grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for marker "wx5_02" from the experiment "Selection under domestication: Evidence for a sweep in the rice Waxy genomic region".

E.g., Germplasm "IRGC9542", RA4969, Basmati 1, Marker/locus RM22.

Items 1 to 25 of 96.       of 4 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Germplasm
ARC 13829 IRGC42469     RA4947 wx5_02 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNN
View all "ARC 13829" genotypes
Basmati 217 IRGC53637     RA4993 wx5_02 CCACCCCTGTTCAGTGGTGAGTTGCTGAGTTTGATTTGCTGGATGAATGG
TTTGGGTATATGGTAGTGCGTTCACCGTTAAAACTGAATTGTCAAACATG
ATGATCTCTCGCTCTCTGTATCCAAGCAGCACTGCTGCTGCTTTTTTTCA
GCCATGGAGGGGTTGGATTAGTGGAGCATGTGCGTGCACACTTCTAGACC
GTAATTATAATGGTTCTTAATGCTGTATTAGCTCGCTAATGCATGTAAAC
AACACCCCCTTACT
View all "Basmati 217" genotypes
DA13 IRGC5857     RA4887 wx5_02 CCACCCCTGTTCAGTGGTGAGTTGCTGAGTTTGATTTGCTGGATGAATGG
TTTGGGTATATGGTAGTGCGTTCACCGTTAAAACTGAATTGTCAAACATG
ATGATCTCTCGCTCTCTGTATCCAAGCAGCACTGCTGCTGCTTTTTTTCA
GCCATGGAGGGGTTGGATTAGTGGAGCATGTGCGTGCACACTTCTAGACC
GTAATTATAATGGTTCTTAATGCTGTATTAGCTCGCTAATGCATGTAAAC
AACACCCCCTTACT
View all "DA13" genotypes
Dom Sufid IRGC12880 aromatic   RA4929 wx5_02 CCACCCCTGTTCAGTGGTGAGTTGCTGAGTTTGATTTGCTGGATGAATGG
TTTGGGTATATGGTAGTGCGTTCACCGTTAAAACTGAATTGTCAAACATG
ATGATCTCTCGCTCTCTGTATCCAAGCAGCACTGCTGCTGCTTTTTTTCA
GCCATGGAGGGGTTGGATTAGTGGAGCATGTGCGTGCACACTTCTAGACC
GTAATTATAATGGTTCTTAATGCTGTATTAGCTCGCTAATGCATGTAAAC
AACACCCCCTTACT
View all "Dom Sufid" genotypes
JC1 IRGC9091     RA4917 wx5_02 CCACCCCTGTTCAGTGGTGAGTTGCTGAGTTTGATTTGCTGGATGAATGG
TTTGGGTATATGGTAGTGCGTTCACCGTTAAAACTGAATTGTCAAACATG
ATGATCTCTCGCTCTCTGTATCCAAGCAGCACTGCTGCTGCTTTTTTTCA
GCCATGGAGGGGTTGGATTAGTGGAGCATGTGCGTGCACACTTCTAGACC
GTAATTATAATGGTTCTTAATGCTGTATTAGCTCGCTAATGCATGTAAAC
AACACCCCCTTACT
View all "JC1" genotypes
Pankhari 203 IRGC5999     RA4888 wx5_02 CCACCCCTGTTCAGTGGTGAGTTGCTGAGTTTGATTTGCTGGATGAATGG
TTTGGGTATATGGTAGTGCGTTCACCGTTAAAACTGAATTGTCAAACATG
ATGATCTCTCGCTCTCTGTATCCAAGCAGCACTGCTGCTGCTTTTTTTCA
GCCATGGAGGGGTTGGATTAGTGGAGCATGTGCGTGCACACTTCTAGACC
GTAATTATAATGGTTCTTAATGCTGTATTAGCTCGCTAATGCATGTAAAC
AACACCCCCTTACT
View all "Pankhari 203" genotypes
BJ1 IRGC45195     RA5345 wx5_02 CCACCCCTGTTCAGTGGTGAGTTGCTGAGTTTGATTTGCTGGATGAATGG
TTTGGGTATATGGTAGTGCGTTCACCGTTAAAACTGAATTGTCAAACATG
ATGATCTCTCGCTCTCTGTATCCAAGCAGCACTGCTGCTGCTTTTTTTCA
GCCATGGAGGGGTTGGATTAGTGGAGCATGTGCGTGCACGCTTCTAGACC
GTAATTATAATGGTTCTTAATGCTGTATTAGCTCGCTAATGCATGTAAAC
AACACCCCCTTACT
View all "BJ1" genotypes
Dhala Shaitta PI180060     RA5361 wx5_02 CCACCCCTGTTCAGTGGTGAGTTGCTGAGTTTGATTTGCTGGATGAATGG
TTTGGGTATATGGTAGTGCGTTCACCGTTAAAACTGAATTGTCAAACATG
ATGATCTCTCGCTCTCTGTATCCAAGCAGCACTGCTGCTGCTTTTTTTCA
GCCATGGAGGGGTTGGATTAGTGGAGCATGTGCGTGCACACTTCTAGACC
GTAATTATAATGGTTCTTAATGCTGTATTAGCTCGCTAATGCATGTAAAC
AACACCCCCTTACT
View all "Dhala Shaitta" genotypes
DV85 IRGC8839     RA5323 wx5_02 CCACCCCTGTTCAGTGGTGAGTTGCTGAGTTTGATTTGCTGGATGAATGG
TTTGGGTATATGGTAGTGCGTTCACCGTTAAAACTGAATTGTCAAACATG
ATGATCTCTCGCTCTCTGTATCCAAGCAGCACTGCTGCTGCTTTTTTTCA
GCCATGGAGGGGTTGGATTAGTGGAGCATGTGCGTGCACACTTCTAGACC
GTAATTATAATGGTTCTTAATGCTGTATTAGCTCGCTAATGCATGTAAAC
AACACCCCCTTACT
View all "DV85" genotypes
Jhona 349 IRGC6307     RA4979 wx5_02 CCACCCCTGTTCAGTGGTGAGTTGCTGAGTTTGATTTGCTGGATGAATGG
TTTGGGTTTATGGTAGTGCGTTCACCGTTAAAACTGAATTGTCAAACATG
ATGATCTCTCGCTCTCTGTATCCAAGCAGCACTGCTGCTGCTTTTTTTCA
GCCATGGAGGGGTTGGATTAGTGGAGCATGTGCGTGCACGCTTCTAGACC
GTAATTATAATGGTTCTTAATGCTGTATTAGCTCGCTAATGCATGTAAAC
AACACCCCCTTACT
View all "Jhona 349" genotypes
Kasalath HO1195     RA5339 wx5_02 CCACCCCTGTTCAGTGGTGAGTTGCTGAGTTTGATTTGCTGGATGAATGG
TTTGGGTATATGGTAGTGCGTTCACCGTTAAAACTGAATTGTCAAACATG
ATGATCTCTCGCTCTCTGTATCCAAGCAGCACTGCTGCTGCTTTTTTTCA
GCCATGGAGGGGTTGGATTAGTGGAGCATGTGCGTGCACGCTTCTAGACC
GTAATTATAATGGTTCTTAATGCTGTATTAGCTCGCTAATGCATGTAAAC
AACACCCCCTTACT
View all "Kasalath" genotypes
Phudugey IRGC32399     RA4939 wx5_02 CCACCCCTGTTCAGTGGTGAGTTGCTGAGTTTGATTTGCTGGATGAATGG
TTTGGGTATATGGTAGTGCGTTCACCGTTAAAACTGAATTGTCAAACATG
ATGATCTCTCGCTCTCTGTATCCAAGCAGCACTGCTGCTGCTTTTTTTCA
GCCATGGAGGGGTTGGATTAGTGGAGCATGTGCGTGCACGCTTCTAGACC
GTAATTATAATGGTTCTTAATGCTGTATTAGCTCGCTAATGCATGTAAAC
AACACCCCCTTACT
View all "Phudugey" genotypes
9311 RA5531 indica   RA5531 wx5_02 CCACCCCTGTTCAGTGGTGAGTTGCTGAGTTTGATTTGCTGGATGAATGG
TTTGGGTATATGGTAGTGCGTTCACCGTTAAAACTGAATTGTCAAACATG
ATGATCTCTCGCTCTCTGTATCCAAGCAGCACTGCTGCTGCTTTTTTTCA
GCCATGGAGGGGTTGGATTAGTGGAGCATGTGCGTGCACACTTCTAGACC
GTAATTATAATGGTTCTTAATGCTGTATTAGCTCGCTAATGCATGTAAAC
AACACCCCCTTACT
View all "9311" genotypes
Ai-Chiao-Hong IRGC51250 indica   RA4967 wx5_02 CCACCCCTGTTCAGTGGTGAGTTGCTGAGTTTGATTTGCTGGATGAATGG
TTTGGGTATATGGTAGTGCGTTCACCGTTAAAACTGAATTGTCAAACATG
ATGATCTCTCGCTCTCTGTATCCAAGCAGCACTGCTGCTGCTTTTTTTCA
GCCATGGAGGGGTTGGATTAGTGGAGCATGTGCGTGCACACTTCTAGACC
GTAATTATAATGGTTCTTAATGCTGTATTAGCTCGCTAATGCATGTAAAC
AACACCCCCTTACT
View all "Ai-Chiao-Hong" genotypes
Badkalamkati IRGC45011 indica   RA4991 wx5_02 CCACCCCTGTTCAGTGGTGAGTTGCTGAGTTTGATTTGCTGGATGAATGG
TTTGGGTATATGGTAGTGCGTTCACCGTTAAAACTGAATTGTCAAACATG
ATGATCTCTCGCTCTCTGTATCCAAGCAGCACTGCTGCTGCTTTTTTTCA
GCCATGGAGGGGTTGGATTAGTGGAGCATGTGCGTGCACACTTCTAGACC
GTAATTATAATGGTTCTTAATGCTGTATTAGCTCGCTAATGCATGTAAAC
AACACCCCCTTACT
View all "Badkalamkati" genotypes
Binulawan IRGC26872 indica   RA4871 wx5_02 CCACCCCTGTTCAGTGGTGAGTTGCTGAGTTTGATTTGCTGGATGAATGG
TTTGGGTATATGGTAGTGCGTTCACCGTTAAAACTGAATTGTCAAACATG
ATGATCTCTCGCTCTCTGTATCCAAGCAGCACTGCTGCTGCTTTTTTTCA
GCCATGGAGGGGTTGGATTAGTGGAGCATGTGCGTGCACACTTCTAGACC
GTAATTATAATGGTTCTTAATGCTGTATTAGCTCGCTAATGCATGTAAAC
AACACCCCCTTACT
View all "Binulawan" genotypes
Cere Air IRGC43369 indica   RA4953 wx5_02 CCACCCCTGTTCAGTGGTGAGTTGCTGAGTTTGATTTGCTGGATGAATGG
TTTGGGTATATGGTAGTGCGTTCACCGTTAAAACTGAATTGTCAAACATG
ATGATCTCTCGCTCTCTGTATCCAAGCAGCACTGCTGCTGCTTTTTTTCA
GCCATGGAGGGGTTGGATTAGTGGAGCATGTGCGTGCACACTTCTAGACC
GTAATTATAATGGTTCTTAATGCTGTATTAGCTCGCTAATGCATGTAAAC
AACACCCCCTTACT
View all "Cere Air" genotypes
Chau IRGC56036 indica   RA4974 wx5_02 CCACCCCTGTTCAGTGGTGAGTTGCTGAGTTTGATTTGCTGGATGAATGG
TTTGGGTATATGGTAGTGCGTTCACCGTTAAAACTGAATTGTCAAACATG
ATGATCTCTCGCTCTCTGTATCCAAGCAGCACTGCTGCTGCTTTTTTTCA
GCCATGGAGGGGTTGGATTAGTGGAGCATGTGCGTGCACACTTCTAGACC
GTAATTATAATGGTTCTTAATGCTGTATTAGCTCGCTAATGCATGTAAAC
AACACCCCCTTACT
View all "Chau" genotypes
Chhote Dhan IRGC58930 indica   RA4978 wx5_02 CCACCCCTGTTCAGTGGTGAGTTGCTGAGTTTGATTTGCTGGATGAATGG
TTTGGGTATATGGTAGTGCGTTCACCGTTAAAACTGAATTGTCAAACATG
ATGATCTCTCGCTCTCTGTATCCAAGCAGCACTGCTGCTGCTTTTTTTCA
GCCATGGAGGGGTTGGATTAGTGGAGCATGTGCGTGCACACTTCTAGACC
GTAATTATAATGGTTCTTAATGCTGTATTAGCTCGCTAATGCATGTAAAC
AACACCCCCTTACT
View all "Chhote Dhan" genotypes
Dee Geo Woo Gen PI279131 indica   RA5344 wx5_02 CCACCCCTGTTCAGTGGTGAGTTGCTGAGTTTGATTTGCTGGATGAATGG
TTTGGGTATATGGTAGTGCGTTCACCGTTAAAACTGAATTGTCAAACATG
ATGATCTCTCGCTCTCTGTATCCAAGCAGCACTGCTGCTGCTTTTTTTCA
GCCATGGAGGGGTTGGATTAGTGGAGCATGTGCGTGCACACTTCTAGACC
GTAATTATAATGGTTCTTAATGCTGTATTAGCTCGCTAATGCATGTAAAC
AACACCCCCTTACT
View all "Dee Geo Woo Gen" genotypes
Guan-Yin-Tsan IRGC51300 indica   RA4968 wx5_02 CCACCCCTGTTCAGTGGTGAGTTGCTGAGTTTGATTTGCTGGATGAATGG
TTTGGGTATATGGTAGTGCGTTCACCGTTAAAACTGAATTGTCAAACATG
ATGATCTCTCGCTCTCTGTATCCAAGCAGCACTGCTGCTGCTTTTTTTCA
GCCATGGAGGGGTTGGATTAGTGGAGCATGTGCGTGCACACTTCTAGACC
GTAATTATAATGGTTCTTAATGCTGTATTAGCTCGCTAATGCATGTAAAC
AACACCCCCTTACT
View all "Guan-Yin-Tsan" genotypes
Hsia-Chioh-Keh-Tu IRGC8240 indica   RA4898 wx5_02 CCACCCCTGTTCAGTGGTGAGTTGCTGAGTTTGATTTGCTGGATGAATGG
TTTGGGTATATGGTAGTGCGTTCACCGTTAAAACTGAATTGTCAAACATG
ATGATCTCTCGCTCTCTGTATCCAAGCAGCACTGCTGCTGCTTTTTTTCA
GCCATGGAGGGGTTGGATTAGTGGAGCATGTGCGTGCACACTTCTAGACC
GTAATTATAATGGTTCTTAATGCTGTATTAGCTCGCTAATGCATGTAAAC
AACACCCCCTTACT
View all "Hsia-Chioh-Keh-Tu" genotypes
Jefferson x Oryza rufipogon NULL     Jefferson x Oryza rufipogon BC2F2 Line 252 wx5_02 CCACCCCTGTTCAGTGGTGAGTTGCTGAGTTTGATTTGCTGGATGAATGG
TTTGGGTATATGGTAGTGCGTTCACCGTTAAAACTGAATTGTCAAACATG
ATGATCTCTCGCTCTCTGTATCCAAGCA--ACTGCTGCTGCTTTTTTTCA
GCCATGGAGGGGTTGGATTAGTGGAGCATGTGCGTGCACACTTCTAGACC
GTAATTATAATGGTTCTTAATGCTGTATTAGCTCGCTAATGCATGTAAAC
AACACCCCCTTACT
View all "Jefferson x Oryza rufipogon" genotypes
Kalukantha IRGC7755 indica   RA4983 wx5_02 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNN
View all "Kalukantha" genotypes
Khao Dawk Mali 105 IRGC27748 indica   RA4878 wx5_02 CCACCCCTGTTCAGTGGTGAGTTGCTGAGTTTGATTTGCTGGATGAATGG
TTTGGGTATATGGTAGTGCGTTCACCGTTAAAACTGAATTGTCAAACATG
ATGATCTCTCGCTCTCTGTATCCAAGCAGCACTGCTGCTGCTTTTTTTCA
GCCATGGAGGGGTTGGATTAGTGGAGCATGTGCGTGCACACTTCTAGACC
GTAATTATAATGGTTCTTAATGCTGTATTAGCTCGCTAATGCATGTAAAC
AACACCCCCTTACT
View all "Khao Dawk Mali 105" genotypes
[ Download ]