grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for marker "STS032" from the experiment "Genome-wide patterns of nucleotide polymorphism in domesticated rice".

E.g., Germplasm "IRGC9542", RA4969, Basmati 1, Marker/locus RM22.

Items 1 to 25 of 71.       of 3 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Germplasm
DA13 IRGC5857     RA4887 STS032 GGCCTCTGGTGTCCCCATCAAGTTGATGAGTGTGCAGAGTGATGATCTTC
TCACCAAGGTGCAGATACAAGATTTCAATTTCATGCATTACACATGGACA
CATAATCTCACACAAGATTCGACTTGGTTTGATTCTACATGGTTTTAATC
TTCACTCTCCATAATGTACAGATATCGAGAGTTGGAGACGCCACATCTGC
AACTGTCAATTCAGGGTTGTTGCCTGATCTGTCAAATGCAACCTTGGAGG
ATTACCAAGGCTATAACACTGAGGTGGTGAAGGCAGCCCGACTTTGGTAC
AGCTCCATAGGAGGAGAAATGCCACTGGAGATCACTCCTAAAGTAGGTGA
CACAAAACTAGGATTTGCAATCAGCCGTACTGAGGAGGTAAGCTTTCTGT
CGCCACTTCCAGAATATCGACAATATTATGCTTCATCAATTAAGAACAAA
AGAGTTATACATCAAACATTCCATGACACAATGTTTCTTTCAGGGTTTTA
TCTACATATCTTCAGTGTT
View all "DA13" genotypes
Dom Sufid IRGC12880 aromatic   RA4929 STS032 GGCCTCTGGTGTCCCCATCAAGTTGATGAGTGTGCAGAGTGATGATCTTC
TCACCAAGGTGCAGATACAAGATTTCAATTTCATGCATTACACATGGACA
CATAATCTCACACAAGATTCGACTTGGTTTGATTCTACATGGTTTTAATC
TTCACTCTCCATAATGTACAGATATCGAGAGTTGGAGACGCCACATCTGC
AACTGTCAATTCAGGGTTGTTGCCTGATCTGTCAAATGCAACCTTGGAGG
ATTACCAAGGCTATAACACTGAGGTGGTGAAGGCAGCCCGACTTTGGTAC
AGCTCCATAGGAGGAGAAATGCCACTGGAGATCACTCCTAAAGTAGGTGA
CACAAAACTAGGATTTGCAATCAGCCGTACTGAGGAGGTAAGCTTTCTGT
CGCCACTTCCAGAATATCGACAATATTATGCTTCATCAATTAAGAACAAA
AGAGTTATACATCAAACATTCCATGACACAATGTTTCTTTCAGGGTTTTA
TCTACATATCTTCAGTGTT
View all "Dom Sufid" genotypes
DV85 IRGC8839     RA5323 STS032 GGCCTCTGGTGTCCCCATCAAGTTGATGAGTGTGCAGAGTGATGATCTTC
TCACCAAGGTGCAGATACAAGATTTCAATTTCATGCATTACACATGGACA
CATAATCTCACACAAGATTCGACTTGGTTTGATTCTACATGGTTTTAATC
TTCACTCTCCATAATGTACAGATATCGAGAGTTGGAGACGCCACATCTGC
AACTGTCAATTCAGGGTTGTTGCCTGATCTGTCAAATGCAACCTTGGAGG
ATTACCAAGGCTATAACACTGAGGTGGTGAAGGCAGCCCGACTTTGGTAC
AGCTCCATAGGAGGAGAAATGCCACTGGAGATCACTCCTAAAGTAGGTGA
CACAAAACTAGGATTTGCAATCAGCCGTACTGAGGAGGTAAGCTTTCTGT
CGCCACTTCCAGAATATCGACAATATTATGCTTCATCAATTAAGAACAAA
AGAGTTATACATCAAACATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNN
View all "DV85" genotypes
Pankhari 203 IRGC5999     RA4888 STS032 GGCCTCTGGTGTCCCCATCAAGTTGATGAGTGTGCAGAGTGATGATCTTC
TCACCAAGGTGCAGATACAAGATTTCAATTTCATGCATTACACATGGACA
CATAATCTCACACAAGATTCGACTTGGTTTGATTCTACATGGTTTTAATC
TTCACTCTCCATAATGTACAGATATCGAGAGTTGGAGACGCCACATCTGC
AACTGTCAATTCAGGGTTGTTGCCTGATCTGTCAAATGCAACCTTGGAGG
ATTACCAAGGCTATAACACTGAGGTGGTGAAGGCAGCCCGACTTTGGTAC
AGCTCCATAGGAGGAGAAATGCCACTGGAGATCACTCCTAAAGTAGGTGA
CACAAAACTAGGATTTGCAATCAGCCGTACTGAGGAGGTAAGCTTTCTGT
CGCCACTTCCAGAATATCGACAATATTATGCTTCATCAATTAAGAACAAA
AGAGTTATACATCAAACATTCCATGACACAATGTTTCTTTCAGGGTTTNA
NCTACATATCTTCAGTGTT
View all "Pankhari 203" genotypes
Dhala Shaitta PI180060     RA5361 STS032 GGCCTCTGGTGTCCCCATCAAGTTGATGAGTGTGCAGAGTGATGATCTTC
TCACCAAGGTGCAGATACAAGATTTCAATTTCATGCATTACACATGGACA
CATAATCTCACACAAGATTCGACTTGGTTTGATTCTACATGGTTTTAATC
TTCACTCTCCATAATGTACAGATATCGAGAGTTGGAGACGCCACATCTGC
AACTGTCAATTCAGGGTTGTTGCCTGATCTGTCAAATGCAACCTTGGAGG
ATTACCAAGGCTATAACACTGAGGTGGTGAAGGCAGCCCGACTTTGGTAC
AGCTCCATAGGAGGAGAAATGCCACTGGAGATCACTCCTAAAGTAGGTGA
CACAAAACTAGGATTTGCAATCAGCCGTACTGAGGAGGTAAGCTTTCTGT
CGCCACTTCCAGAATATCGACAATATTATGCTTCATCAATTAAGAACAAA
AGAGTTATACATCAAACATTCCATGACACAATGTTTCTTTCAGGGTTTTA
TCTACATATCTTCAGTGTT
View all "Dhala Shaitta" genotypes
Jhona 349 IRGC6307     RA4979 STS032 GGCCTCTGGTGTCCCCATCAAGTTGATGAGTGTGCAGAGTGATGATCTTC
TCACCAAGGTGCAGATACAAGATTTCAATTTCATGCATTACACATGGACA
CATAATCTCACACAAGATTCGACTTGGTTTGATTCTACATGGTTTTAATC
TTCACTCTCCATAATGTACAGATATCGAGAGTTGGAGACACCACATCTGC
AACTGTCAATTCAGGGTTGTTGCCTGATCTGTCAAATGCAACCTTGGAGG
ATTACCAAGGCTATAACACTGAGGTGGTGAAGGCAGCCCGACTTTGGTAC
AGCTCCATAGGAGGAGAAATGCCACTGGAGATCACTCCTAAAGTAGGTGA
CACAAAACTAGGATTTGCAATCAGCCGTACTGAGGAGGTAAGCTTTCTGT
CGCCACTTCCAGAATATCGACAATATTATGCTTCATCAATTAAGAACAAA
AGAGTTATACATCAAACATTCCATGACACAATGTTTCTTTCAGGGTTTTA
TCTACATATCTTCAGTGTT
View all "Jhona 349" genotypes
Phudugey IRGC32399     RA4939 STS032 GGCCTCTGGTGTCCCCATCAAGTTGATGAGTGTGCAGAGTGATGATCTTC
TCACCAAGGTGCAGATACAAGATTTCAATTTCATGCATTACACATGGACA
CATAATCTCACACAAGATTCGACTTGGTTTGATTCTACATGGTTTTAATC
TTCACTCTCCATAATGTACAGATATCGAGAGTTGGAGACACCACATCTGC
AACTGTCAATTCAGGGTTGTTGCCTGATCTGTCAAATGCAACCTTGGAGG
ATTACCAAGGCTATAACACTGAGGTGGTGAAGGCAGCCCGACTTTGGTAC
AGCTCCATAGGAGGAGAAATGCCACTGGAGATCACTCCTAAAGTAGGTGA
CACAAAACTAGGATTTGCAATCAGCCGTACTGAGGAGGTAAGCTTTCTGT
CGCCACTTCCAGAATATCGACAATATTATGCTTCATCAATTAAGAACAAA
AGAGTTATACATCAAACATTCCATGACACAATGTTTCTTTCAGGGTTTTA
TCTACATATCTTCAGTGTT
View all "Phudugey" genotypes
9311 RA5531 indica   RA5531 STS032 GGCCTCTGGTGTCCCCATCAAGTTGATGAGTGTGCAGAGTGATGATCTTC
TCACCAAGGTGCAGATACAAGATTTCAATTTCATGCATTACACATGGACA
CATAATCTCACACAAGATTCGACTTGGTTTGATTCTACATGGTTTTAATC
TTCACTCTCCATAATGTACAGATATCGAGAGTTGGAGACACCACATCTGC
AACTGTCAATTCAGGGTTGTTGCCTGATCTGTCAAATGCAACCTTGGAGG
ATTACCAAGGCTATAACACTGAGGTGGTGAAGGCAGCCCGACTTTGGTAC
AGCTCCATAGGAGGAGAAATGCCACTGGAGATCACTCCTAAAGTAGGTGA
CACAAAACTAGGATTTGCAATCAGCCGTACTGAGGAGGTAAGCTTTCTGT
CGCCACTTCCAGAATATCGACAATATTATGCTTCATCAATTAAGAACAAA
AGAGTTATACATCAAACATTCCATGACACAATGTTTCTTTCAGGGTTTTA
TCTACATATCTTCAGTGTT
View all "9311" genotypes
Ai-Chiao-Hong IRGC51250 indica   RA4967 STS032 GGCCTCTGGTGTCCCCATCAAGTTGATGAGTGTGCAGAGTGATGATCTTC
TCACCAAGGTGCAGATACAAGATTTCAATTTCATGCATTACACATGGACA
CATAATCTCACACAAGATTCGACTTGGTTTGATTCTACATGGTTTTAATC
TTCACTCTCCATAATGTACAGATATCGAGAGTTGGAGACACCACATCTGC
AACTGTCAATTCAGGGTTGTTGCCTGATCTGTCAAATGCAACCTTGGAGG
ATTACCAAGGCTATAACACTGAGGTGGTGAAGGCAGCCCGACTTTGGTAC
AGCTCCATAGGAGGAGAAATGCCACTGGAGATCACTCCTAAAGTAGGTGA
CACAAAACTAGGATTTGCAATCAGCCGTACTGAGGAGGTAAGCTTTCTGT
CGCCACTTCCAGAATATCGACAATATTATGCTTCATCAATTAAGAACAAA
AGAGTTATACATCAAACATTCCATGACACAATGTTTCTTTCAGGGTTTTA
TCTACATATCTTCAGTGTT
View all "Ai-Chiao-Hong" genotypes
Badkalamkati IRGC45011 indica   RA4991 STS032 GGCCTCTGGTGTCCCCATCAAGTTGATGAGTGTGCAGAGTGATGATCTTC
TCACCAAGGTGCAGATACAAGATTTCAATTTCATGCATTACACATGGACA
CATAATCTCACACAAGATTCGACTTGGTTTGATTCTACATGGTTTTAATC
TTCACTCTCCATAATGTACAGATATCGAGAGTTGGAGACGCCACATCTGC
AACTGTCAATTCAGGGTTGTTGCCTGATCTGTCAAATGCAACCTTGGAGG
ATTACCAAGGCTATAACACTGAGGTGGTGAAGGCAGCCCGACTTTGGTAC
AGCTCCATAGGAGGAGAAATGCCACTGGAGATCACTCCTAAAGTAGGTGA
CACAAAACTAGGATTTGCAATCAGCCGTACTGAGGAGGTAAGCTTTCTGT
CGCCACTTCCAGAATATCGACAATATTATGCTTCATCAATTAAGAACAAA
AGAGTTATACATCAAACATTCCATGACACAATGTTTCTTTCAGGGTTTTA
TCTACATATCTTCANNNNN
View all "Badkalamkati" genotypes
Binulawan IRGC26872 indica   RA4871 STS032 GGCCTCTGGTGTCCCCATCAAGTTGATGAGTGTGCAGAGTGATGATCTTC
TCACCAAGGTGCAGATACAAGATTTCAATTTCATGCATTACACATGGACA
CATAATCTCACACAAGATTCGACTTGGTTTGATTCTACATGGTTTTAATC
TTCACTCTCCATAATGTACAGATATCGAGAGTTGGAGACACCACATCTGC
AACTGTCAATTCAGGGTTGTTGCCTGATCTGTCAAATGCAACCTTGGAGG
ATTACCAAGGCTATAACACTGAGGTGGTGAAGGCAGCCCGACTTTGGTAC
AGCTCCATAGGAGGAGAAATGCCACTGGAGATCACTCCTAAAGTAGGTGA
CACAAAACTAGGATTTGCAATCAGCCGTACTGAGGAGGTAAGCTTTCTGT
CGCCACTTCCAGAATATCGACAATATTATGCTTCATCAATTAAGAACAAA
AGAGTTATACATCAAACATTCCATGACACAATGTTTCTTTCAGGGTTTTA
TCTACATATCTTCAGTGTT
View all "Binulawan" genotypes
Cere Air IRGC43369 indica   RA4953 STS032 GGCCTCTGGTGTCCCCATCAAGTTGATGAGTGTGCAGAGTGATGATCTTC
TCACCAAGGTGCAGATACAAGATTTCAATTTCATGCATTACACATGGACA
CATAATCTCACACAAGATTCGACTTGGTTTGATTCTACATGGTTTTAATC
TTCACTCTCCATAATGTACAGATATCGAGAGTTGGAGACACCACATCTGC
AACTGTCAATTCAGGGTTGTTGCCTGATCTGTCAAATGCAACCTTGGAGG
ATTACCAAGGCTATAACACTGAGGTGGTGAAGGCAGCCCGACTTTGGTAC
AGCTCCATAGGAGGAGAAATGCCACTGGAGATCACTCCTAAAGTAGGTGA
CACAAAACTAGGATTTGCAATCAGCCGTACTGAGGAGGTAAGCTTTCTGT
CGCCACTTCCAGAATATCGACAATATTATGCTTCATCAATTAAGAACAAA
AGAGTTATACATCAAACATTCCATGACACAATGTTTCTTTCAGGGTTTTA
TCTACATATCTTCAGTGTT
View all "Cere Air" genotypes
Chau IRGC56036 indica   RA4974 STS032 GGCCTCTGGTGTCCCCATCAAGTTGATGAGTGTGCAGAGTGATGATCTTC
TCACCAAGGTGCAGATACAAGATTTCAATTTCATGCATTACACATGGACA
CATAATCTCACACAAGATTCGACTTGGTTTGATTCTACATGGTTTTAATC
TTCACTCTCCATAATGTACAGATATCGAGAGTTGGAGACACCACATCTGC
AACTGTCAATTCAGGGTTGTTGCCTGATCTGTCAAATGCAACCTTGGAGG
ATTACCAAGGCTATAACACTGAGGTGGTGAAGGCAGCCCGACTTTGGTAC
AGCTCCATAGGAGGAGAAATGCCACTGGAGATCACTCCTAAAGTAGGTGA
CACAAAACTAGGATTTGCAATCAGCCGTACTGAGGAGGTAAGCTTTCTGT
CGCCACTTCCAGAATATCGACAATATTATGCTTCATCAATTAAGAACAAA
AGAGTTATACATCAAACATTCCATGACACAATGTTTCTTTCAGGGTTTTA
TCTACATATCTTCAGTGTT
View all "Chau" genotypes
Chhote Dhan IRGC58930 indica   RA4978 STS032 GGCCTCTGGTGTCCCCATCAAGTTGATGAGTGTGCAGAGTGATGATCTTC
TCACCAAGGTGCAGATACAAGATTTCAATTTCATGCATTACACATGGACA
CATAATCTCACACAAGATTCGACTTGGTTTGATTCTACATGGTTTTAATC
TTCACTCTCCATAATGTACAGATATCGAGAGTTGGAGACACCACATCTGC
AACTGTCAATTCAGGGTTGTTGCCTGATCTGTCAAATGCAACCTTGGAGG
ATTACCAAGGCTATAACACTGAGGTGGTGAAGGCAGCCCGACTTTGGTAC
AGCTCCATAGGAGGAGAAATGCCACTGGAGATCACTCCTAAAGTAGGTGA
CACAAAACTAGGATTTGCAATCAGCCGTACTGAGGAGGTAAGCTTTCTGT
CGCCACTTCCAGAATATCGACAATATTATGCTTCATCAATTAAGAACAAA
AGAGTTATACATCAAACATTCCATGACACAATGTTTCTTTCAGGGTTTTA
TCTACATATCTTCAGTGTT
View all "Chhote Dhan" genotypes
Gundil Kuning IRGC16428 japonica   RA5297 STS032 GGCCTCTGGTGTCCCCATCAAGTTGATGAGTGTGCAGAGTGATGATCTTC
TCACCAAGGTGCAGATACAAGATTTCAATTTCATGCATTACACATGGACA
CATAATCTCACACAAGATTCGACTTGGTTTGATTCTACATGGTTTTAATC
TTCACTCTCCATAATGTACAGATATCGAGAGTTGGAGACACCACATCTGC
AACTGTCAATTCAGGGTTGTTGCCTGATCTGTCAAATGCAACCTTGGAGG
ATTACCAAGGCTATAACACTGAGGTGGTGAAGGCAGCCCGACTTTGGTAC
AGCTCCATAGGAGGAGAAATGCCACTGGAGATCACTCCTAAAGTAGGTGA
CACAAAACTAGGATTTGCAATCAGCCGTACTGAGGAGGTAAGCTTTCTGT
CGCCACTTCCAGAATATCGACAATATTATGCTTCATCAATTAAGAACAAA
AGAGTTATACATCAAACATTCCATGACACAATGTTTCTTTCAGGGTTTTA
TCTACATATCTTCAGTGTT
View all "Gundil Kuning" genotypes
Guan-Yin-Tsan IRGC51300 indica   RA4968 STS032 GGCCTCTGGTGTCCCCATCAAGTTGATGAGTGTGCAGAGTGATGATCTTC
TCACCAAGGTGCAGATACAAGATTTCAATTTCATGCATTACACATGGACA
CATAATCTCACACAAGATTCGACTTGGTTTGATTCTACATGGTTTTAATC
TTCACTCTCCATAATGTACAGATATCGAGAGTTGGAGACACCACATCTGC
AACTGTCAATTCAGGGTTGTTGCCTGATCTGTCAAATGCAACCTTGGAGG
ATTACCAAGGCTATAACACTGAGGTGGTGAAGGCAGCCCGACTTTGGTAC
AGCTCCATAGGAGGAGAAATGCCACTGGAGATCACTCCTAAAGTAGGTGA
CACAAAACTAGGATTTGCAATCAGCCGTACTGAGGAGGTAAGCTTTCTGT
CGCCACTTCCAGAATATCGACAATATTATGCTTCATCAATTAAGAACAAA
AGAGTTATACATCAAACATTCCATGACACAATGTTTCTTTCAGGGTTTTA
TCTACATATCTTCAGTGTT
View all "Guan-Yin-Tsan" genotypes
Hsia-Chioh-Keh-Tu IRGC8240 indica   RA4898 STS032 GGCCTCTGGTGTCCCCATCAAGTTGATGAGTGTGCAGAGTGATGATCTTC
TCACCAAGGTGCAGATACAAGATTTCAATTTCATGCATTACACATGGACA
CATAATCTCACACAAGATTCGACTTGGTTTGATTCTACATGGTTTTAATC
TTCACTCTCCATAATGTACAGATATCGAGAGTTGGAGACACCACATCTGC
AACTGTCAATTCAGGGTTGTTGCCTGATCTGTCAAATGCAACCTTGGAGG
ATTACCAAGGCTATAACACTGAGGTGGTGAAGGCAGCCCGACTTTGGTAC
AGCTCCATAGGAGGAGAAATGCCACTGGAGATCACTCCTAAAGTAGGTGA
CACAAAACTAGGATTTGCAATCAGCCGTACTGAGGAGGTAAGCTTTCTGT
CGCCACTTCCAGAATATCGACAATATTATGCTTCATCAATTAAGAACAAA
AGAGTTATACATCAAACATTCCATGACACAATGTTTCTTTCAGGGTTTTA
TCTACATATCTTCAGTGTT
View all "Hsia-Chioh-Keh-Tu" genotypes
Jefferson x Oryza rufipogon NULL     Jefferson x Oryza rufipogon BC2F2 Line 252 STS032 GGCCTCTGGTGTCCCCATCAAGTTGATGAGTGTGCAGAGTGATGATCTTC
TCACCAAGGTGCAGATACAAGATTTCAATTTCATGCATTACACATGGACA
CATAATCTCACACAAGATTCGACTTGGTTTGATTCTACATGGTTTTAATC
TTCACTCTCCATAATGTACAGATATCGAGAGTTGGAGACACCACATCTGC
AACTGTCAATTCAGGGTTGTTGCCTGATCTGTCAAATGCAACCTTGGAGG
ATTACCAAGGCTATAACACTGAGGTGGTGAAGGCAGCCCGACTTTGGTAC
AGCTCCATAGGAGGAGAAATGCCACTGGAGATCACTCCTAAAGTAGGTGA
CACAAAACTAGGATTTGCAATCAGCCGTACTGAGGAGGTAAGCTTTCTGT
CGCCACTTCCAGAATATCGACAATATTATGCTTCATCAATTAAGAACAAA
AGAGTTATACATCAAACATTCCATGACACAATGTTTCTTTCAGGGTTTTA
TCTACATATCTTCAGTGTT
View all "Jefferson x Oryza rufipogon" genotypes
Mudgo IRGC6663 indica   RA5282 STS032 GGCCTCTGGTGTCCCCATCAAGTTGATGAGTGTGCAGAGTGATGATCTTC
TCACCAAGGTGCAGATACAAGATTTCAATTTCATGCATTACACATGGACA
CATAATCTCACACAAGATTCGACTTGGTTTGATTCTACATGGTTTTAATC
TTCACTCTCCATAATGTACAGATATCGAGAGTTGGAGACACCACATCTGC
AACTGTCAATTCAGGGTTGTTGCCTGATCTGTCAAATGCAACCTTGGAGG
ATTACCAAGGCTATAACACTGAGGTGGTGAAGGCAGCCCGACTTTGGTAC
AGCTCCATAGGAGGAGAAATGCCACTGGAGATCACTCCTAAAGTAGGTGA
CACAAAACTAGGATTTGCAATCAGCCGTACTGAGGAGGTAAGCTTTCTGT
CGCCACTTCCAGAATATCGACAATATTATGCTTCATCAATTAAGAACAAA
AGAGTTATACATCAAACATTCCATGACACAATGTTTCTTTCAGGGTTTTA
TCTACATATCTTCAGTGTT
View all "Mudgo" genotypes
Khao Dawk Mali 105 IRGC27748 indica   RA4878 STS032 GGCCTCTGGTGTCCCCATCAAGTTGATGAGTGTGCAGAGTGATGATCTTC
TCACCAAGGTGCAGATACAAGATTTCAATTTCATGCATTACACATGGACA
CATAATCTCACACAAGATTCGACTTGGTTTGATTCTACATGGTTTTAATC
TTCACTCTCCATAATGTACAGATATCGAGAGTTGGAGACACCACATCTGC
AACTGTCAATTCAGGGTTGTTGCCTGATCTGTCAAATGCAACCTTGGAGG
ATTACCAAGGCTATAACACTGAGGTGGTGAAGGCAGCCCGACTTTGGTAC
AGCTCCATAGGAGGAGAAATGCCACTGGAGATCACTCCTAAAGTAGGTGA
CACAAAACTAGGATTTGCAATCAGCCGTACTGAGGAGGTAAGCTTTCTGT
CGCCACTTCCAGAATATCGACAATATTATGCTTCATCAATTAAGAACAAA
AGAGTTATACATCAAACATTCCATGACACAATGTTTCTTTCAGGGTTTTA
TCTACATATCTTCAGTGTT
View all "Khao Dawk Mali 105" genotypes
Lal Aman IRGC46202 indica   RA4956 STS032 GGCCTCTGGTGTCCCCATCAAGTTGATGAGTGTGCAGAGTGATGATCTTC
TCACCAAGGTGCAGATACAAGATTTCAATTTCATGCATTACACATGGACA
CATAATCTCACACAAGATTCGACTTGGTTTGATTCTACATGGTTTTAATC
TTCACTCTCCATAATGTACAGATATCGAGAGTTGGAGACRCCACATCTGC
AACTGTCAATTCAGGGTTGTTGCCTGATCTGTCAAATGCAACCTTGGAGG
ATTACCAAGGCTATAACACTGAGGTGGTGAAGGCAGCCCGACTTTGGTAC
AGCTCCATAGGAGGAGAAATGCCACTGGAGATCACTCCTAAAGTAGGTGA
CACAAAACTAGGATTTGCAATCAGCCGTACTGAGGAGGTAAGCTTTCTGT
CGCCACTTCCAGAATATCGACAATATTATGCTTCATCAATTAAGAACAAA
AGAGTTATACATCAAACATTCCATGACACAATGTTTCTTTCAGGGTTTTA
TCTACATATCTTCAGTGTT
View all "Lal Aman" genotypes
Mudgo IRGC6663 indica   RA5282 STS032 GGCCTCTGGTGTCCCCATCAAGTTGATGAGTGTGCAGAGTGATGATCTTC
TCACCAAGGTGCAGATACAAGATTTCAATTTCATGCATTACACATGGACA
CATAATCTCACACAAGATTCGACTTGGTTTGATTCTACATGGTTTTAATC
TTCACTCTCCATAATGTACAGATATCGAGAGTTGGAGACACCACATCTGC
AACTGTCAATTCAGGGTTGTTGCCTGATCTGTCAAATGCAACCTTGGAGG
ATTACCAAGGCTATAACACTGAGGTGGTGAAGGCAGCCCGACTTTGGTAC
AGCTCCATAGGAGGAGAAATGCCACTGGAGATCACTCCTAAAGTAGGTGA
CACAAAACTAGGATTTGCAATCAGCCGTACTGAGGAGGTAAGCTTTCTGT
CGCCACTTCCAGAATATCGACAATATTATGCTTCATCAATTAAGAACAAA
AGAGTTATACATCAAACATTCCATGACACAATGTTTCTTTCAGGGTTTTA
TCTACATATCTTCAGTGTT
View all "Mudgo" genotypes
Pao-Tou-Hung IRGC51400 indica   RA4992 STS032 GGCCTCTGGTGTCCCCATCAAGTTGATGAGTGTGCAGAGTGATGATCTTC
TCACCAAGGTGCAGATACAAGATTTCAATTTCATGCATTACACATGGACA
CATAATCTCACACAAGATTCGACTTGGTTTGATTCTACATGGTTTTAATC
TTCACTCTCCATAATGTACAGATATCGAGAGTTGGAGACACCACATCTGC
AACTGTCAATTCAGGGTTGTTGCCTGATCTGTCAAATGCAACCTTGGAGG
ATTACCAAGGCTATAACACTGAGGTGGTGAAGGCAGCCCGACTTTGGTAC
AGCTCCATAGGAGGAGAAATGCCACTGGAGATCACTCCTAAAGTAGGTGA
CACAAAACTAGGATTTGCAATCAGCCGTACTGAGGAGGTAAGCTTTCTGT
CGCCACTTCCAGAATATCGACAATATTATGCTTCATCAATTAAGAACAAA
AGAGTTATACATCAAACATTCCATGACACAATGTTTCTTTCAGGGTTTTA
TCTACATATCTTCAGTGTT
View all "Pao-Tou-Hung" genotypes
Pin Kaeo IRGC5803 indica   RA4883 STS032 NNNCTCTGGTGTCCCCATCAAGTTGATGAGTGTGCAGAGTGATGATCTTC
TCACCAAGGTGCAGATACAAGATTTCAATTTCATGCATTACACATGGACA
CATAATCTCACACAAGATTCGACTTGGTTTGATTCTACATGGTTTTAATC
TTCACTCTCCATAATGTACAGATATCGAGAGTTGGAGACACCACATCTGC
AACTGTCAATTCAGGGTTGTTGCCTGATCTGTCAAATGCAACCTTGGAGG
ATTACCAAGGCTATAACACTGAGGTGGTGAAGGCAGCCCGACTTTGGTAC
AGCTCCATAGGAGGAGAAATGCCACTGGAGATCACTCCTAAAGTAGGTGA
CACAAAACTAGGATTTGCAATCAGCCGTACTGAGGAGGTAAGCTTTCTGT
CGCCACTTCCAGAATATCGACAATATTATGCTTCATCAATTAAGAACAAA
AGAGTTATACATCAAACATTCCATGACACAATGTTTCTTTCAGGGTTTTA
TCTACATATCTTCAGTGTT
View all "Pin Kaeo" genotypes
Popot 165 IRGC43545 indica   RA4987 STS032 GGCCTCTGGTGTCCCCATCAAGTTGATGAGTGTGCAGAGTGATGATCTTC
TCACCAAGGTGCAGATACAAGATTTCAATTTCATGCATTACACATGGACA
CATAATCTCACACAAGATTCGACTTGGTTTGATTCTACATGGTTTTAATC
TTCACTCTCCATAATGTACAGATATCGAGAGTTGGAGACACCACATCTGC
AACTGTCAATTCAGGGTTGTTGCCTGATCTGTCAAATGCAACCTTGGAGG
ATTACCAAGGCTATAACACTGAGGTGGTGAAGGCAGCCCGACTTTGGTAC
AGCTCCATAGGAGGAGAAATGCCACTGGAGATCACTCCTAAAGTAGGTGA
CACAAAACTAGGATTTGCAATCAGCCGTACTGAGGAGGTAAGCTTTCTGT
CGCCACTTCCAGAATATCGACAATATTATGCTTCATCAATTAAGAACAAA
AGAGTTATACATCAAACATTCCATGACACAATGTTTCTTTCAGGGTTTTA
TCTACATATCTTCAGTGTT
View all "Popot 165" genotypes
[ Download ]