grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "RA5539" from the experiment "Genome-wide patterns of nucleotide polymorphism in domesticated rice".

E.g., Germplasm "IRGC9542", RA4969, Basmati 1, Marker/locus RM22.

Items 1 to 25 of 102.       of 5 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
M-202 RA5539 japonica, temperate japonica   RA5539 STS001 CCGCCGAGGAGATGGTCGTCCTCTCCGGCGCCCACACCGTCGGCCGCTCC
TTCTGCTCCTCCTTCCTCGCCCGCATCTGGAACAACACCACCCCCATCGT
ACGTATACAG----------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
TTCATTCGCCGGCGACGGCGAC----------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
---------------------------GCCATT-GACCATTTCGCCATTG
ACG-GCGGCTCACACG---GCGGCGGCCGGTGTGTTCGATCGTGTGCAGG
TGGACACGGGGCTGAGCCCGGGGTACGCGGCGCTGCTGAGGGCGCTGTGC
CCGTCGAACGCG------TCGGCGACGGCGACGACGGCGATCGACCCGAG
CACGCCGGCGACGCTGGACAACAACTACTACAAGCTACTGCCGCTTAACC
TGGGGCTCTTCTTCTCCGACAACCAGCTGCGGGTGAACACGACGCTGGGC
GCGTCGGTGAGCAGCTTCGCGGCGAACGAGACGCTGTGGAAGGAGAAGTT
CGTCGCCGC
View all "STS001" genotypes
M-202 RA5539 japonica, temperate japonica   RA5539 STS002 ATTTGCTAACCAACTCACTCAAGGTTACAACAAGAAACTGAAGAGGATGA
TCTACAAGCTGAACCAGGAGATGGGGCCTGAGAGTAGATTTGTTTACGCA
AACACGTACGAGATCGTGATGGAAATCATTCAGCAGTACCGTCAATACGG
TGAGCTTTCTTCCTTGCTGCAGCTACCTCTTGCGAAAACCACCTGCGAAT
GCTGTGCTGCAGTCTGCAGAGCATTAGAAAATGCAGAATATTTCAGTCTT
GCATTTGTCTTCAGGTTTTGAGAATGCGCTGGACCCATGCTGCGGAGGCA
GCTTCCCTCCATTTCTCTGCATCAGCATCGCTAACTCAACCTCCACCTTA
TGCAATGACCGGTCCAAGTACGTCTTCTGGGACGCGTTCCACCCGACCGA
AGCCGTCAACTTCATCGTCGCCGGCAAGCTTCTCGACGGCAACTCCGCCG
TTGCTTCTC
View all "STS002" genotypes
M-202 RA5539 japonica, temperate japonica   RA5539 STS003 TTCTGGGAATAAAGAAGACAACACCAGCTATCGCATCAGCCATGCCAAAC
TTGAGCCCTGGACTCATCTTCATCATTGCGGCTTGTTTCAGGTATAGTAG
TAGCTGCTTATAGATGAAGCTGCAATTGATGACCTACCTAAGATATATAC
ATTTACCTGAATTATTACATATACTTAAGGTTGGAGAAGTTTGACAAGGG
ATGCAAGTACACAAGAGCCAAGATACTGGGAACGTTGGTGTGCTTGGTGG
GAGCTATGGCCATGAGCTTCTTGCAGAGTCCCGTTTCGTCTTCTCCACAA
CTCACAACAACTAGTTACTATGACTGGATCCTTGGTTGCTTCTACCTTTT
CCTGGCAGTAGTTGTTCTCTCTATCTACACGGTGCTCCAGGTAATCATCA
ATTACTACTAATTCACTCACTCTACATACATGCATG----TAGTTTCATT
GTTAGCTAGCTGCTCATGGATTACTGAAACTTGCAACAATATATACTCAT
GGTATTATTCAGGCAGCGACGTTGGTGAGCTTCCCTGC
View all "STS003" genotypes
M-202 RA5539 japonica, temperate japonica   RA5539 STS004 TTATATAGGTATGTAGCAAAAAGAAGCAAAAAATAATAGACTACTTTTAT
CACTTATGTGTTAATGTAAATTCTATTTAATAAAATGGCATGTTTTTTGT
TTTTGGAAAACATGCGAATCTCTTGTTGTTTAAACAGTTGTGAAGTCTTA
TCAGTACACATCTTTGACAAGCGTGATGCTCTTGGATTGCTGGTCAATTC
CTTGTGTGATTATTCTTACATGGATATTTTTGAAGACCAAGTATGGGCTC
AGGAAGTTCATCGGTGTTGGAGTTTGCGTGGCTGGACTTATATTAGTAGT
ATTTTCAGATGTCCATGCCTCTGATCGAGCTAGTAAGGACATAACTTCTC
ATGATGCAATTTGTACTAGTTACAGCAATATATACTTTTTATGTTTTTCT
TTTCACAAATTCTGATCAGTGATCAGAATATAAGTACAGTTTCTGAAATG
TATTGCAGAAGGAC
View all "STS004" genotypes
M-202 RA5539 japonica, temperate japonica   RA5539 STS005 TCCTCAGTTCCTCCAAGTCCTCCTTACAGAGTAACTGGCATGTATGGAAC
ACCTAGATATCCTGCAGAGAAATCGGTGCTATTGAAAAAGAATAATGTGA
TTCATCGGCAAGGCGTCGGTCGATCCGAAGGCGACGCAAACATGAACCAC
ACCGGCAAAGGAACTGTGGATAAGTGGCTTCAAATGCTCATGGAGGATCA
GCAGCAGCAAGAAGATCCTGCAGCAGCATATCATTCTTCTGAAGATCACA
ACACTGCTGATGAAATCGCTTCAGACGAGCACCAAATGCAAAGCAGAATT
GATGATGAGAGCTGCAGGAATGAGATCACCGAATGCTCCGATGAGATCGT
CGAGGTCGGTGGCGATGGTGCTACTGAGCAGCAGGACAGGTGCAGGAACA
GCTTTGAGATCAAGGAGAGGGGAGAGGAGAAGAAGATCTGGTTCCCAAGG
TCTGACAGCTCCAGGGGTTTCAGGTCTCTG
View all "STS005" genotypes
M-202 RA5539 japonica, temperate japonica   RA5539 STS006 CCCCACCTGCCCCGGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAATGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTATACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTACCAGCTCAGTGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATCGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "STS006" genotypes
M-202 RA5539 japonica, temperate japonica   RA5539 STS007 AAAGATTTTCTGTCAGTTCCTGTGGCAGAAATGACTCATCTTTGGCCTTA
CAAAAATCAGGTGACAACCATGTTGCCTGCCAATCAGGACAACCACCTCT
GGCTGTGCATACTGAGCTCCAACATGACACTTCTATTGTAATATCCAGTG
GTGAAGAGAAGGTCCTTTTTGACCTTAATGTGCCAGCTGAAAGCATTGAC
ATGGAATCAACAATAACCAGTAATAGTTTTAGAGATAAGCTAGTGAAAAA
TGATGGAAGTGAAGAAACAGTAACCGATCATTCTTTCTCCAAGAGAAACG
GTGTGCATGCTGAAACTTCTATAGAAGAACGAACTGTTGGAGAACATCAT
ATATCAGTCAGCAAGGATGGAAACACCACATTTTTCCAAGAATCAATAAA
TAATGAAATTGATAAGGCGCAGTCTTCAGACCTTATAAGTGTTAGCAGCA
AACATTTGATTGCAGAAACTCCTCATGTTGACAATATTGTGTGTCCAGAA
CTGCGAGCATCTCCTGATGGA
View all "STS007" genotypes
M-202 RA5539 japonica, temperate japonica   RA5539 STS008 TTAAGCGGGCAATTGCAACGAGCATTTGTCACAGGTACACGCTTCCTCTA
CATGTATATTTTGTGTGTCTTATATCTAGTATTTCAGTTACACCTTACAC
CATGACCCATCAATCTTTTATCCCAGGTGTACCTTCATTGAAACGGTCTG
AGCTGGAAGCAGCATGTGAGGATTTCAGCAATATAATTGGTTCTACATCT
AGTTGCATGTTGTACAAGGGAACTTTATCAAGTGGAGTTGAAATAGCAGT
TTTGACAAGTTCAACAGAATCCGGGAAGGAATGGTCAAAAGAATGCGAGT
CACAGTACAGAAAAAAGGTAACATGTGCTCATAACTTTTAGGATATCCCC
TAAAATACAAATATGTTTTCTGTGGTGCAAATGACTTTTCTCAGAAATGT
GCGTATGCTTTTTCTCATCTTTACTGTGCGAATGGCTGAAATGGTTATGA
TTTCAGATCACAAATTTATCCAAAGTTAGCCATAAGAACTTTATGAATCT
GCTCGGCTATTGNGAAGAAGAG
View all "STS008" genotypes
M-202 RA5539 japonica, temperate japonica   RA5539 STS009 GGTTGTTGACTATTCCTTTGGAGGTTATAGCTACATTAAGTGTGAGGCAG
TCCTAGAAGAGAACAAAATATGTGGGCATATTGGGCACCTTGATTGTGCT
CTCCGTACTTTTATGGCTGGAACAGTTGGAGGATGTATTGACTTGGACAT
GCAGTATTGTTGCAGACGTTGTGATAACAAAACGAACTTGATGCTGCACG
TAGAAAAATTCTTGGAAATATGCCAATCTCTTCAATCAAGGGATGACATT
GAACCTATCCTGAATACTGGCTTATGCCTAGTGCGTGGTTCAAGACAAAC
AAGAGCAAAAAGCTTGGAGAGCATTATGAGATCAGCAATGGCAAAGGTAT
GGTCAGTTTTATTTTTTT-AGCCACTTGTGGAAACTTCCATTTTGGTCAC
CATTTATCTTCTTTTTGATCTCTTATAAGTAGTTTGTGGCTATGCACTGA
TGGTTTACAACTATATGCAGCTAAAGTGTGGGGTTGATCTTGCTGAAGTT
View all "STS009" genotypes
M-202 RA5539 japonica, temperate japonica   RA5539 STS010 CACCAAGGTGAGCGTTGGTTGCTTAGCTAATGATATTAGCTTCCTTAATG
-----GCGTTGTTTAGATTGTATTAACGTTTAACTAATCACGCAATGTGT
TCATGGATGGATGCAGGTGAAGATCCTGAGGAGGGAGTCCTACTGGTACA
ACGGCACTGGCTCCGTCGTCACCGTTGATCAGGTACGTACA---------
--------------------AATCTCATAGCCTTCACATGAATCAGTTCA
ATTCTCCTAGTACTCCAATCGATAATCAAAAGGAAGAAATACTTTTAAGC
AATGAATAATAATCAATTAATGGTTGAATTGAATTGACTGGATGCAGGAT
CCCAACACTCGCTACCCGGTGGTGGTTCGGTTCGCCAAGGTGAACTACGC
CGGCGTGTCGACCAACAACTACGCC
View all "STS010" genotypes
M-202 RA5539 japonica, temperate japonica   RA5539 STS011 GACTTCAGTTTATCACCTTTGCTAGCAGCACAATCAATGACAAAATATAA
CTCAGCTGCACCAACTACTACTGGACCAGCAATCTCCATGCAAGAGGTAA
TTTAACTACGCTGGTTCACTTTCTCATGGTGTTTTCTCTGGATTCATATT
TCATAGAAGTATAACTTTAGGAAGAAAAAGGCTCCACATCCTTTCTTTAT
TTGAAAGATGAATTTACAAGGGTGTGATGGTGTTGGAATTTTTTATTTTG
TGTGCATATACAGTTAATCATTCAGCAACAAGTAATCTCTAGTTCTCTAA
TTTTCTTCACACACATGTACATATTTGTTTCAGACTCTGAAGCCAGGAGT
TTTCTCCAACGCTCAATCTACCCAAAATCTTCCAAGTACTAGTATAGCAA
CGGGGCCTCCTCTCCCTCAGCAATTAGTCCACCCTTACTCTCAGCCTACT
GTACCACTGGCGCCTTTTGCGAATATGATTGGTTATCCGTATTTGGCACA
GAACTACCCTGCTGCTTACCTACCATCAG
View all "STS011" genotypes
M-202 RA5539 japonica, temperate japonica   RA5539 STS012 AAAGGTTTCAAGTACAAAAGTCGAAGAGCTCCAAGTAGATGTGGCGTCTA
TGGATGTTGAAATCTCTGCGTTAATGAAGCTATTTAGAAAAATAACAGAA
AACGACCGAGCCCCTTACTCGAGGGAGAGAGCCGATGATTCATCTTTGGA
ATGTGAACCGGTTCAACTTGACGTAAGCTCATTTTTTCCTTGTTATAGTT
TCCTTTCGCTCTTCAACCCAAAGTACGTCATGTAGTTTTACCACCTCTTT
GATGAGCGATTGTTTTT-CCTCAATACAATTGGCTAAACGTCCTACTTGA
TATGGGCAGGATATGGTTGGTGACATCGACATGGAGAAGATGGAGCAGGA
AATGTCTGCATACGCTACAGCTCTCGCTGCCGCGAAAGACAATCCTACTG
A
View all "STS012" genotypes
M-202 RA5539 japonica, temperate japonica   RA5539 STS014 CCGGAGGAGGACGAGAAGCTGTTCAACCACATCAGCCGCTATGGCGTCGG
CTGCTGGAGCTCCGTCCCAAAGCTCGCCGGTACGCCCATCGATCAGTGTA
TGCATTAGTAACCAAAAT----GGCAAACTGACAAGCTAAGCTAAACTTG
GGTTAATTA--ATCACTTCTTTTCTCCTGAATAATAATGCTAATTGCTTA
CATCAATGTGTTTATAGTATTTCAGTTTATTATTTCATCAATTTCTGTCC
TGCTGCATAATGCTCACT------ATAGAAATGTGTTTATATC-------
----------------------------------------GTAATTTAGT
TGCTATACCTCTCTCTTTGTATCTC------ACTCTCTGACAGTGTGTGA
ATAATATAATGTGTGTTGCTGAGTTGCTGTGTACAGGATTGGAGAGGTGT
GGCAAGAGTTGCAGGCTGAGATGGATCAACTACCTGAGGCCTGATCTCAA
GAGAGGCAGCTTCTCCCAGCAGGAGGAGGAGCTCATNNNNNN
View all "STS014" genotypes
M-202 RA5539 japonica, temperate japonica   RA5539 STS015 TTATAATGCCAGACGGCCTATGAAACAAAGGTACTTTTTCTTATGAGGCC
CGAAAGTTTTAGTTTATAGTTAGCTATATGATCCACCTTTGTTAATGCAG
TACAATGCAACATACATGTTCTATATTTTGCAGGTATCACTACAACGTTG
CAGATTCAAGGCTTGTACAACACATTGACAAAGGGAATGAAGATGGTCTG
TTTATCAGTTGCATAACATCTTGCTCAAATCTGTGGGCTCTAATCATGGA
TGCTGGCACTGGGTTCACTTCCCAGGTTTATGAACTTTCACCACATTTTC
TTCACAAGGTGAGTAGCTTGCTCCTTGTTTAACTGGTGGAAAATCTTAGC
AAACTAATCACATAACTTTTCAAGGCAAAGTTACATATAAGGAAGCTCTT
GTATACATTGTCAAATGTGATTCCATGGTTTTCTGGTCATT
View all "STS015" genotypes
M-202 RA5539 japonica, temperate japonica   RA5539 STS016 GAGCGGAGTTACCATCAATGGGAAGCGAGCGGTCGTGGTTGGCCGCAGCA
ACATTGTCGGGCTACCTGTATCCCTGCTTCTTCTGAAGGCGGATGCGACC
GTATCCATTGTTCACTCCCGGACCCCAAACCCTGAAAGTATTGTCCGTGA
AGCAGACATTGTCATTGCAGCGGCTGGCCAGGCTATGATGGTACATTGTT
CTACCACCAAATTATGACATGGTTCATCACAAT--------CCA----CT
GCCCAGTTCTAACTGCAGATTTCTTGGTTGCCAGATCAAAGGAGACTGGA
TCAAACCAGGCGCTGCTGTCATCGACGTTGGGACGAACTCCATCAGTGAC
CCAACCAGGAAATCGGGGTACAGACTCGTCGGCGATGTGGATTTCGCAGA
GGTGAGCAAGGTTGCTGGTCACCTGACTCCAGTCCCAGGTGGCGTTGGCC
CCATGACGGTGGCGATGTTGCTGAAGAACACGG
View all "STS016" genotypes
M-202 RA5539 japonica, temperate japonica   RA5539 STS017 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTXG
TCCTTGCATGATTCTGTTAGGGGTTCTTGAGACATGGYGCAATGCCGATG
CAGTGTGTTTTGATGTTGATAGCACGGTCTGCTTGGATGAGGGTATTGAT
GAACTCGCTGATTTCTGTGGGGCTGGGAAGGCTGTTGCTGAGTGGACTKC
AAAGTAAATAACATGTTATGAACATTAGTTTTGAAGTGTGTTTGTTGCTT
AGTGCATAAAATTCATTCAGGATGCTCATTGGTTTAATATTCTTAGGGCA
ATGACAGGAAC
View all "STS017" genotypes
M-202 RA5539 japonica, temperate japonica   RA5539 STS018 GTGTATTTTGCTCATTGCACGTCAGAGATGATATTCATTACTCATTTGCT
CACAGAACAACCTGAGAAACTTGCTGGCCCTCTGCTGGCTGATACTTATG
TTACTCTCCTGAAAGGTCGCAATGCGTGGTATGGGCAAATGCTAGCGAAG
GGAGAACTGAGCCCTGACATGGGCGACAGCATCAAGGGGAAGGGGATGAT
TCAGGTTATCTCATAAAACTACTCATTATTTTCCCCGAAAGTTATATGAA
TTTTGAGCGTATTTTTGAAGAATGCTGGAAGTCAAAACTTGCAAAAGATA
TCACATCATCCTGGATATAACCTGTTCACTTTTCACTCTACAGGGTATCT
CTGCTGTTGGTGCATTTTTTGAGCTTCTCAGTCAACCCAGCTTAAGTGTG
CAACACCCAGAGGAAAATAAGCAAGTTGCAC
View all "STS018" genotypes
M-202 RA5539 japonica, temperate japonica   RA5539 STS019 TAGCAAATCATTCCAGTTGGGTATCAGCTTTGCTGGTGGTTACATTGCCG
GTGTCTTCTGTGCTATTGTTTCTCACCCGGCAGATAATCTAGTCTCTTTC
CTGAACAATGCCAAGGGTGCTACAGTGGGTGATGTGAGTTTATTACTTAT
TACAATGCTCTGGTATTAATGCATTGTGGTGCTTTGCTTTTGAAGTTTTG
TTGATGAGCAACTGATTACAGTTATGTATTTCTGTAGGCTGTTAAGAAGC
TTGGTCTCTGGGGTCTATTCACTCGTGGACTGCCCCTACGTATTGTCATG
ATCGGTACCCTTACTGGAGCTCAATGGGGAATTTATGATGCATTCAAAGT
CATGGTTGGATTGTAAGTATCTTTCTTTATTATTACTGTCATTAGAACAG
CGTCATTATCTTTCGATTGAATCAGTAAATTGAGAATTCACTTTATAATT
TAACAGGCCAACTACCGGTGGTGTTACGCCAGCACCATCCACTTC
View all "STS019" genotypes
M-202 RA5539 japonica, temperate japonica   RA5539 STS021 TGGTTCCAGTCACTATGACATTGAGGTGGCACCCCGCCGGTTGGAAAGCT
TGATAATTTCTAGCGGTGAGGTCATCTACTCACTTGAGTTCTCATACATT
GACCACAGTGGGCAGCAGCACACATCAGGCACATGGGGCGGCTATGGCCC
AAATAAAGGGAACAAACATACTAAGGTGACTATGAATCTTATTATTCAAT
TCTTGCATTTTTCTTTTAGATAAAATGATTGGTATACATTCATTATCTCT
GCACACAACTAGTGAAATTTATAATAGGTTTACTAGTAGTATTATGTTAT
TTTGAAACTTTTCTTGCAGATTGAGCTTGGTCTTATAGAGTATGTAACGG
AAGTTTCTGGGACAATCGGACCATTTGATAGGGCACCCGCTGGTGTTATT
ACATCGCTTATGTTTATCACTAATAAGGGAAGCTACGGACCTTTTGGAGA
AGTAAGAGGAACTCCTTTCCACATCCCAGTGCAGGACAATGGCAGCATTG
TTGGCTTTTTTGCACGTGC
View all "STS021" genotypes
M-202 RA5539 japonica, temperate japonica   RA5539 STS022 TGTTGGATCATTATTACAAGAGTGCTGTTTGGCACTGAATAAATTGCATC
CCTAGTTGAACATAAGAGTCAATCTTTGCTTTTCCTCCAGTTAAGCGAGC
TAAGAAGTACGTATATCATACCTGAGCCTGCCTTTTCTTTGCTCTTATGA
AGCTTGCTGGAAAAAACTCACACCATATTATTGAGGCAACTTTCAAAGCA
TTTGCTAGAGCCCTTCGACAAGCAACAGAATATGACTTGCGCCGACGCGG
CACTGTCCCCAGGTTCGTTTTAGCTTATTGCAAATAGCGTTTAGGAAATT
CTATGTTGTGCCCAACTACACTGTTGATGCCTGATTCAAAAACTTCACAC
CTGCTAAGCATATGGTTTATCTCTGACCTTTGCTGATATTGAAACATTAA
CGTATCTTTCTTGACTTGATCGCAGCTCAAAAGGTGTGTTGTCAAGGTCA
TAGTGTTGCAGGTTTGGAAAACAAGGGGTGCATGCTACTGTTCCTTGTAG
ATTGCAATATTCAAAGGAAACAAATGGAATGGCCTCTACAGCT
View all "STS022" genotypes
M-202 RA5539 japonica, temperate japonica   RA5539 STS024 TTCTTTTATAAGGTAATTCTAATTTTGTCCTGAAATGCATTAATTATTTA
CTCTACTTGTATTGCTAGCTAGCTAGCTAACAACATCATCGTGCTCTTCT
TGTTAGCTTTTCTCAAATGGCATGAAAGAATCTGATCAGAGGCATGCTAC
TCTTAGAATAACTGCTTCAGGTAATTCTGTAGTTCATTGTTCATTGTTTG
TTTCTGTTTGACAAAAACTATAATTTCTGCACTATCCTATGACTGTCTGT
AACGTTTTTCTTTATATTGCTGATATGATCAGTTTTGGTGGAACTTAAAG
CTTATATCGATCTGATATTTAATAGTCCTGAATATTTATTCAAATTGATA
TTCTAGAATTCAATGTTGTGCATTTTCCTATATCATCTCTCAAGAATTAT
CAAGAAGTGTATGCTTCATTTGAAACTTTTCCAAATGAGAATAAGGGAGA
TTTTTCTGCTATTTGATTTTCTTGTAAACAGAT--AGCTTTTATCTGATC
ATTGTATGTCTATCTGAAACAGA
View all "STS024" genotypes
M-202 RA5539 japonica, temperate japonica   RA5539 STS027 GTGAACACCGGTTTCCTTTCCTTGTTAAGGTACAAGGACCCAAGACTATG
ATACTAGTTGTAATTATTCTTTTCAAATTTCCTGTAAGGCTGTAACTGTT
ACAACCCTGGCAGGTTAACAATTGGAATAGGTTCAATTGCAACAGTGGAG
GAACTCTTGTTGAGAAGTGCTGCCATTTTTTTGATTTGATGAGATTGTTT
GCAGCTGCAAACCCTGTTCGTGTGATGGCTTCTGGAGCCATTGATGTCAA
CCACAAGGATGAAATTTATGATGGGAAGGTCAGGTTAATTGACTACAAGA
TCGCTGATTTATAAGCTGGATGGCATTTTCACTCATGTGATTATTTATAA
GCTTATAAAGGCTATATTTATAAGCTGCAGCGCATTTTTTGTGCTTATCG
GGTTATGGTGGTCTCAGTTTAAACAGCAGTCCCTGATTTTAACTTCTTTC
TCAATGCAGGTTCCAGATATTATAGACAATGCATATGTAATAGTAGAATT
TGATAATG
View all "STS027" genotypes
M-202 RA5539 japonica, temperate japonica   RA5539 STS028 GTGAACACCGGTTTCCTTTCCTTGTTAAGGTACAAGGACCCAAGACTATG
ATACTAGTTGTAATTATTCTTTTCAAATTTCCTGTAAGGCTGTAACTGTT
ACAACCCTGGCAGGTTAACAATTGGAATAGGTTCAATTGCAACAGTGGAG
GAACTCTTGTTGAGAAGTGCTGCCATTTTTTTGATTTGATGAGATTGTTT
GCAGCTGCAAACCCTGTTCGTGTGATGGCTTCTGGAGCCATTGATGTCAA
CCACAAGGATGAAATTTATGATGGGAAGGTCAGGTTAATTGACTACAAGA
TCGCTGATTTATAAGCTGGATGGCATTTTCACTCATGTGATTATTTATAA
GCTTATAAAGGCTATATTTATAAGCTGCAGCGCATTTTTTGTGCTTATCG
GGTTATGGTGGTCTCAGTTTAAACAGCAGTCCCTGATTTTAACTTCTTTC
TCAATGCAGGTTCCAGATATTATAGACAATGCATATGTAATAGTAGAATT
TGATAATG
View all "STS028" genotypes
M-202 RA5539 japonica, temperate japonica   RA5539 STS029 CCGGCGAGGGTGCCCCGGCGGCTGACCGCCGCCGAGCTCCTGCCGGTGAC
CCCGACTCCCCCCGCCGCCGAGAGGAGAACCACCCGGAAGCGCAAGTCCG
ACGTCGACTTCGAGGCGGAGTTCGAGCTTTTCGAG------------GAC
GACGACGACGACGATGAGTTCGAGCTTTCCGACGATGGCGACGAGAGTTT
GGCCGTGTCATGTGTGTCGTCCCCCAAGTCGAAGGCAGTACCTTCGTTTT
CTTGTACGATGAGATGGAGAAATCTTGCCTGCTTTCTTGAAGGATTTTCA
CCTGACGGCAACCTGAACTTTACACGATTTCTTCTCCTGCTGTTGATTTC
ATCGATCGCCGGCGGCAGTTTCGTCGGATGTCTCCTCGAGCTCCAGGCCG
CGGCGGCGCGTGGCGGCGGCGGCGGCCGGTCGTCGGAAGGCGAGCAAGAA
GAG---------CAAGTACAGGGGCGTCCGGCGCCGGCCGTCGGGGAGGT
TCGCGGC
View all "STS029" genotypes
M-202 RA5539 japonica, temperate japonica   RA5539 STS030 AAACATAAGTCTTCAACCCTCAGGATTGTTGGATATGTTCTTCTAGCTAT
TGTCCTGTTTATAGTTACAGTGCTGCTGGTAATATTTTGCCTGTCCAAGT
ACCAAGAGAGACAGTCAAGACGTGATTATACAACAAGTCAGGTGGGGAGG
GTTCATCAGAGGGTTGAAGAGCCGAAAGTTAAGCAAGCTTCAGTGCAGTC
AAGGAATGATGCCAAAAAAGGTCAACAATTAATTTATATATTCTGTAATA
TATTTCTGATTATATTTTATTTGTTTTATATCACAGCATATTGATGTTCT
ATTAACAGGATCAACAGAGGTTCCTGAACGGAGGCAGGTTCGTGAAATAA
ATTTGGCGGTACCAGGTATAGATGCTTGTAAATCTGATCTATCAGGTCTT
TTAGTACTGTAATACTATTCACATTTTTAAGTTCAGATGTATAAAATAAC
TATTCAATTGCTGGCAGCTGCTCT
View all "STS030" genotypes
[ Download ]