grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "KFS1" from the experiment "Hamblin et al (2004) Comparative Population Genetics of the Panicoid Grasses: Sequence Polymorphism, Linkage Disequilibrium and Selection in a Diverse Sample. Genetics 167:471-483".

E.g., Germplasm L-WA58, Marker/locus pSB0080.

Items 1 to 25 of 76.       of 4 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
KFS1   NULL South Africa   cuigd-0033 TGTGGCCTTGGCTGCCAGCCAGCCGCCGTTGGGGCTCGCCGCCTCGGCGG
ACATGGCGAGCACCACGAACACTGCAGCGAGTGCAGGCACCTTTGAGGAG
ATGGAGATCACGGCGGCGGCCATCGTC---TCAGCTCGATCGATCGAACC
AGCTATAGTCGATCACCTACAATTTTCAAGAAGAGCGAGTG---TACTTG
TACTTGGATGTTCGGTCGGTGTTTTTCTTGGTCGATCGGTGGACGACACT
GCTGGTGCGTTTT-ATAGGCAGGCGAAAGTCGGCCGGGTTGATCGAATTG
GCATCAAGGGTCGCCGTTGGGCTCGTCGCGTACGACGGGCTTGCCGT
View all "cuigd-0033" genotypes
KFS1   NULL South Africa   cuigd-0062 GACAGCGTCGGGTACCTGGACATCGCTCTGGTGTCGTATGTCGGCTGGGT
GAAGGCGGTGGAGAAGATGGCCGGGGTCACTCTCCTGGACAAGGCGAAGG
TTCCGAACCTGGTGGCATGGGCTGATCGGCTCTGCAACCACCCGGCCGTG
GTGGACGCGATCCCTGACGCGGACAAATTCGTTGAGTTCAGCGTCACCTA
TGGGTCGTTCTCAAAGCCTATCAATGGTCCCAAGTGAGGAAAAGGGTCTG
CTTAGCTGTGTTTGGTGATTTTCACTGCGTGTGTGCCA-----GTGCGTG
TCACTGTCAATAAGGTGTAGTTTGTACGTGTCGTTCCTCTGGAAATAAAG
CTTTCTTTAACTTTATATAAAAAGTTTGTGCCCTTCAAAGGGAATCGACA
CATACACTGGTGGT------------TTCTTAAGTGCAAAACTTACTGTT
AAGA
View all "cuigd-0062" genotypes
KFS1   NULL South Africa   cuigd-0067 ACCCATCTCCACTGGCTGCCAATGGGCCAAGTGCATCCTCCCGGCCAGCC
TCGAGGGCCTGGTCCTGAGATGTGAAGACACATCTGACCTGGATGTGATA
CCGGTCTAGCTAGAGGG--ATTGGTTCTGGCGATCCTCTGGTGTGCGGAG
AAGGAGAGGAAAAAGATGCCTTGACTTTTGATTTGGTTTCTGTGGGTTGT
TAGGGTTGAAAGAATGTGCAAATGCAGGGTGTGATTATGGGCTAAGTACA
ATATCAGTGGTCGTTCAGTCAGTTTACCTGGAGCTTGGTCGTATAGTATA
TTATATGTAATTTTCTCTTTCTC-TTTTTTG
View all "cuigd-0067" genotypes
KFS1   NULL South Africa   cuigd-0075 CGGACGCACACGTTACACATGAATGAATATACTGCACGTCTGGAGTGTAC
ACTACACAGTACATACACTGCAAATGG-CCGTACGTAGTCTCGATCACTA
CACGCAACGCAACGCTACATACAACTCCTAA---CGAGAAAGCAAACGCA
CGCTCTGCACACTAGTCGTCCCGACGCCGACGACAAGACGGACACCAACC
TCTGCCT
View all "cuigd-0075" genotypes
KFS1   NULL South Africa   cuigd-0088 CCAGTAGCGTGGATAAGTTTGGAGCGCGCAGAATCAGAAAAAGTGCTGCA
TGTTCATGCAACAAGATGCGGCTTCTTCGCAAACCCTGCTCTCACGTCGT
GGCTGTCTGCTGTCAAATTGGAGTTTCTTCTACATACATGTCCTCGTACT
ACAGCTTGACCTGTCTAGGTAATACTTGGAGTACAAAATTCAATGTAGCT
GATAAATTGTTCAGGTACAGAGAATCCATTCAATTTAGCTGGGAGAAGAA
GACGCCAACTTGGATGCCGGACAAAAAGCTGGAGTGTGGCTTTCCTGGTT
TTCTAACATCAGACTGCACACAAACTGCCACAGAAGAGGAAGA
View all "cuigd-0088" genotypes
KFS1   NULL South Africa   cuigd-0122 GAGCTTTCAACTACTACCATAGAAAACCTGAAATTTGGAAACAGTTGGTG
CAGAAAGACATGAAGATCGATTTCAGCTGGGATACTTCAGCTTCCCAATA
CGAAGAAATCTATCAGAGAGCAGCGGCTCGAGCCAGGGCAACAGCGTAAA
TAGCAGAGACAGTTCCCTACTGCCTCTGTGAAGTCTCCTAGATGCTGTGC
TTAACCGTATGGTAAAGAAATATGGTTGTATCAGCTCTAAATTAAGCATA
TGCTGAAGAAGCACGGTGCTTCCCTACTTGGGTGTACTAAGGGCGACTTG
GCG
View all "cuigd-0122" genotypes
KFS1   NULL South Africa   cuigd-0142 GCGCCTGAGGTTCTTCTTGGCGCCACACACTACTCCACGCCGGTTGACAT
TTGGTCCGTGGGCTGCATATTTGGTACCATTTCGATGAGCTCAGAGATTC
TTGTCAATGCAAACTGCTTAAGAATTCAAACCAACACATACAGTTTCTAA
TTTGGTTGTAAATGGCAGCTGAGTTGGTCACTAACCAGCCACTTTTCCCT
GGCGATTCTGAGTTGCAGCAGCTCCTCCACATCTTCAAGTAATACCTCCA
GTGCATTAGTTGATTGTTTGCTTGCTGAAATTCTGGGTGAGTGTCTCATG
TTAATGGCTAtccatcTTGTTCTTTGGATGAAAGGTTGCTGGGCACCCCA
AATGAGCAGATGTGGCCAGGAGTAGGCAAGCTGCCCAACTGGCACGTGTA
CCCTCAGTGGAAGCCCACTAAGC
View all "cuigd-0142" genotypes
KFS1   NULL South Africa   cuigd-0161 AAGTGATGGAAAGACCTATCTCCACACTGGGGATTTTAGAGCATCAAAAT
CAATGCAATTGCATCCACTTCTCCAGAGAGGCCGGGTAAATTTGGTTTAC
CTGGACACAACATATTGCAATCCCAAGTACAAGTAGGTATTCGATCCTCA
AGTTTTAGACATTTTCTCTTTCATTAGTACTTTGCTGAACATG-TAAACT
GTAGGTTCCCACCCCAGGAGGATGTTATTGATTTTGTTGTGAGGACAGCT
CGAAGATATCTAAAGAAGCAGCCAAAAACCCTCATT
View all "cuigd-0161" genotypes
KFS1   NULL South Africa   cuigd-0176 ACAAGACCAAAGATAAATTTGCATCTTTATCAAAATGGAATATCTATGTG
CATCTCACACGTCCTATAAGGTACACACTCATGAGAGTGCTGAGTGACAG
TGAGAGCTTACCAATGGTACACCACTTTTAGCTCGTTGTTCCAAATACGA
TGATGGTTTGAAGAAGGGACCATAAATTTCAGCCCACTTGCTTAGCTTCG
AATGTATGTAAGGTGCTCCAACAGTGTCAGCCCAGAAGACAAGACCACCC
CTGCAAACAAAAAAAAAATTGTAAATTCAAACGAAATACTCATAATAGGC
ACCACACCTCCTTAAACCCATAAACAAGTACAATGTAGAAATGCATAAAT
GGTAAATTGAGGACAATAATCATAATCATTGCATTAAAAGAGGTTTAGCT
TGTATTGACAC
View all "cuigd-0176" genotypes
KFS1   NULL South Africa   cuigd-0193 AAATCTTCCTTGTCTCGTCTGATATAGATAGATAGATGCGAAGTTTCAGG
GCACCGTGCGGTTGTTTC-ATCGCTGGGTTGCTCTACCTACCCAGGCTTG
CGTTAAGGGAGGGTATTCCTGTTTCTGAGTATGCTTGGTTTGGTGTTGCG
CAGATTGCCCTGGAACGCAGTCGGAGGAGGCGGGGAAGGCGGATGCCTGC
GCTGGGTGCCCCAACCAGCAGATTTGCGCCACCGCCCCCAAGGGCCCCGA
CCCCGGTAATTGGATCATTTCATGTCCTTGTACAGATTCTGTGACTTTCT
CTGGTGCTGGTGTACTGTTATCTCCATCATATCATTTTGTTTTATCAGAA
ATTAGCTTAGTTTAGTTTCATTTTATTACAGTGGTTGTGGTTGTGG----
--ATTTGG------TATTTTCTGTTTTCAGTACAAAATCCCCACTAAAGC
ATTTTAGATT
View all "cuigd-0193" genotypes
KFS1   NULL South Africa   cuigd-0289 GGCTTCATGGCATGAATCAACATGGTGTCCTTAGTTGGGAAAACCGTATG
AAGATTCTCCTTGGCACTGCAAAAGCGTAAGTTTGGAATTTGGATATGTT
TCACTTTATTACCTGAAATCTTGTTTAACATGGACTGCCGGTGTTCATGT
TTTGCAGTCTCGCGTACCTTCATGAGGCCATAGACCCCAAAGTTGTACAC
AGAGATATCAAGTCAAGCAATATTTTAATCGACGATGAATTCAACAGCAA
GGTTTCTGATTTTGGGTTGGCTAAACTTCTGAATTCTGACAAAAGTCATA
TCAATACAAGAGTGATGGGAACATATGGGTATAGCTTTGTTTTTATGATG
TTCCTTTTCCTATTGTTAGCTCTTCTATTCATCTGGAAAACTGGAGAGAA
GT
View all "cuigd-0289" genotypes
KFS1   NULL South Africa   cuigd-0318 GACGACCGGATGGTGGGCTACTTCAAGATCAGGAAGGCGGCGGCGACGGC
GACGAGGAGATCGGCGCGGCGAGGCATGTCGCCGGGCGTTACCGCCGCGA
TGGTGGTGCTGTCGCTGGTCCTGGTGGCGCTGGCTGCGGCCGGAGCGTAC
TGGGGATACAGGATGTGGGAGAAGAGGAAGAGGAAACGGGCCGGGATGGA
GCAGGAGCTGGCGCCGGGGCCGTACAAGGACCTCAAGTCCATGGCCAGCT
CTAACAGTTCGTTC-AAAGCAGCCATGAATTCCAGCCATGAGAGGGCTGG
TTGAAGTTGAAGGT---CTAGTGCAGTGGAGTGGAGTGGATTGCTCGTCC
TCCA---GTTGGATGAATTGCATTCGATGATCGATCAGAGGTTCAGACC
View all "cuigd-0318" genotypes
KFS1   NULL South Africa   cuigd-0347 AGGCCTTGGTAGTCAATGGTGGAAGCAAGTGACTCAAATGACAAGTACCA
GGAGGGGAAGCGGATTATGAAGATATGTTTCATCCATGAACAGAAGTTTA
AAAGTGATATCAGATCTATGAATGATTTGAATTGTTTTCCCGTTACGACA
CCATTGTTTGCTATATAAGATTCACAGTACCTGCCAGT------TGATTC
CATTTGTTGTTTCTGTAAAACAAATATCAATTTGTCACTAGAATATGTGG
TGTTTGTATGTAAACAGGTCCTCTATTTATGTGAGCCATATACTTCTTTT
TCAGAAGATCCCCATGAAGTG
View all "cuigd-0347" genotypes
KFS1   NULL South Africa   cuigd-0355 ACGATCAGATGATCATGCCCAGTGACGAACTCTCTGAAATTCGCAGCCCG
CTCTAGGTTCTTCACCTCCTCTATCACCAGCTCCAGCCGCACCACCATCT
CCACCAGCAGCGACGCGAACGCGGCGAACGGGAGCGCCTCGGAGAACTCG
AGGCTCGTGATGGCAATCTTGCTGAGCGTCGGCCGCAGCATGCCGCCCCT
CTCGACGCGATCCGGCGGCGCACGCGTCTCTGACAACGCTGTCGCGTCGG
TCTTGAACGAATGAAGCGCGGTGGCTCTCGACGCC-GAGAGCTTCCCGGA
GTTCAGCTCCATCAGCATGCGCTTGTTGGCGGCGCACGCGCGTTTGGAGC
CCAGGAAGAGCCGCGGCTGCGACCTGA
View all "cuigd-0355" genotypes
KFS1   NULL South Africa   cuigd-0402 TGCTTGTCATTTGCCTTAAGATGAAAATCTGAATCCATCTGTCAGATCTC
AGATCTGTACCATTTAAACATGCATCGATCAGTGTCCTGAAAAATACACT
ACCAGAAAACTAGGATAAAAAGATGAGTTGACTAATCCTATGCATGACTT
CACCAGAAAACTAGAATAAAATATGAGTTGACTAATCCTATGTATGACTT
CTTACAAGGAGCTTATTAAATCAATATTCTCAACAAACAGACACTAGAAT
ATGTCATAAATAGACACATGTATTATCTCTAGTTGGTTGATAACTGGACA
TATGAGCAGAGAAGAACAACAAAAGTCTTCCAGAAAATTATATGT
View all "cuigd-0402" genotypes
KFS1   NULL South Africa   cuigd-0446 GTGGTGATAGGGAAGGGACAGTTTGAACAAGAAAGAGCAAAGCCTAACGT
CTTAGCGGTAACCATTTCATCATAACTCCCAAGTATATTTAAGTGGTTAC
TACTGTGTAGACGACAACAAAACAAATGCCATTGAAAAATTGTCGTTGGT
GTCTTGTCCCATGGGATGCAGGAGGGGGAGCTGCTGGCGCTGCTTAGGGA
CGAGCAGGACGAAGAAGACCGGATGATCCAGACCGACATCAGCCATGAAG
ACCTCTTGAAGCTGATGGACCGCAGCGACCTGTCCGGACCACCTGGTGCT
GCCGATGCCACACCACTGATCCCGCTGAAAGGTCCTGGCTGGGAGGTCGT
GGTGCCAGCCAAGAGCGGTGGCGGTATGCTCTCGTCGCTCACCAGCTGAG
C
View all "cuigd-0446" genotypes
KFS1   NULL South Africa   cuigd-0455 CAACGAGCCCACCGCGGCAGCCATCGCCTACGGCATCGACGACAAGGGCC
CGGAGAAGAAGGTGCTCGTGTTTGAC--CTCGGCGGCGGCACGTTCGACG
TCAGCATCCTCGCCATCGACAACGGCGTCTTCGAGGTGCTTG---CCACC
AACGGCGACACCCACCTCGGAGGCGAGGACTTCGACCAGCGCGTCATGGA
TTACTTCATCAAGCTCATCAAGCGCAGGCACGGCCGGGACATCTCCGGCG
ACGCCCGCGCGCTAGGGAAGCTCCGGCGCGAGTGCGAGCGCGCCAAGCGC
GCGCTCAGCAACCAGCACCAGGTGCGCGTGGAGATCG
View all "cuigd-0455" genotypes
KFS1   NULL South Africa   cuigd-0487 AGGCGGTGGTGAACTCGGAGTGCAGCCGCCTGTCCATCGCCACGTTCCAG
AACCCGGCACCCGATGCGACGGTGTACCCGCTGGCCGTGCGGGAGGGGGA
GGCGCCCATACTGGACGAGCCCATCACCTTCGCCGAGATGTACCGCCGTA
AGATGGCACGC-GACATCGAGCTCGCCAAGCTCAAGAAGCAGGCCAAGGC
TGAGAAGCAGCAGAAGAT-------------------------TGCCAAG
GAGTTCGCCGTGCCGACTGCCAAGGAATTCGCCGTGCCGAACGCCAAGCC
TCTCGACGACATTCTTGCATGATAAGGCGACTGATCCATTGATCCACGGT
TTTATATCGTCGCGTGTGATTTCATTTATAACTAAGAACATTGCTATATA
CGAGCGTATGGCAATTAA
View all "cuigd-0487" genotypes
KFS1   NULL South Africa   cuigd-0544 GTCCGTGATTGCTCAACTCGGCCAGAAAGGCCGGTACCGCAACTTACTGG
ATATGAATGCAAAGTTTGGCGGCTTCGCTGCGGCATTGGTAAATGACCCC
TTGTGGGTCATGAACATGGTCCCTACTGTGGGGAACTCAACAACCCTTGG
GGTTATATACGAGCGTGGCCTCATTGGGAGCTACCAGGACTGGTACATAT
TCGTACTGCAAACAT
View all "cuigd-0544" genotypes
KFS1   NULL South Africa   cuigd-0669 AGGCAAGCTTTCTTATCAGTGTATCACTGCTCTCTTTTGCACGATTATGT
AGCCTTTATTACTAAAATTACACTCGTTTGGACATTTTTAGGCTACAAGT
AGAGAGATAATCAAAGCCGATGCATATGTTGCAGGTTCTTTTTCTTGTTT
GTCTTCTGTTTCTTCTTTTACTAGCATGTCCAACCATACAAACCTAACTT
GGTGCTTCTAACTTCACAGCCTGTGATGTTCCGGGTATCAAAAGACTACT
TCCATCAGAATGGAGGGAATGGGAAATG
View all "cuigd-0669" genotypes
KFS1   NULL South Africa   cuigd-0725 CATCTTGGTCGCTTGCCAAAGGGCCAGCAAGCCACCACCTTACTTGATTT
AATGATTATAAGAGCATTCCACAGCAAGATCCTCCGCCGGTTTAGTCTTG
GTACAGCAATAGGCTTTAGAATCAGGAAAGGAACATTGACTGACACACCT
GCCATCCTTGTGTTTGTTGCTCGAAAGGTTCACAGGAAGTGGCTCAGCCC
TACTCAATGTCTTCCAGCTGCCCTTGAGGTAGGCATTATTTTGTTTCATG
TAGTTTACAAAGTTATGTAAGCCATTCGAAATCACATTCAGTCACATTCC
ATAAACAGGGACCTGGGGGGGTGTGGTGTGATGTTGAT
View all "cuigd-0725" genotypes
KFS1   NULL South Africa   cuigd-0742 TTTGAACACTTGAATCCCGACCTATAAATTGCTGGCCTGGGGCATGCATA
TATAATCCAAAAGAACATAAATGTCAATCAAGCCAAAAACATTTGCTGGA
AAGAGGAGCAGAAATGTACTAGGACATACAAGTTTATGCCTGGTGGCCCT
TTTCTCATCAGTGGTTCGTAGCAGACAGGGCAGGCAAACACCTCAGTTTC
CATAATGCTATTTTGCTGCTGCTCTTTTGTTTCCTGTAATCACGAAAAAT
TACGAGATCTTCAGAGGAATGCCAACTCCTAGAGAAATGGATAGCAGGGT
CTGTTAGGAAACATTTTGCTAGTAACAAACAATTGACCCACATCACAAAG
TCACAAATCCCAGAGAAATTCTCAGAGGCAACCAGCATCTACCAAAATTT
AACAAAGCTACCATAACATAG
View all "cuigd-0742" genotypes
KFS1   NULL South Africa   cuigd-0774 CTCTTCGAACACTGCGCTGCCGAGCACTGCTTCGATTTCCACAGGATTGT
GAAGGAGCTGGGGCTGGATTTCTACAGCTGCATCAAGCTCATCAACTTTG
CCCGCTCCAAGGTGCGTCAGCAACACCCTTCTGCTGACAGTAATCTTTTT
TGGGCCACGTTAATGCCAGCAATAGTATTATCTGCTCAATTGCTTTGTTT
ACGTCAATGGTTCTATGGTGGTATGAAGAGCTGATTAACGTTGCAATTTT
GTTAATTTCTGAGCGTACTCTGCTTGATTTCTTGCCGTTGCTGATTCATA
GGTTGCAGAGAAAAAATGCTGGAGCTGTGG
View all "cuigd-0774" genotypes
KFS1   NULL South Africa   cuigd-0811 TACTGTTTTTATAATTTGTTTTGCTGTATTTGTAGCTTCATGCTTTTGTG
GAGTATTCAACTGTTGAAGATGCTGAGAAGGCAGTATGTCAGCTTGACTT
TTCTATCCAGTTGTGCTTTCCCGCTTTTGGTTCACTAATAGAAGGAACAC
CCTGTGACCTGTGT-----ATAGGTTGCTGAATTCGGTGGTGGGGGAAAC
TGGAGAGATGGGATTAG
View all "cuigd-0811" genotypes
KFS1   NULL South Africa   cuigd-0874 CCTACCGCTGGATGTGGCAAAGACCATAATACAGACCGATCCGGACCCTC
ATGTGAGCCGAAACCCCTTGCAGATTTTGAGAATGGTAGTACTCTCACAG
GACCTCATAATATCGCGTTTTAATTATCTAGTATCTTGTCCTCAATGCAC
ATGGCTTGAAATGTGACAGGTTTATAAGAGAGCTGGGATGGGTGGCTGTT
ATGCTGGACTTGGACCAACTCTAGCAAGAGCATTCCCTGCCAATGCAGCA
GCAATTGTTGCTTGGGAATACAGCGCCAAGATTCTTGGTATAAAGCGAGG
CTAGTATTAAGGTACTACTATATGAACACGGAGTTACTTAATTCAAGATT
TAACCTTCTTTTCATCTGATGGCATCTTTTTGTGCCAGTAGACTAACAAT
ATATTTTCCAG
View all "cuigd-0874" genotypes
[ Download ]