grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "65I 1633" from the experiment "Hamblin et al (2004) Comparative Population Genetics of the Panicoid Grasses: Sequence Polymorphism, Linkage Disequilibrium and Selection in a Diverse Sample. Genetics 167:471-483".

E.g., Germplasm L-WA58, Marker/locus pSB0080.

Items 1 to 25 of 62.       of 3 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
65I 1633   bicolor, NULL Chad   cuigd-0033 TGTGGCCTTGGCTGCCAGCCAGCCGCCGTTGGGGCTCGCAGCCTCGGCGG
ACATGGCGAGCACCACGAACAGTGCAGCGAGTGCAGCCACCTTTGAGGAG
ATGGAGATCACGGCGGCGGACATCGTCGTCTCAGCTCGATCGATCGAACC
AGCTATAGTCGATCACCTACAATTTTCAAGAACAGCGAGTG---TACTTG
TACTTGGATGTTCGGTCGGTGTTTTTCTTGGTCGATCGGTGGACGACACT
GCTGGTGCGTTTTTATAGGCAGGCGAAAGCCGGCCGGGTTGATCGAATTG
GCATCAAGGGTCGCCGTTGGGCTCGTCGCGTACG-------------
View all "cuigd-0033" genotypes
65I 1633   bicolor, NULL Chad   cuigd-0075 CGGACGCACGCGTTACACATGAATGAATATACTGCACGTCTGGAGTGTAC
ACTACACAGTACATACACTGCAAATGG-CCGTACGTAGTCTCGATCACTA
CACGCAACGCAA-GCTACATACAACTCCTAATAACGAGAAAGCAAAC---
-----TGCACACTAGTCGTCCCGACGNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNN
View all "cuigd-0075" genotypes
65I 1633   bicolor, NULL Chad   cuigd-0088 CCAGTAGCGTGGATAAGTTTGGAGCGCGCAGAATCAGAAAAAGTGCTGCA
TGTTCATGCAACAAGATGCAGCTTCTTCGCAAACCCTGCTCTCACGTCGT
GGCTGTCTGCTGTCAAATTGGAGTTACTTCTACATACATGTCCCCGTACT
ACAGCTTGACCTGTCTAGGTAATACTTGGAGTACAAAATTCAAAGTAGCT
GGTAATTTGTTCAAGTACCGAGAATCCATTCAATTCAGCTGGGAGAAGAA
GACGCTAACTTGGATGCCGGACAAAAAGCTGGAGTGTGGCTTTCCTGGTT
TTCTAACATCAGACTGCACACAAACTGCCACAGAAGAGGAAGA
View all "cuigd-0088" genotypes
65I 1633   bicolor, NULL Chad   cuigd-0122 GAGCTTTCAACTACTACCATAGAAAACCTGAAGTTTGGAAACAGTTGGTG
CAGAAAGACATGAAGATCGATTTCAGCTGGGATACTTCAGCTTCCCAATA
CGAAGAAATCTATCAGAGAGCAGCGGCTCGAGCCAGGGCAACAGCGTAAA
TAGCAGAGACAGTTCCCTACTGCCTCTGTGAAGTCTCCTAGATGCTGTGC
TTAACCGTATGGTAAAGAAATATGGTTGTATCAGCTCTAAATTAAGCATA
TGCTGAAGAAGCACGGTGCTTCCCTACTTGGGTATACTAAGGGCGACTTG
GCG
View all "cuigd-0122" genotypes
65I 1633   bicolor, NULL Chad   cuigd-0142 GCGCCTGAGGTTCTTCTTGGCGCCACACACTACTCCACGCCGGTTGACAT
TTGGTCCGTGGGCTGCATATTTGGTACCATTTCGATGAGCTCAGAGATTC
TTGTCAATGCAAACTGCTTAAGAATTCAAACCAACACATACAGTTTCTAA
TTTGGTTGTAAATGGCAGCTGAGTTGGTCACTAACCAGCCACTTTTCCCT
GGCGATTCTGAGTTGCAGCAGCTCCTCCACATCTTCAAGTAATACCTCCA
GTGCATTAGTTGATTGTTTGCTTGCTGAAATTCTTGGTGAGTGTCTCATG
TTAATGGCTATCCATCTTGTTCTTTGGATGAAAGGTTGCTGGGCACCCCA
AATGAGCAGATGTGGCCAGGAGTAGGCAAGCTGCCCAACTGGCACGTGTA
CCCTCAGTGGAAGCCCACTAAGC
View all "cuigd-0142" genotypes
65I 1633   bicolor, NULL Chad   cuigd-0161 AAGTGATGGAAAGACCTATCTCCACACTGGGGATTTTAGAGCATCAAAAT
CAATGCAATTGCATCCACTTCTCCAGAGAGGCAGGGTAAATTTGGTTTAC
CTGGACACAACATATTGCAATCCCAAATACAAGTAGGTATACGATAATCA
AGTTTTAGGCTTTTTCTCTTTGATTAGTACTTTGCTGAACATGGTAAACT
GTAGGTTCCCACCCCAGGAGGATGTTATTGATTTTGTTGTGAGGACAGCT
CAAAGATATCTAAAGAAACAGCCAAAAACCCTCATT
View all "cuigd-0161" genotypes
65I 1633   bicolor, NULL Chad   cuigd-0176 ACAAGACCAAAGATAAATTTGCATCTTTATCAAAATGGAATATCTATGTG
CATCTCAACGTCCTATAAGGTACACACTCATGAGAGTGCTGAGTGACAGT
GAGAGCTTACCAATGGTACACCACTTTTAGCTCGTTGTTCCAAATACGAT
GATGGTTTGAAGAAGGGACCATAAATTTCAGCCCACTTGCTTAGCTTCGA
ATGTATGTAAGGTGCTCCAACAGTGTCAGCCCAGAAGACAAGACCACCCC
TGCAAACAAAATTTTTTTGTAAATTCAAACGAAATGCTCATAATAGGCAC
CACACCTCCTTAAATCCATAAACAATACAATGTAGAAATGCATAAATGGT
AAATTGAGGACAATAATCATAATCATTGCATTACAAGAGGTTTAGCTTGT
ATTGACAC
View all "cuigd-0176" genotypes
65I 1633   bicolor, NULL Chad   cuigd-0193 AAGTCTTCCTTGTCTCGTCTGATATAGATAG----ATGCGAAGTTTCAGG
GCACCGTGCAGTTGTTTCGATCGCTGGGTTGCTCTACCTACCCAGGCTTG
CGTTAAGGGAGGGTATTCCTGTTTCTGAGTATGCTTGGTTTGGTGCTGCG
CAGATTGCCCTGGAACGCAGTCGGAGGAGGCGGGGAAGGCGGATGCCTGC
GCTGGGTGCCCCAACCAGCAGATTTGCGCCACCGCCCCCAAGGGCCCCGA
CCCCGGTAATTGGATCATTTCATGTCCTTGTACAGATTCTGTGACTTGCT
CTGGTGCTGGTGTACTGTTATCCCCATCATATCATTTTGTTTTATCAGAA
ATTAGCTTAGTTTAGTTTCATTTTATTACAGTGGTTGTGGTTGTGGTTGT
GGATTTGG-----GTATTTTCTGTTTTCAGTACAAAATCCCCACTAAAGC
ATTTTAGATT
View all "cuigd-0193" genotypes
65I 1633   bicolor, NULL Chad   cuigd-0289 GGCTTCATGGCATGAATCAACATGGTGTCCTTAGTTGGGAAAACCGTATG
AAGATTCTCCTTGGCACTGCAAAAGCGTAAGTTTGGAATTTGGATATGTT
TCACTTTATTTCCTGAAATCTTGTTTAACATGGACTGCCGGTGTTCATGA
TTTGCAGTCTCGCGTACCTTCATGAGGCCATAGACCCCAAAGTTGTACAC
AGAGATATCAAGTCAAGCAATATCTTAATCGACGATGAATTCAACAGCAA
GGTTTCTGATTTTGGGTTGGCTAAACTTCTGAATTCTGACAAAAGTCATA
TCAATACAAGAGTGATGGGAACATATGGGTATAGCTCTGTTTTTATGATG
TTCCTTTTCCTATTGTTAGCTCTTCTATTCATCTGGAAAACTGGAGAGAA
GT
View all "cuigd-0289" genotypes
65I 1633   bicolor, NULL Chad   cuigd-0318 GACGACCGGATGGTGGGCTACTTCAAGATCAGGAAGGCGGCGGCGACGGC
GACGAGGAGATCGGCGCGGCGAGGCATGTCGCCGGGCGTTACCGCCGCGA
CGGTGGTGCTGTCGCTGGTCCTGGTGGCGCTGGCTGCGGCCGGAGCGTAC
TGGGGATACAGGATGTGGGAGAAGAGGAAGAGGAAACGGGCCGGGATGGA
GCAGGAGCTGGCGCCGGGGCCGTACAAGGACCTCAAGTCCATGGCCAGCT
CTAACAGTTCGTTCAAAAGCAGCCATGAATTCCAGCCATGAGAGGGCTGG
TTGAAGTTGAAGGTCTACTAGTGCAGTGGAGTGGAGTGGATTGCTCGTCC
TCCAGTTGTTGGATGAATTGCATTCGATGATCGATCAGAGGTTCAGACC
View all "cuigd-0318" genotypes
65I 1633   bicolor, NULL Chad   cuigd-0402 TGCTTGTCATTTGCCTTAAGATGAAAATCTGAATCCATCTGTCAGATCTC
AGATCTGTACCATTTAAACATGCATCGATCAGTGTCCTGAAAAAAACACT
ACCAGAAAACTAGGATAAAAAGATGAGTTGACTAATCCTATGCATGAGTT
CACCAGAAAACTAGAATAAAATATGAGTTGACTAATTCTATGTATGACTT
CTTACAAGGAGCTTATTAAATCAATATTCTCAACAAACAGACACTAGAAT
ATGTCATAAATAGACACATGTATTATCTCTAGTTGGTTGATAACTGGACA
TATGAGCAGAGAAGAACAACAAAAGTCTTCCAGAAAATTATATGT
View all "cuigd-0402" genotypes
65I 1633   bicolor, NULL Chad   cuigd-0446 GTGGTGATAGGGAAGGGACAGTTTGAACAAGAAAGAGCAAAGCCTAATGT
CTTAGCGGTAACCATTTCATCATAACTCCCAAGTATATTTAAGTGGTTAC
TACTGCGTAGACGACAACAAAACAAATACCATTGAAAAATTGTCGTTGGT
GTCTTTTCCCATGGGATGCAGGAGGGGGAGCTGCTGGCGCTGCTTAGGGA
CGAGCAGGACGAAGAAGACCGGATGATCCAGACCGACATCAGCGATGAAG
ACCTCTTGAAGCTGATGGACCGCAGCGACCTGTCCGGACCACCTGGTGCT
GCCGATGCCACACCACTGATCCCGCTGAAAGGTCCTGGCTGGGAGGTCGT
GGTGCCAGCCAAGAGCGGTGGCGGTATGCTCTCGTCGCTCACCAGCTGAG
C
View all "cuigd-0446" genotypes
65I 1633   bicolor, NULL Chad   cuigd-0455 CAACGAGCCCACAGCCGCCGCCATCGTCTACGGCATCGACGAGAAGGGCC
CGGAGAAGATGGTGCTCGTGTTCGACCTCTCGGCGGCGGCACGTTCGACG
TCAGCGTCCTGGCCATCGACAACGGCGTCTTCGAGGTGCTCGGCACCAAC
AACGGCGACACCCACCTCGGA-GCGAGGACTTCCACCAA----TCATGGA
CTACTTCATCAAGCTCATCAAGGGTAAGAACGGCCGGGACATCTCCGGCG
ACGCTCGCGCGCTAGGGAAGCTTCGCCGCGAGTGCGAGCACGCCAAGCGC
GCGCTCAGCAACCAGCACCAGGTGCGCGTGGAGATCG
View all "cuigd-0455" genotypes
65I 1633   bicolor, NULL Chad   cuigd-0487 NNNNNNNNNNNNACTCGGAGTGCAGCCGCCTGTCCATCGCCACGTTCCAG
AACCCGGCACCCGACGCGACGGTGTACCCGCTGGCCGTGCGGGAGGGGGA
GGCGCCCATACTGGACGATCCCATCACCTTCGCCGAGATGTACCGCCGCA
AGATGGCACGCGACATCGAGCTCGCCAAGCTCAAGAAGCAGGCCAAGGCT
GAGAAGCAGCAGAAGATTGCCAAGGAGTTCGCCGTGCCGACTGCCAAGGA
ATTCGCCGTGCCGAACGCCAAGCCTCTCGACGACATTCTTGCCTGATAAG
GCGACTGATCCATTGATCCACGGTTTTATATCGTCGCGTGTGATTTCATT
TATAACTAAGAACATTGCTATATACGAGCGTGTGGCGATTAA
View all "cuigd-0487" genotypes
65I 1633   bicolor, NULL Chad   cuigd-0501 TCTGCTTCAATCCAGCCAGGAGCTTACTGTACTGATGAAATCATCAGGTG
TTGTCCGTTGTTAATATCTTAGCTATTCCAGATGGCACATCAGCTCCCGG
AGCCTGAAACAATCAACACAAGCAGCAACAGCTAGCTAGCATCTGAATAT
ATTGTCAACAGGAAGACTAAGAA
View all "cuigd-0501" genotypes
65I 1633   bicolor, NULL Chad   cuigd-0540 GGTCGTGCAGCGGCAGCGTCGCGCCGGCCGGGAAGCAGCAGAAGACGCCG
ATCTGCGTGATGGGCAGGGACGCCGGAATTAATAATCAGTACAAGCACAA
CACGTACAGCGGATGAGCACGACCGACCACGATCTGCTCCGGCTAAACAC
AGCAGCCCGGCCGGCCTGCATGCTTACCGAGAAATCGTGGCACTGGTGTA
CGTATGTGCATGCACATAGGTGATCCGCGTGAACGCCGGCGCCGGCAGGA
GGCG--GTGGCCGCTCGCTCTTGGGGCTCAGCTCGTCGTCGCACGATCGA
GCAGGATGATGTCGGCGATCCCGACGCCGGCTGCCTCCACACCA-TCTGA
ACCAAATAGAAACACGTACAGCAGGG-ACGCAAGT-------CGTCTTC-
--ATTCACCGGC-G---GCGAACGCGAACGCGAACACAAATTAAAG
View all "cuigd-0540" genotypes
65I 1633   bicolor, NULL Chad   cuigd-0581 TTCTATCTGGCTCATCAGCTTATCAGGAGGGCACTAAACATTCCAGGCGC
ATCAATCCATTGGTATGCAAAGCCAGGTTAGCTTACTCACACAAAACATT
CTTGCTTCCCTATGTCAGGAAATATCATTTAGAATACTTTTCTTTCAGAG
ATGCGGAAGCAAAGGAAGATGGGTCATATTACAATTGTGGGGTCTTCTAA
GACAAGTGTAAAATCACGCTTGGATAATTTGCTGCAAAGCAACTCGTCTG
ATCCCAAGCAAGGTATTGCAGTCACAAATCTTTTGGTCGCTCTGAATCAT
ATATAACAGTTCATTGCTATTGTTTTATCTGTTCCGGATTG
View all "cuigd-0581" genotypes
65I 1633   bicolor, NULL Chad   cuigd-0616 CTTTGTTCTGTTCATAGATTTTCAGTGAGCAATATAGTATTGCGACAGCA
ACATAAACTATTTCTTTCTCATATGCAGCACTAGTCACCACCTTCAATAT
TGAGATTGGTATCACTGGTGCTATATTGACTAAATTGGATGGTGACTCCA
GGGGCGGAGCCGCACTAAGTGTTAAAGAGGTAGTCATTTACCAGAAATCA
TTTCTATTAGTTGATGATGCAAAGAAGATTATTATCTATCAATTTTACTA
TTCAACTTCAC
View all "cuigd-0616" genotypes
65I 1633   bicolor, NULL Chad   cuigd-0639 TCGGCAACAATTCACATGGCAGTGGTGACAA-GGAAATGGCTTGCCCAAT
GGTGAGCTGCTGCACCACATGTCCGCGAATCTTGGGTTTGTGATACTGAT
ATAGACTAGACCACTAACCTGATTTACCTACTTTCTGATTCAAAAAGTAG
CCCC-TCTTTATCAGGT-TATGCCTGTGTTTTCTATAGGTTCTTTAAACA
GTGTTGTAATAATATGATATGATGATCGGGTATGTCCGACGTTGAAGTTT
GCTGCTGGTTCTCCGCAGTGTTCTGAACAGTAGAAATTTCAGGATGAAAT
CCGGTGGTGCTCTAGCTCTACCTTGTAAACTGCACGATCGTTGTGTAAGG
AAAATTTT-ATCACTCGCCGCCCTTTTCATTGGGC
View all "cuigd-0639" genotypes
65I 1633   bicolor, NULL Chad   cuigd-0640 CTGATTCCTGGACAGGACAGAGAAAGTATGGAGCAGCTAGGGAGAAGTTA
CTTGAATGAACTGATCAATAGAAGCTTGGTCCAGCCAACCAAGGTTGGGG
TAGATGGGACAAACGTGAAACAGTGCAGAGTTCATGATGTCATACTTGAG
TTCATTGTGTCAAAGGCTGTGGAGGAAAACTTTGTTACTATATGGAATGG
TGATGGTTTTTCTAGAAATTATTCTTCAAACAAGATTCGTCGATTATCCA
TCCGGAATGTCAAATCTGCCCAGGCGGCGAAAGAGATTGCCAGGACAATA
AAAAATGGAGCTCATATTAGATCAATTAATGTCTATCAATCTGCCTATAG
CCTGCTTAAAGAGCATGCCTCTGAG
View all "cuigd-0640" genotypes
65I 1633   bicolor, NULL Chad   cuigd-0688 AGTACTTCATCAGGCTCAACTCCGGCGGCAAGGACAAGAGGAGATCCAGC
ATTCATGACATTACCACTGTGAACCTGACGGACGAGCAGCCTCCATCACC
ATCCCAGTCCTCTCTGATCACCAACCAGTCAAACGCATCAGCTCCGACTG
CGGGGATAGGCCAGTTCTCATTGGCAGCCGATGCCAAGCAACACGGTTCT
GGAAATCTGCCCTTCAATCCACCAAGCCGGACCTCTGTGATGGCGG
View all "cuigd-0688" genotypes
65I 1633   bicolor, NULL Chad   cuigd-0703 TGCAGGGTCGTCTATGACACCTGCAATCCCCTTAT--GATTCGCATATTT
CAGTGACCATTTACCGATTCCATCTCAGATATCTTTCTCATCATCAATGG
AGGTGGGTATAGTCCCAGACAACATGGCAACGACGACAGACATGCCAAAC
TCCGGCATCCTGCTGACACCTGCTGGGGCCATCAGCCTCTTCTCGTCAGG
TTCTTCGCTTCAGATGCCACTCCACTTGACCTCCATGGACAGAGAGGCCA
GGGTCCTCAGGTACAAGGAGAAGAAGAAGAGCAGAAAGTTCGCGAAGACC
ATACGATATGCGACGAGGAAGACATATGCAGAAGCAAGGCCGAGGATCA
View all "cuigd-0703" genotypes
65I 1633   bicolor, NULL Chad   cuigd-0716 ATTGATGATGCATGGCTGTGCCAGGCCAGCTGATTGATTGATTGATTGAT
TGGTTGATTGCAGGTGAGGTTCAATGGCGACGCCGGCAGCCTGGTGATCA
ACGGCACGGCGTACTACCTCAGGCAGATGCACTGGCACTCGCCGACAGAG
CACACCGTCGACGGCCGCAGGTCAGAGTCATCGTCATCCTCGTCTCTCGC
CGTTGAGGAGCTAATAATAAAGCCTTGACGTGAACCGCTTAATTACTCAT
TCCCTAATTGCTTAATTACTTACTAGTAACGGCTCTGAGATGTTGGTTCG
TCGCGTGCGCCCGTGCTCGCAGGTACGACATGGAGCTGCACCTGGTGCAC
CAGACCTTGGCGAACAAGACGGCG
View all "cuigd-0716" genotypes
65I 1633   bicolor, NULL Chad   cuigd-0747 AGCTGAGCTAAAAGATGACAGTGAGTTTCCCTTATTTCAGGCAAAACTTT
GATTATGTTTGGCTTATTAGAGTTTAGATGTGGCCATGGTTATTAAGGCG
TCGCTTCAGCGTTGCTTAAGCAGCTGAGCGGTCCAGGGTTGCCCCAGGGG
CAAAGGTGACACCCTTTGGCCTTATGCGCATGCTGATGCCCCCTGGTTCC
GCCTTCTCGTCGATTCTGCTGCTGGCCTGCTCGATTTTGCTTCTGCTGGC
TTGATTTCTTCCATCTCCCGCTTGCCAATTGCTCAATCTGGAAGGGGACA
GCGG
View all "cuigd-0747" genotypes
65I 1633   bicolor, NULL Chad   cuigd-0851 ATGTTTGCGCACAGAAGGATTCTGAGGTGTCACATGATTTGGAATTTGAC
AAGTCCTATGGAGGTAAGGTACCTTCTTTCCCTTCTGGTGGCCCACCATC
TCTTATGTTGAGCAGGGGAGATGATACTGATGCTGGTAATGTCAGTGGTT
TCATCTCAAAACAGTCTGGTTTGGGACGTGCAGCAAGGAGACAGTTAGCA
GCAATTCTTGATGAGTTCTGGGGGCAACTTTTTGATTATCATGGTAAACT
TACACAAGAGGCCAACAATAAAAGGTTCAACTATTTGATTGGACTGGACT
TGAGAGCAGCTGGTTCTGCTGTGAGGAAAGATAACCTATCAATTGAAGCT
TCCAGTAACTCAATGATGAGAGATGTAATGCAAGGGTCAGCTACTGTA
View all "cuigd-0851" genotypes
[ Download ]