grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "IRGC104119" from the experiment "Selection under domestication: Evidence for a sweep in the rice Waxy genomic region".

E.g., Germplasm "IRGC9542", RA4969, Basmati 1, Marker/locus RM22.

Items 1 to 9 of 9.

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
Oryza barthii-RA2740 IRGC104119     RA2740 wx3_02 CAAGACTCCAGGCCACCCCGAGAACTTCGAGACACCCGGAGTTGAAGTTA
CCACTGGTCTGTTATCTCCACTGAAGCTCATAGCACCTTTAAGTTTCTAT
GCTGGAATACATACAGAACTGAATGTTTCGGGTTCTTGTTTGGTTTTGTT
CTGTAGGACCTCTTGGTCAGGGTATTGCAAATGCAGTTGGGCTGGCCCTT
GCCGAGAAGCACCTGGCTGCTCGTTTCAACAAGCCCGACAGCGAGATTGT
TGATCACTACACGTAA---TATGTTTTATCATGAATGCTTTTAGTTTTCA
CTTTAGTTATGGTGGTGCAACCTTGGTAACATGATTCGTGGATTTTGTGC
AGCTACTGTATTTTGGGAGATGGGTGCCAGATGGAGGGTATCTCCAATGA
AGCTTGCTCGTTGGCTGGCCATTGGGGTCTTGGCAAGCTGATTGCATTCT
ATGATGACAACC
View all "wx3_02" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 wx3_06 AAGTGATGGAGTAAGCAAATATCCTAGAGACCTACTAATGTACTCCTCAC
TGTTTGGTACACATAAGTGACAGTAATTATGTTTACTGCAGATAACTGTG
GAAGAAAGCAAGGAAGCTGATACAACGACTAAAGAGGCTACTCATAGAAT
CTCTCGAGGAATTCATGACAAGGTAGATACCTTGCCATGTTGAAATATAT
CGTATAAACTATAATCTCATTAATTGAACCAGCACAATAGTATCAAAGAT
TTCCTCTTATCTAAAGCTAAGTTCATTATAGTTTTGTTTAGGTCCGTCAC
TAATTTTCTTTGTACTTGAAATTTTAGGGACATTCACTAACAAGGAAGCT
GAAATCGGATGGCAATGTGGACACTACACAGATATTGCACAATCTCCATG
AAGGTTTGTTTTTAGCTTTGGGTGCTTCAT
View all "wx3_06" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 wx3_08 ATTACTCCATTACTTGTGTAGTAACAAT------GCTTTTGGATCTAATT
GCATCAGACACTGTACTCTTTGCACTGACTTCCTTTGATGTGGTAAAAAC
AATGACAGCTTGGAGCAAATGCTATTCTTGCTGTTTCACTTGCTGTGTGC
AAAGCAGGAGCCATGGTGAAGAAGATTCCCCTTTACCAGGTCTTTTAAAC
AACTGCATCGGTATATAACTTTGTTCTTCTGAAACTTCAGAACCTATGCT
AAAACATAAAGAAATTGCAGCACATTGCAAATCTTGCTGGAAACAAGACT
CTCGTGCTGCCTGTACCTGCTTTCAATGTGATCAATGGAGGATCCCATGC
TGGAAATAAACTTGCCATGCAGGTAAAATATTGCTTGCATAACAGGAAC
View all "wx3_08" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 wx3_10 CCAGTTGTAGAGGTATGTGACACAGTCGAAACCTTTTTTGCATTTCCTTG
TTTTTGTTATTCATAATTTCAATTGTTCGTGAATGAAATCTTTTGGCAAA
TTGTAAACAAGTATGGTTTGGATGTTGGACTGGGATATACGACTATGCTG
GGTGTAACACAAACCAGCTGGAGCATGGAATATTGGTACAATTGGAGGTT
TCTTAATTTTTGATGAAATAATCAGAGAAATCCTTCTTTTAATGAATCTT
GCTAGAGGTTGTGCAATGTTATTAAAGTTTGACCCAATTCTGTGAGGTAA
AAGAAACCTTGAGTCCTCTTGTAGCTAGTGGTTCTGCAAACTTTCTTCCA
CACAAGCTATTAGTGGACTCATGTTTGTTCTCTTCTGACCAATGGCTGTA
CC
View all "wx3_10" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 wx5_02 CCACCCCTGTTCAGTGGTGAGTTGCTGAGTTTGATTTGCTGGATGAATGG
TTTGGGTATATGGTAGTGCGTTCACCGTTAAAACTGAATTGTCAAACATG
ATGATCTCTCGCTCTCTGTATCCAAGCAGCACTGCTGCTGCTTTTTTTCA
GCCATGGAGGGGTTGGATTAGTGGAGCATGTGCGTGCACACTTCTAGACC
GTAATTATAATGGTTCTTAATGCTGTATTAGCTCGCTAATGCATGTAAAC
AACACCCCCTTACT
View all "wx5_02" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 wx5_04 GGGAGTCCGCGCGCAGCGGGTGCGGGGACTCGGGACGGAAGAAAGTCCAA
AAACGAGAGGAGAAGCGGGGAGCGCGCTGGGCCGGTGGTTTCCTTCCAGA
GGAGAGGTGAGGTGAGGTGA-----AGCGTGGGATTGGGCCGTGTGGCAC
CGCGAGAGCATGGCGGAAAAGCCGAGAACGCGCACTGCGCGATTGGCTGG
ACCGGGCTTCCGGTACACACGAAATCAGTTCAGTACATGTGTTTTTTTAA
ACTTGTAAGAGCATCAATATACATGCTTGGACAGGAGAACAAATTTATGC
ACATCAATATATTAGCAGGAGATAAAAAATTTACAATTATGACCTGCTGT
AGCGGTGATGAGAGTTTTACACAGGAAGAGAGGAGGGCAGTTAGCTAGGC
AAAACTAGACCCTGAACAAGCAAAAAGACAGAAAAATAGGAGATAAAGAT
TATATA
View all "wx5_04" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 wx5_06 ATGCCCTTGCTGCTCTTGAGTTAGCACGTACAAACGGATTGAACATGAAT
AACGGGAATGGATTCCCCCAAGGATCTCTCAGCGGATCAAAGAACATCCA
CCACCACGACCAGCTTTCTCATGCTCAGTCATCACCGCTGCAACTGGCAG
ATTCTCCATATGATCATGCTAGAGAAATGCACATATCAGAAGCATACCCT
ATCTCAACAGCTCCAGGGAGTGCTGGAAAAGCAAAGAGGCCAAAGAAGAA
TAGTTCCCAAGCCTCTCCATTGAAGAGGCCATCAGGTGTGCTCCGGAAAA
CCAAGAAACCTTCTGGTGACTGGAAGAATGTCGGGATGTCTGGTTGTGGA
GATGATTCTGCTCATGCTTCTGTGATGAAGAACGAGTGGAAGGACCAAAA
CCTTGGTCTGAATCAAGTCGCGTTTGATGAGTCCACGATGCCCGCGCCTG
CCTGTTCATGCACGGGGAAGCTTCGCCAATGCTACAAGTGGGGAAACGGG
GGATGGCAATCATCATGTTGCACCATGAACATTTCCATGTACCCACTCCC
AGTGATGCCGAACAAGCGGCATGCTCGCATGGGGGGACGGAAGATGAGCG
GCGG
View all "wx5_06" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 wx5_08 GTTCGTGTGAGTACGGATATGAGTAGAGAG---TACTATTTCCCCTTGCT
TTGCATCTACCTGAGTTTTTGTGCATTTGACTAGCCTGTATTTTCTTTTT
ATAATCCTGCACACTTCACCTGATTTGACCCCTCATGCCATGATGTGACA
CAGTTCTTTACTATTTTACTTTAAGCCTGTGGATTTGCTCGCTGATTAGT
TTATTTGTGCTCTAATGATTTGCCTCTCTGCAGTGATCTCAAGGGGAACA
AGCTCACTGGCCAAATCCCAGATGAGATTGGGGACTGCATCTCCTTAAAA
TATTTGTACTTCACCTAATCTAAGTCTTCTTTTATTCTGTTACTTTTTGT
AACAGGGTGTTCTAGC
View all "wx5_08" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 wx5_12 AAACTGTACAAGCTTAGCTCTGCACAAGCTAAGCCAAGCCATCGGTTTTT
GACTCGAATTAATATCGAGCCGTTTGATCGATCGCCCAACCGACCAACCA
GCTAGTCCATGTTTCTGACCTGGATCTTGAATTCTGAATGCACATGGGGA
TTGATTGAACTGAAGACGCCATTGATGCAAGCTTGCCGGTTCGGTCACTG
GGAGGTGGTTCAGACGCTGCTGGTTTTCAGATGCAATGTAC---AGTAAA
CTGATTAGCTCCTGCACTTCAGTTAATTGCAACGATTAATCAGTAAATTA
GAAATTAACTTTTG-----------TTTTTACTGAAGGTGTGGAGGGTGG
AGAACCTGAGTGGGCGGACGGCGCTGCACATGGCGGCGGCCGGCGGGCAT
GTCAAGTGCGTCAGGCTGCTGGTGGCGGACGCCGCCGGCGACAGAGACGG
GTAAGCCATTGTTGTTGTTGAGGAGCTCGAGCGAGGTGGCGGCCATGGTG
ATCTCG
View all "wx5_12" genotypes
[ Download ]