grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "PI366153" from the experiment "Genome-wide patterns of nucleotide polymorphism in domesticated rice".

E.g., Germplasm "IRGC9542", RA4969, Basmati 1, Marker/locus RM22.

Items 1 to 25 of 101.       of 5 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
Taipei 309 PI366153 Japonica   RA5397 STS001 CCGCCGAGGAGATGGTCGTCCTCTCCGGCGCCCACACCGTCGGCCGCTCC
TTCTGCTCCTCCTTCCTCGCCCGCATCTGGAACAACACCACCCCCATCGT
ACGTACATAG----------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
ATCGATCGCCGGCGACGGCGACGGCGACCTCGCG----------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
---------------------------GCCATT-GACCATTTCGCCATTG
ACGTACGGCTCACATG---GCGGCGGCCGGTGTGTTCGATCGTGTGCAGG
TGGACACGGGGCTGAGCCCGGGGTACGCGGCGCTGCTGAGGGCGCTGTGC
CCGTCGAACGCG------TCGGCGACGGCGACGACGGCGATCGACGTGAG
CACGCCGGCGACGCTGGACAACAACTACTACAAGCTGCTGCCGCTCAACC
TGGGGCTCTTCTTCTCCGACAACCAGCTGCGGGTGAACGCGACGCTGGGC
GCGTCGGTGAGCAGCTTCGCGGCGAACGAGACGCTGTGGAAGGAGAAGTT
CGTCGCCGC
View all "STS001" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS002 ATTTGCTAACCAACTCACTCAAGGTTACAACAAGAAACTGAAGAGGATGA
TCTACAAGCTGAACCAGGAGATGGGGCCTGAGAGTAGATTTGTTTACGCA
AACACGTACGAGATCGTGATGGAAATCATTCAGCAGTACCGTCAATACGG
TGAGCTTTCTTCCTTGCTGCAGCTACCTCTTGCGAAAACCACCTGCGAAT
GCTGTGCTGCAGTCTGCAGAGCATTAGAAAATGCAGAATATTTCAGTCTT
GCATTTGTCTTCAGGTTTTGAGAATGCGCTGGACCCATGCTGCGGAGGCA
GCTTCCCTCCATTTCTCTGCATCAGCATCGCTAACTCAACCTCCACCTTA
TGCAATGACCGGTCCAAGTACGTCTTCTGGGACGCGTTCCACCCGACCGA
AGCCGTCAACTTCATCGTCGCCGGCAAGCTTCTCGACGGCAACTCCGCCG
TTGCTTCTC
View all "STS002" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS003 TTCTGGGAATAAAGAAGACAACACCAGCTATCGCATCAGCCATGCCAAAC
TTGAGCCCTGGACTCATCTTCATCATTGCGGCTTGTTTCAGGTATAGTAG
TAGCTGCTTATAGATGAAGCTGCAATTGATGACCTACCTAAGATATATAC
ATTTACCTGAATTATTACATATACTTAAGGTTGGAGAAGTTTGACAAGGG
ATGCAAGTACACAAGAGCCAAGATACTGGGAACGTTGGTGTGCTTGGTGG
GAGCTATGGCCATGAGCTTCTTGCAGAGTCCCGTTTCGTCTTCTCCACAA
CTCACAACAACTAGTTACTATGACTGGATCCTTGGTTGCTTCTACCTTTT
CCTGGCAGTAGTTGTTCTCTCTATCTACACGGTGCTCCAGGTAATCATCA
ATTACTACTAATTCACTCACTCTACATACATGCATG----TAGTTTCATT
GTTAGCTAGCTGCTCATGGATTACTGAAACTTGCAACAATATATACTCAT
GGTATTATTCAGGCAGCGACGTTGGTGAGCTTCCCTGC
View all "STS003" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS004 TTATATAGGTATGTAGCAAAAAGAAGCAAAAAATAATAGACTACTTTTAT
CACTTATGTGTTAATGTAAATTCTATTTAATAAAATGGCATGTTTTTTGT
TTTTGGAAAACATGCGAATCTCTTGTTGTTTAAACAGTTGTGAAGTCTTA
TCAGTACACATCTTTGACAAGCGTGATGCTCTTGGATTGCTGGTCAATTC
CTTGTGTGATTATTCTTACATGGATATTTTTGAAGACCAAGTATGGGCTC
AGGAAGTTCATCGGTGTTGGAGTTTGCGTGGCTGGACTTATATTAGTAGT
ATTTTCAGATGTCCATGCCTCTGATCGAGCTAGTAAGGACATAACTTCTC
ATGATGCAATTTGTACTAGTTACAGCAATATATACTTTTTATGTTTTTCT
TTTCACAAATTCTGATCAGTGATCAGAATATAAGTACAGTTTCTGAAATG
TATTGCAGAAGGAC
View all "STS004" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS005 TCCTCAGTTCCTCCAAGTCCTCCTTACAGAGTAACTGGCATGTATGGAAC
ACCTAGATATCCTGCAGAGAAATCGGTGCTATTGAAAAAGAATAATGTGA
TTCATCGGCAAGGCGTCGGTCGATCCGAAGGCGACGCAAACATGAACCAC
ACCGGCAAAGGAACTGTGGATAAGTGGCTTCAAATGCTCATGGAGGATCA
GCAGCAGCAAGAAGATCCTGCAGCAGCATATCATTCTTCTGAAGATCACA
ACACTGCTGATGAAATCGCTTCAGACGAGCACCAAATGCAAAGCAGAATT
GATGATGAGAGCTGCAGGAATGAGATCACCGAATGCTCCGATGAGATCGT
CGAGGTCGGTGGCGATGGTGCTACTGAGCAGCAGGACAGGTGCAGGAACA
GCTTTGAGATCAAGGAGAGGGGAGAGGAGAAGAAGATCTGGTTCCCAAGG
TCTGACAGCTCCAGGGGTTTCAGGTCTCTG
View all "STS005" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS006 CCCCACCTGCCCCGGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAATGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTATACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTACCAGCTCAGTGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATCGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "STS006" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS007 AAAGATTTTCTGTCAGTTCCTGTGGCAGAAATGACTCATCTTTGGCCTTA
CAAAAATCAGGTGACAACCATGTTGCCTGCCAATCAGGACAACCACCTCT
GGCTGTGCATACTGAGCTCCAACATGACACTTCTATTGTAATATCCAGTG
GTGAAGAGAAGGTCCTTTTTGACCTTAATGTGCCAGCTGAAAGCATTGAC
ATGGAATCAACAATAACCAGTAATAGTTTTAGAGATAAGCTAGTGAAAAA
TGATGGAAGTGAAGAAACAGTAACCGATCATTCTTTCTCCAAGAGAAACG
GTGTGCATGCTGAAACTTCTATAGAAGAACGAACTGTTGGAGAACATCAT
ATATCAGTCAGCAAGGATGGAAACACCACATTTTTCCAAGAATCAATAAA
TAATGAAATTGATAAGGCGCAGTCTTCAGACCTTATAAGTGTTAGCAGCA
AACATTTGATTGCAGAAACTCCTCATGTTGACAATATTGTGTGTCCAGAA
CTGCGAGCATCTCCTGATGGA
View all "STS007" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS008 TTAAGCGGGCAATTGCAACGAGCATTTGTCACAGGTACACGCTTCCTCTA
CATGTATATTTTGTGTGTCTTATATCTAGTATTTCAGTTACACCTTACAC
CATGACCCATCAATCTTTTATCCCAGGTGTACCTTCATTGAAACGGTCTG
AGCTGGAAGCAGCATGTGAGGATTTCAGCAATATAATTGGTTCTACATCT
AGTTGCATGTTGTACAAGGGAACTTTATCAAGTGGAGTTGAAATAGCAGT
TTTGACAAGTTCAACAGAATCCGGGAAGGAATGGTCAAAAGAATGCGAGT
CACAGTACAGAAAAAAGGTAACATGTGCTCATAACTTTTAGGATATCCCC
TAAAATACAAATATGTTTTCTGTGGTGCAAATGACTTTTCTCAGAAATGT
GCGTATGCTTTTTCTCATCTTTACTGTGCGAATGGCTGAAATGGTTATGA
TTTCAGATCACAAATTTATCCAAAGTTAGCCATAAGAACTTTATGAATCT
GCTCGGCTATTGTGAAGAAGAG
View all "STS008" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS009 GGTTGTTGACTATTCCTTTGGAGGTTATAGCTACATTAAGTGTGAGGCAG
TCCTAGAAGAGAACAAAATATGTGGGCATATTGGGCACCTTGATTGTGCT
CTCCGTACTTTTATGGCTGGAACAGTTGGAGGATGTATTGACTTGGACAT
GCAGTATTGTTGCAGACGTTGTGATAACAAAACGAACTTGATGCTGCACG
TAGAAAAATTCTTGGAAATATGCCAATCTCTTCAATCAAGGGATGACATT
GAACCTATCCTGAATACTGGCTTATGCCTAGTGCGTGGTTCAAGACAAAC
AAGAGCAAAAAGCTTGGAGAGCATTATGAGATCAGCAATGGCAAAGGTAT
GGTCAGTTTTATTTTTTT-AGCCACTTGTGGAAACTTCCATTTTGGTCAC
CATTTATCTTCTTTTTGATCTCTTATAAGTAGTTTGTGGCTATGCACTGA
TGGTTTACAACTATATGCAGCTAAAGTGTGGGGTTGATCTTGCTGAAGTT
View all "STS009" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS010 CACCAAGGTGAGCGTTGGTTGCTTAGCTAATGATATTAGCTTCCTTAATT
-----GCGTTGTTTAGATTGTATTAACGTTTAACTAATCACGCAATGGGT
TCATGGATGGATGCAGGTGAAGATCCTGAGGAGGGAGTCCTACTGGTACA
ACGGCACTGGCTCCGTCGTCACCGTTGATCAGGTACGTACA---------
--------------------AATCTCATAGCCTTCACATGAATCAGTTCA
ATTCTCCTAGTACTCCAATCGATAATCAAAAGGAAGAAATACTTTTAAGC
AATGAATAATAATCAATTAATGGTTGAATTGAATTGACTGGATGCAGGAT
CCCAACACTCGCTACCCGGTGGTGGTTCGGTTCGCCAAGGTGAACTACGC
CGGCGTGTCGACCAACAACTACGCC
View all "STS010" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS011 GACTTCAGTTTATCACCTTTGCTAGCAGCACAATCAATGACAAAATATAA
CTCAGCTGCACCAACTACTACTGGACCAGCAATCTCCATGCAAGAGGTAA
TTTAACTACGCTGGTTCACTTTCTCATGGTGTTTTCTCTGGATTCATATT
TCATAGAAGTATAACTTTAGGAAGAAAAAGGCTCCACATCCTTTCTTTAT
TTGAAAGATGAATTTACAAGGGTGTGATGGTGTTGGAATTTTTTATTTTG
TGTGCATATACAGTTAATCATTCAGCAACAAGTAATCTCTAGTTCTCTAA
TTTTCTTCACACACATGTACATATTTGTTTCAGACTCTGAAGCCAGGAGT
TTTCTCCAACGCTCAATCTACCCAAAATCTTCCAAGTACTAGTATAGCAA
CGGGGCCTCCTCTCCCTCAGCAATTAGTCCACCCTTACTCTCAGCCTACT
GTACCACTGGCGCCTTTTGCGAATATGATTGGTTATCCGTATTTGGCACA
GAACTACCCTGCTGCTTACCTACCATCAG
View all "STS011" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS012 AAAGGTTTCAAGTACAAAAGTCGAAGAGCTCCAAGTAGATGTGGCGTCTA
TGGATGTTGAAATCTCTGCGTTAATGAAGCTATTTAGAAAAATAACAGAA
AACGACCGAGCCCCTTACTCGAGGGAGAGAGCCGATGATTCATCTTTGGA
ATGTGAACCGGTTCAACTTGACGTAAGCTCATTTTTTCCTTGTTATAGTT
TCCTTTCGCTCTTCAACCCAAAGTACGTCATGTAGTTTTACCACCTCTTT
GATGAGCGATTGTTTTT-CCTCAATACAATTGGCTAAACGTCCTACTTGA
TATGGGCAGGATATGGTTGGTGACATCGACATGGAGAAGATGGAGCAGGA
AATGTCTGCATACGCTACAGCTCTCGCTGCCGCGAAAGACAATCCTACTG
A
View all "STS012" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS014 CCGGAGGAGGACGAGAAGCTGTTCAACCACATCAGCCGCTATGGCGTCGG
CTGCTGGAGCTCCGTCCCAAAGCTCGCCGGTACGCCCATCGATCAGTGTA
TGCATTAGTAACCAAAAT----GGCAAACTGACAAGCTAAGCTAAACTTG
GGTTAATTA--ATCACTTCTTTTCTCCTGAATAATAATGCTAATTGCTTA
CATCAATGTGTTTATAGTATTTCAGTTTATTATTTCATCAATTTCTGTCC
TGCTGCATAATGCTCACT------ATAGAAATGTGTTTATATC-------
----------------------------------------GTAATTTAGT
TGCTATACCTCTCTCTTTGTATCTC------ACTCTCTGACAGTGTGTGA
ATAATATAATGTGTGTTGCTGAGTTGCTGTGTACAGGATTGGAGAGGTGT
GGCAAGAGTTGCAGGCTGAGATGGATCAACTACCTGAGGCCTGATCTCAA
GAGAGGCAGCTTCTCCCAGCAGGAGGAGGAGCTCATCATCAG
View all "STS014" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS015 TTATAATGCCAGACGGCCTATGAAACAAAGGTACTTTTTCTTATGAGGCC
CGAAAGTTTTAGTTTATAGTTAGCTATATGATCCACCTTTGTTAATGCAG
TACAATGCAACATACATGTTCTATATTTTGCAGGTATCACTACAACGTTG
CAGATTCAAGGCTTGTACAACACATTGACAAAGGGAATGAAGATGGTCTG
TTTATCAGTTGCATAACATCTTGCTCAAATCTGTGGGCTCTAATCATGGA
TGCTGGCACTGGGTTCACTTCCCAGGTTTATGAACTTTCACCACATTTTC
TTCACAAGGTGAGTAGCTTGCTCCTTGTTTAACTGGTGGAAAATCTTAGC
AAACTAATCACATAACTTTTCAAGGCAAAGTTACATATAAGGAAGCTCTT
GTATACATTGTCAAATGTGATTCCATGGTTTTCTGGTCATT
View all "STS015" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS016 GAGCGGAGTTACCATCAATGGGAAGCGAGCGGTCGTGGTTGGCCGCAGCA
ACATTGTCGGGCTACCTGTATCCCTGCTTCTTCTGAAGGCGGATGCGACC
GTATCCATTGTTCACTCCCGGACCCCAAACCCTGAAAGTATTGTCCGTGA
AGCAGACATTGTCATTGCAGCGGCTGGCCAGGCTATGATGGTACATTGTT
CTACCACCAAATTATGACATGGTTCATCACAAT--------CCA----CT
GCCCAGTTCTAACTGCAGATTTCTTGGTTGCCAGATCAAAGGAGACTGGA
TCAAACCAGGCGCTGCTGTCATCGACGTTGGGACGAACTCCATCAGTGAC
CCAACCAGGAAATCGGGGTACAGACTCGTCGGCGATGTGGATTTCGCAGA
GGTGAGCAAGGTTGCTGGTCACCTGACTCCAGTCCCAGGTGGCGTTGGCC
CCATGACGGTGGCGATGTTGCTGAAGAACACGG
View all "STS016" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS017 CATTTCTTTCTGCTAAACTTTGCAAGACTCGTCCCCTGGTAGTAGTAGCA
GCTATGGAGGTCTCGAAGGAAGCCCCTTCTGCTGACTTTGCCAATCGCCA
GCCTTCCAAAGGTTGTTGCTGAGAACTCCATCTTATTAAATTGATTGATA
TGCCTCTGCGGGTTGCACTGTCTCCAGTTCTAAATTTAATATAACTTTTG
TCCTTGCATGATTCTGTTAGGGGTTCTTGAGACATGGTGCAATGCCGATG
CAGTGTGTTTTGATGTTGATAGCACGGTCTGCTTGGATGAGGGTATTGAT
GAACTCGCTGATTTCTGTGGGGCTGGGAAGGCTGTTGCTGAGTGGACTGC
AAAGTAAATAACATGTTATGAACATTAGTTTTGAAGTGTGTTTGTTGCTT
AGTGCATAAAATTCATTCAGGATGCTCATTGGTTTAATATTCTTAGGGCA
ATGACAGGAAC
View all "STS017" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS018 GTGTATTTTGCTCATTGCACGTCAGAGATGATATTCATTACTCATTTGCT
CACAGAACAACCTGAGAAACTTGCTGGCCCTCTGCTGGCTGATACTTATG
TTACTCTCCTGAAAGGTCGCAATGCGTGGTATGGGCAAATGCTAGCGAAG
GGAGAACTGAGCCCTGACATGGGCGACAGCATCAAGGGGAAGGGGATGAT
TCAGGTTATCTCATAAAACTACTCATTATTTTCCCCGAAAGTTATATGAA
TTTTGAGCGTATTTTTGAAGAATGCTGGAAGTCAAAACTTGCAAAAGATA
TCACATCATCCTGGATATAACCTGTTCACTTTTCACTCTACAGGGTATCT
CTGCTGTTGGTGCATTTTTTGAGCTTCTCAGTCAACCCAGCTTAAGTGTN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
View all "STS018" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS021 TGGTTCCAGTCACTATGACATTGAGGTGGCACCCCGCCGGTTGGAAAGCT
TGATAATTTCTAGCGGTGAGGTCATCTACTCACTTGAGTTCTCATACATT
GACCACAGTGGGCAGCAGCACACATCAGGCACATGGGGCGGCTATGGCCC
AAATAAAGGGAACAAACATACTAAGGTGACTATGAATCTTATTATTCAAT
TCTTGCATTTTTCTTTTAGATAAAATGATTGGTATACATTCATTATCTCT
GCACACAACTAGTGAAATTTATAATAGGTTTACTAGTAGTATTATGTTAT
TTTGAAACTTTTCTTGCAGATTGAGCTTGGTCTTATAGAGTATGTAACGG
AAGTTTCTGGGACAATCGGACCATTTGATAGGGCACCCGCTGGTGTTATT
ACATCGCTTATGTTTATCACTAATAAGGGAAGCTACGGACCTTTTGGAGA
AGTAAGAGGAACTCCTTTCCACATCCCAGTGCAGGACAATGGCAGCATTG
TTGGCTTTTTTGCACGTGC
View all "STS021" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS022 TGTTGGATCATTATTACAAGAGTGCTGTTTGGCACTGAATAAATTGCATC
CCTAGTTGAACATAAGAGTCAATCTTTGCTTTTCCTCCAGTTAAGCGAGC
TAAGAAGTACGTATATCATACCTGAGCCTGCCTTTTCTTTGCTCTTATGA
AGCTTGCTGGAAAAAACTCACACCATATTATTGAGGCAACTTTCAAAGCA
TTTGCTAGAGCCCTTCGACAAGCAACAGAATATGACTTGCGCCGACGCGG
CACTGTCCCCAGGTTCGTTTTAGCTTATTGCAAATAGCGTTTAGGAAATT
CTATGTTGTGCCCAACTACACTGTTGATGCCTGATTCAAAAACTTCACAC
CTGCTAAGCATATGGTTTATCTCTGACCTTTGCTGATATTGAAACATTAA
CGTATCTTTCTTGACTTGATCGCAGCTCAAAAGGTGTGTTGTCAAGGTCA
TAGTGTTGCAGGTTTGGAAAACAAGGGGTGCATGCTACTGTTCCTTGTAG
ATTGCAATATTCAAAGGAAACAAATGGAATGGCCTCTACAGCT
View all "STS022" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS023 GAGCAACTCAGGGTATAGATAATCTGAAAACAAACCACTTGAATCCCATG
ATGAAAACCATTTCACACTTCGAGTTTACTGATGATCTGTTCACTTCTGC
AGAAAGAACATTTTGATATCAGGAAAGGTAAAGCGCCCGAAGATGCCATC
GACTGGAATGATTTCAAGTCCATGACCTTCACTCGAGCTGTAAGTTTGAT
GATGATAAACTCAGAAAGCAGCCACAGTAACAGTGTAGTCTGATCATGAT
GAACTCATGGGCACTTTTACTATGCAGGTTATCTTCGAGACATTAAGATT
AGCTACAGTTGTGAATGGGCTGCTGAGGAAAACTACCCAAGATGTTGAAA
TGAATGGTGAGATATGCATGATATATACGCTGCTGCAATTAGCATCTTTT
TGATAAATCTTTGGATAGCCCTAATGCAGTGCTTATTTGTTTCTTCCAGG
GTATGTTATCCCAAAAGGTTGGAGAATATATGTTTACACAAGGGAAATAA
ATTA
View all "STS023" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS024 TTCTTTTATAAGGTAATTCTAATTTTGTCCTGAAATGCATTAATTATTTA
CTCTACTTGTATTGCTAGCTAGCTAGCTAACAACATCATCGTGCTCTTCT
TGTTAGCTTTTCTCAAATGGCATGAAAGAATCTGATCAGAGGCATGCTAC
TCTTAGAATAACTGCTTCAGGTAATTCTGTAGTTCATTGTTCATTGTTTG
TTTCTGTTTGACAAAAACTATAATTTCTGCACTATCCTATGACTGTCTGT
AACGTTTTTCTTTATATTGCTGATATGATCAGTTTTGGTGGAACTTAAAG
CTTATATCGATCTGATATTTAATAGTCCTGAATATTTATTCAAATTGATA
TTCTAGAATTCAATGTTGTGCATTTTCCTATATCATCTCTCAAGAATTAT
CAAGAAGTGTATGCTTCATTTGAAACTTTTCCAAATGAGAATAAGGGAGA
TTTTTCTGCTATTTGATTTTCTTGTAAACAGAT--AGCTTTTATCTGATC
ATTGTATGTCTATCTGAAACAGA
View all "STS024" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS027 GTGAACACCGGTTTCCTTTCCTTGTTAAGGTACAAGGACCCAAGACTATG
ATACTAGTTGTAATTATTCTTTTCAAATTTCCTGTAAGGCTGTAACTGTT
ACAACCCTGGCAGGTTAACAATTGGAATAGGTTCAATTGCAACAGTGGAG
GAACTCTTGTTGAGAAGTGCTGCCATTTTTTTGATTTGATGAGATTGTTT
GCAGCTGCAAACCCTGTTCGTGTGATGGCTTCTGGAGCCATTGATGTCAA
CCACAAGGATGAAATTTATGATGGGAAGGTCAGGTTAATTGACTACAAGA
TCGCTGATTTATAAGCTGGATGGCATTTTCACTCATGTGATTATTTATAA
GCTTATAAAGGCTATATTTATAAGCTGCAGCGCATTTTTTGTGCTTATCG
GGTTATGGTGGTCTCAGTTTAAACAGCAGTCCCTGATTTTAACTTCTTTC
TCAATGCAGGTTCCAGATATTATAGACAATGCATATGTAATAGTAGAATT
TGATAATG
View all "STS027" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS028 GTGAACACCGGTTTCCTTTCCTTGTTAAGGTACAAGGACCCAAGACTATG
ATACTAGTTGTAATTATTCTTTTCAAATTTCCTGTAAGGCTGTAACTGTT
ACAACCCTGGCAGGTTAACAATTGGAATAGGTTCAATTGCAACAGTGGAG
GAACTCTTGTTGAGAAGTGCTGCCATTTTTTTGATTTGATGAGATTGTTT
GCAGCTGCAAACCCTGTTCGTGTGATGGCTTCTGGAGCCATTGATGTCAA
CCACAAGGATGAAATTTATGATGGGAAGGTCAGGTTAATTGACTACAAGA
TCGCTGATTTATAAGCTGGATGGCATTTTCACTCATGTGATTATTTATAA
GCTTATAAAGGCTATATTTATAAGCTGCAGCGCATTTTTTGTGCTTATCG
GGTTATGGTGGTCTCAGTTTAAACAGCAGTCCCTGATTTTAACTTCTTTC
TCAATGCAGGTTCCAGATATTATAGACAATGCATATGTAATAGTAGAATT
TGATAATG
View all "STS028" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS030 AAACATAAGTCTTCAACCCTCAGGATTGTTGGATATGTTCTTCTAGCTAT
TGTCCTGTTTATAGTTACAGTGCTGCTGGTAATATTTTGCCTGTCCAAGT
ACCAAGAGAGACAGTCAAGACGTGATTATACAACAAGTCAGGTGGGGAGG
GTTCATCAGAGGGTTGAAGAGCCGAAAGTTAAGCAAGCTTCAGTGCAGTC
AAGGAATGATGCCAAAAAAGGTCAACAATTAATTTATATATTCTGTAATA
TATTTCTGATTATATTTTATTTGTTTTATATCACAGCATATTGATGTTCT
ATTAACAGGATCAACAGAGGTTCCTGAACGGAGGCAGGTTCGTGAAATAA
ATTTGGCGGTACCAGGTATAGATGCTTGTAAATCTGATCTATCAGGTCTT
TTAGTACTGTAATACTATTCACATTTTTAAGTTCAGATGTATAAAATAAC
TATTCAATTGCTGGCAGCTGCTCT
View all "STS030" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS031 ATTGCCCAGCCAAAGGTTAGAACTTGTTTATCAGTTTGCATTTTGTTTGG
TATCAACTGTCATTATTAGTGGAAAATATTCACCTTTGATTTTTGCAGGG
TGTCCTTCTTTACGGGCCTCCGGGTACAGGAAAAACGCTACTAGCTCGGG
CAGTTGCTCATCACACCGACTGTACCTTTATTAGGGTGTCAGGTTCCGAG
TTGGTTCAGAAGTATATTGGAGAGGGTTCCAGAATGGTTCGTGAACTATT
TGTGATGGCCAGGTAAACATTTTCTGTTGATGATACATTGAAATTTACCA
TATATTCAATGGGATCTGAAAATCCTTCATTGGGAAGGATGCTTGCATTG
CTTTACACTATTCAGTAGGCTGACGTCTTTGGTTTGAATTTTGACAGAGA
GCATGCACCATCCATAATCTTTATGGATGAAATAGACTCCATTGGATCTG
CTAGAATGCAGTCAGGATCTGGGGGT
View all "STS031" genotypes
[ Download ]