGAAGTACGTATATCATACCTGAGCCTGCCTTTTCTTTGCTCTTATGA
AGCTTGCTGGAAAAAACTCACACCATATTATTGAGGCAACTTTCAAAGCA
TTTGCTAGAGCCCTTCGACAAGCAACAGAATATGACTTGCGCCGACGCGG
CACTGTCCCCAGGTTCGTTTTAGCTTATTGCAAATAGCGTTTAGGAAATT
CTATGTTGTGCCCAACTACACTGTTGATGCCTGATTCAAAAACTTCACAC
CTGCTAAGCATATGGTTTATCTCTGACCTGTGCTGATATTGAAACATTAA
CGTATCTTTCTTGACTTGATCGCAGCTCAAAAGGTGTGTTGTCAAGGTCA
TAGTGTTGCAGGTTTGGAAAACAAGGGGTGCATGCTACTGTTCCTTGTAG
ATTGCAATATTCAAAGGAAACAAATGGAATGGCCTCTACAGCT
View all "Chhote Dhan" genotypes
Gundil Kuning IRGC16428 japonica   RA5297 STS022 TGTTGGATCATTATTACAAGAGTGCTGTTTGGCACTGAATAAATTGCATC
CCTAGTTGAACATAAGAGTCAATCTTTGCTTTTCCTCCAGTTAAGCGAGC
TAAGAAGTACGTATATCATACCTGAGCCTGCCTTTTCTTTGCTCTTATGA
AGCTTGCTGGAAAAAACTCACACCATATTATTGAGGCAACTTTCAAAGCA
TTTGCTAGAGCCCTTCGACAAGCAACAGAATATGACTTGCGCCGACGCGG
CACTGTCCCCAGGTTCGTTTTAGCTTATTGCAAATAGCGTTTAGGAAATT
CTATGTTGTGCCCAACTACACTGTTGATGCCTGATTCAAAAACTTCACAC
CTGCTAAGCATATGGTTTATCTCTGACCTTTGCTGATATTGAAACATTAA
CGTATCTTTCTTGACTTGATCGCAGCTCAAAAGGTGTGTTGTCAAGGTCA
TAGTGTTGCAGGTTTGGAAAACAAGGGGTGCATGCTACTGTTCCTTGTAG
ATTGCAATATTCAAAGGAAACAAATGGAATGGCCTCTACAGCT
View all "Gundil Kuning" genotypes
Guan-Yin-Tsan IRGC51300 indica   RA4968 STS022 TGTTGGATCATTATTACAAGAGTGCTGTTTGGCACTGAATAAATTGCATC
CCTAGTTGAACATAAGAGTCAATCTTTGCTTTTCCTCCAGTTAAGCGAGC
TAAGAAGTACGTATATCATACCTGAGCCTGCCTTTTCTTTGCTCTTATGA
AGCTTGCTGGAAAAAACTCACACCATATTATTGAGGCAACTTTCAAAGCA
TTTGCTAGAGCCCTTCGACAAGCAACAGAATATGACTTGCGCCGACGCGG
CACTGTCCCCAGGTTCGTTTTAGCTTATTGCAAATAGCGTTTAGGAAATT
CTATGTTGTGCCCAACTACACTGTTGATGCCTGATTCAAAAACTTCACAC
CTGCTAAGCATATGGTTTATCTCTGACCTTTGCTGATATTGAAACATTAA
CGTATCTTTCTTGACTTGATCGCAGCTCAAAAGGTGTGTTGTCAAGGTCA
TAGTGTTGCAGGTTTGGAAAACAAGGGGTGCATGCTACTGTTCCTTGTAG
ATTGCAATATTCAAAGGAAACAAATGGAATGGCCTCTACAGCT
View all "Guan-Yin-Tsan" genotypes
Hsia-Chioh-Keh-Tu IRGC8240 indica   RA4898 STS022 TGTTGGATCATTATTACAAGAGTGCTGTTTGGCACTGAATAAATTGCATC
CCTAGTTGAACATAAGAGTCAATCTTTGCTTTTCCTCCAGTTAAGCGAGC
TAAGAAGTACGTATATCATACCTGAGCCTGCCTTTTCTTTGCTCTTATGA
AGCTTGCTGGAAAAAACTCACACCATATTATTGAGGCAACTTTCAAAGCA
TTTGCTAGAGCCCTTCGACAAGCAACAGAATATGACTTGCGCCGACGCGG
CACTGTCCCCAGGTTCGTTTTAGCTTATTGCAAATAGCGTTTAGGAAATT
CTATGTTGTGCCCAACTACACTGTTGATGCCTGATTCAAAAACTTCACAC
CTGCTAAGCATATGGTTTATCTCTGACCTGTGCTGATATTGAAACATTAA
CGTATCTTTCTTGACTTGATCGCAGCTCAAAAGGTGTGTTGTCAAGGTCA
TAGTGTTGCAGGTTTGGAAGACAAGGGGTGCATGCTACTGTTCCTTGTAG
ATTGCAATATTCAAAGGAAACAAATGGAATGGCCTCTACAGCT
View all "Hsia-Chioh-Keh-Tu" genotypes
Jefferson x Oryza rufipogon NULL     Jefferson x Oryza rufipogon BC2F2 Line 252 STS022 TGTTGGATCATTATTACAAGAGTGCTGTTTGGCACTGAATAAATTGCATC
CCTAGTTGAACATAAGAGTCAATCTTTGCTTTTCCTCCAGTTAAGCGAGC
TAAGAAGTACGTATATCATACCTGAGCCTGCCTTTTCTTTGCTCTTATGA
AGCTTGCTGGAAAAAACTCACACCATATTATTGAGGCAACTTTCAAAGCA
TTTGCTAGAGCCCTTCGACAAGCAACAGAATATGACTTGCGCCGACGCGG
CACTGTCCCCAGGTTCGTTTTAGCTTATTGCAAATAGCGTTTAGGAAATT
CTATGTTGTGCCCAACTACACTGTTGATGCCTGATTCAAAAACTTCACAC
CTGCTAAGCATATGGTTTATCTCTGACCTGTGCTGATATTGAAACATTAA
CGTATCTTTCTTGACTTGATCGCAGCTCAAAAGGTGTGTTGTCAAGGTCA
TAGTGTTGCAGGTTTGGAAAACAAGGGGTGCATGCTACTGTTCCTTGTAG
ATTGCAATATTCAAAGGAAACAAATGGAATGGCCTCTACAGCT
View all "Jefferson x Oryza rufipogon" genotypes
Mudgo IRGC6663 indica   RA5282 STS022 TGTTGGATCATTATTACAAGAGTGCTGTTTGGCACTGAATAAATTGCATC
CCTAGTTGAACATAAGAGTCAATCTTTGCTTTTCCTCCAGTTAAGCGAGC
TAAGAAGTACGTATATCATACCTGAGCCTGCCTTTTCTTTGCTCTTATGA
AGCTTGCTGGAAAAAACTCACACCATATTATTGAGGCAACTTTCAAAGCA
TTTGCTAGAGCCCTTCGACAAGCAACAGAATATGACTTGCGCCGACGCGG
CACTGTCCCCAGGTTCGTTTTAGCTTATTGCAAATAGCGTTTAGGAAATT
CTATGTTGTGCCCAACTACACTGTTGATGCCTGATTCAAAAACTTCACAC
CTGCTAAGCATATGGTTTATCTCTGACCTGTGCTGATATTGAAACATTAA
CGTATCTTTCTTGACTTGATCGCAGCTCAAAAGGTGTGTTGTCAAGGTCA
TAGTGTTGCAGGTTTGGAAAACAAGGGGTGCATGCTACTGTTCCTTGTAG
ATTGCAATATTCAAAGGAAACAAATGGAATGGCCTCTACAGCT
View all "Mudgo" genotypes
Khao Dawk Mali 105 IRGC27748 indica   RA4878 STS022 TGTTGGATCATTATTACAAGAGTGCTGTTTGGCACTGAATAAATTGCATC
CCTAGTTGAACATAAGAGTCAATCTTTGCTTTTCCTCCAGTTAAGCGAGC
TAAGAAGTACGTATATCATACCTGAGCCTGCCTTTTCTTTGCTCTTATGA
AGCTTGCTGGAAAAAACTCACACCATATTATTGAGGCAACTTTCAAAGCA
TTTGCTAGAGCCCTTCGACAAGCAACAGAATATGACTTGCGCCGACGCGG
CACTGTCCCCAGGTTCGTTTTAGCTTATTGCAAATAGCGTTTAGGAAATT
CTATGTTGTGCCCAACTACACTGTTGATGCCTGATTCAAAAACTTTACAC
CTGCTAAGCATATGGTTTATCTCTGACCTGTGCTGATATTGAAACATTAA
CGTATCTTTCTTGACTTGATCGCAGCTCAAAAGGTGTGTTGTCAAGGTCA
TAGTGTTGCAGGTTTGGAAAACAAGGGGTGCATGCTACTGTTCCTTGTAG
ATTGCAATATTCAAAGGAAACAAATGGAATGGCCTCTACAGCT
View all "Khao Dawk Mali 105" genotypes
[ Download ]