grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for marker "LDregion2D" from the experiment "Hamblin et al. (2005) Equilibrium Processes Cannot Explain High Levels of Short- and Medium-Range Linkage Disequilibrium in the Domesticated Grass Sorghum bicolor. Genetics 171: 1247-1256.".

E.g., Germplasm L-WA58, Marker/locus pSB0080.

Items 1 to 25 of 29.       of 2 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Germplasm
L-WA28   arundinaceum, NULL Angola   LDregion2D CTGCTGCCTGCTGGCAGGGGAAAAAACTTGAGACGGTGGTGTGGTCGCTG
ATCGGCCGAGGACACAGGACAGCCGAGCCGAGGGCCAGGGGGAGGGGGGG
CACACGCTGTCGATCAGG--------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------TGTTGGCAAGCGTGTACCACGAGGTCGGGTCCCAAC
TCCCAACTACCCAGCTCACCCACCGGCCCGCCCGACCCACCTGTCAATGC
CCGCGCACGACTTGCACCCAACCCAGCCAGAGCCAGCCGCATCGCAGCTA
GCTTCGACTTCGAGGGCGAGCGAGCGGCTACCAGCTGCTCACGCCGGCGC
GACGTCGTAATCCACCACGTATGGCCGTAGCCCGCCAACTGCGTCTGCGT
GCACTGCTGACTGCTCCCTCCGTCCACAGTCGCG-TTTTTTACTTGCAGA
CATTATATTTAACTGTTTGTTTTTTTATAAATTATAAAATAAATAAATTA
TTAGTAAAATATCTTTAATAATAAAATAAGTCTTAATAAAATATATAATA
TTTATGTAAAAAATCAAATAAGATGAATAAAATGTCTAAAGTTCTAAAAT
GATACTATTTTTTGAACCGAGGAGGTAGCTTGGCCAAGCTGTGCAGGACA
ACGCCAGACCTCTTGCCGTGTGCTGACTACTAATTTGTACTGAGCACGGC
GAAGATCTGTACTAGATGCTGAATAATCCGCTGAAAGCTACTCTAAAGTC
CTTCCCCGTACCAGCAAGCAAACGGGACTTTTACTGGACGCCGCTGTCAC
A
View all "L-WA28" genotypes
L-WA42   arundinaceum, NULL South Africa   LDregion2D CTGCTGCCTGCTGGCAGGGGAAAAAACTTGAGACGGTGGTGTGGTCGCTG
ATCGGCCGAGGACACAGGACAGCCAAGCCGAGGGCCAGGGGGAGGGGGGG
CACACGCTGTCGATCAGG--------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------TGTTGGCAAGCGTGTACCACGAGGTCGGGTCCCAAC
TCCCAACTACCCAGCTCACCCACCGGCCCGCCCGACCCACCTGTCAATGC
CCGCGCACGACTTGCACCCAACCCAGCCAGAGCCAGCCGCATCGCAGCTA
GCTTCGACTTCGAGGGCGAGCGAGCGGCTACCAACTGGTGACGCCGGCGC
GACGTCGTA-TCCACCACGTATGGCCGTAGCCCGCCAACTGCGTCTGCGT
GCACTGCTGACTGCTCCCTCCGTCCACAGTCGCGTTTTTTTACTTGCAGA
CATTATATTTAACTGTTTGTTTTTTTATAAATTATAAAATAAATAAATTA
TTAGTAAAATATCTTTAATAATAAAATAAATCTTAATAAAATATATAATA
TTTATGTAAAAAATCAAATAAGATGAATAAAATGTCTAAAGTTCTAAAAC
GATACTATTTTTTGAACCGAGGAGGTAGCTTGGCCAAGCTGTGCAGGACA
ACGCCAGACCTCTTGCCCTGTGCTGACTACTAATTTGTACTGAGCACGGC
GAAGATCTGTACTAGATGCTGAATAATCCGCTGAAAGCTACTCTAAAGTC
CTTCCCCGTACCAGCAAGCAAACGGGACTTTTACTGGACGCCGCTGTCAC
A
View all "L-WA42" genotypes
L-WA55   arundinaceum, NULL South Africa   LDregion2D CTGCTGCCTGCTGGCAGGGGAAAAAACTTGAGACGGTGGTGTGGTCGCTG
ATCGGCCGAGGACACAGGACAGCCAAGCCGAGGGCCAGGGGGAGGGGGGG
CACACGCTGTCGATCAGG--------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------TGTTGGCAAGCGTGTACCACGAGGTCGGGTCCCAAC
TCCCAACTACCCAGCTCACCCACCGGCCCGCCCGACCCACCTGTCAATGC
CCGCGCACGACTTGCACCCAACCCAGCCAGAGCCAGCCGCATCGCAGCTA
GCTTCGACTTCGAGGGCGAGCGAGCGGCTACCAGCTGGTGACGCCGGCGC
GACGTCGTA-TCCACCACGTATGGCCGTAGCCCGCCAACTGCGTCTGCGT
GCACTGCTGACTGCTCCCTCCGTCCACAGTCGCG-TTTTTTACTTGCAGA
CATTATATTTAACTGTTTGTTTTTTTATAAATTAT---------------
-TAGTAAAATATCTTTAATAATAAAATAAGTCTTAATAAAATATATAATA
TTTATGTAAAAAATCAAATAAGATGAATAAAATGTCTAAAGTTCTAAAAC
GATACTATTTTTTGAACCGAGGAGGTAGCTTGGCCAAGCTGTGCAGGACA
ACGCCAGACCTCTTGCCCTGTGCTGACTACTAATTTGTACTGAGCACGGC
GAAGATCTGTACTAGATGCTGAATAATCCGCTGAAAGCTACTCTAAAGTC
CTTCCCCGTACCAGCAAGCAAACGGGACTTTTACTGGACGCCGCTGTCAC
A
View all "L-WA55" genotypes
L-WA88   arundinaceum, NULL Egypt   LDregion2D CTGCTGCCTGCTGGCAGGGGAAAAAACTTGAGACGGTGGTGTGGTCGCTG
ATCGGCCGAGGACACAGGACAGCCAAGCCGAGGGCCAGGGGGAGGGGGGG
CACACGCTGTCGATCAGG--------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------TGTTGGCAAGCGTGTACCACGAGGTCGGGTCCCAAC
TCCCAACTACCCAGCTCACCCACCGGCCCGCCCGACCCACCTGTCAATGC
CCGCGCACGACTTGCACCCAACCCAGCCAGAGCCAGCCGCATCGCAGCTA
GCTTCGACTTCGAGGGCGAGCGAGCGGCTACCAACTGGTGACGCCGGCGC
GACGTCGTA-TCCACCACGTATGGCCGTAGCCCGCCAACTGCGTCTGCGT
GCACTGCTGACTGCTCCCTCCGTCCACAGTCGCG-TTTTTTACTTGCAGA
CATTATATTTAACTGTTTGTTTTTTTATAAATTATAAAATAAATAAATTA
TTAGTAAAATATCTTTAATAATAAAATAAGTCTTAATAAAATATATAATA
TTTATGTAAAAAATCAAATAAGATGAATAAAATGTCTAAAGTTCTAAAAC
GATACTATTTTTTGAACCGAGGAGGTAGCTTGGCCAAGCTGTGCAGGACA
ACGCCAGACCTCTTGCCCTGTGCTGACTACTAATTTGTACTGAGCACGGC
GAAGATCTGTACTAGATGCTGAATAATCCGCTGAAAGCTACTCTAAAGTC
CTTCCCCGTACCAGCAAGCAAACGGGACTTTTACTGGACGCCGCTGTCAC
A
View all "L-WA88" genotypes
65I 1502   bicolor, NULL Nigeria   LDregion2D CTGCTGCCTGCTGGCAGGGGAAAAAACTTGAGACGGTGGTGTGGTCGCTG
ATCGGCCGAGGACACAGGACAGCCAAGCCGAGGGCCAGGGGGAGAGGGGG
CACACGCTGTCGATCAGG--------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------TGTTGGCAAGCGTGTACCACGAGGTCGGGTCCCAAC
TCCCAACTACCCAGCTCACCCACCGGCCCGCCCGACCCACCTGTCAATGC
CCGCGCACGACTTGCACCCAACCCAGCCAGAGCCAGCCGCATCGCAGCTA
GCTTCGACTTCGAGGGCGAGCGAGCGGCTACCAACTGGTGACGCCGGCGC
GACGTCGTA-TCCACCACGTATGGCCGTAGCCCGCCAACTGCGTCTGCGT
GCACTGCTGACTGCTCCCTCCGTCCACAGTCGCG-TTTTTTACTTGCAGA
CATTATATTTAACTGTTTGTTTTTTTATAAATTATAAAATAAATAAATTA
TTAGTAAAATATCTTTAATAATAAAATAAGTCTTAATAAAATATATAATA
TTTATGTAAAAAATCAAATAAGATGAATAAAATGTCTAAAGTTCTAAAAC
GATACTATTTTTTGAACCGAGGAGGTAGCTTGGCCAAGCTGTGCAGGACA
ACGCCAGACCTCTTGCCCTGTGCTGACTACTAATTTGTACTGAGCACGGC
GAAGATCTGTACTAGATGCTGAATAATCCGCTGAAAGCTACTCTAAAGTC
CTTCCCCGTACCAGCAAGCAAACGGGACTTTTACTGGACGCCGCTGTCAC
A
View all "65I 1502" genotypes
65I 1793   bicolor, NULL Mali   LDregion2D CTGCTGCCTGCTGGCAGGGGAAAAAACTTGAGACGGTGGTGTGGTCGCTG
ATCGGCCGAGGACACAGGACAGCCAAGCCGAGGGCCAGGGGGAGAGGGGG
CACACGCTGTCGATCAGG--------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------TGTTGGCAAGCGTGTACCACGAGGTCGGGTCCCAAC
TCCCAACTACCCAGCTCACCCACCGGCCCGCCCGACCCACCTGTCAATGC
CCGCGCACGACTTGCACCCAACCCAGCCAGAGCCAGCCGCATCGCAGCTA
GCTTCGACTTCGAGGGCGAGCGAGCGGCTACCAACTGGTGACGCCGGCGC
GACGTCGTA-TCCACCACGTATGGCCGTAGCCCGCCAACTGCGTCTGCGT
GCACTGCTGACTGCTCCCTCCGTCCACAGTCGCG-TTTTTTACTTGCAGA
CATTATATTTAACTGTTTGTTTTTTTATAAATTATAAAATAAATAAATTA
TTAGTAAAATATCTTTAATAATAAAATAAGTCTTAATAAAATATATAATA
TTTATGTAAAAAATCAAATAAGATGAATAAAATGTCTAAAGTTCTAAAAC
GATACTATTTTTTGAACCGAGGAGGTAGCTTGGCCAAGCTGTGCAGGACA
ACGCCAGACCTCTTGCCCTGTGCTGACTACTAATTTGTACTGAGCACGGC
GAAGATCTGTACTAGATGCTGAATAATCCGCTGAAAGCTACTCTAAAGTC
CTTCCCCGTACCAGCAAGCAAACGGGACTTTTACTGGACGCCGCTGTCAC
A
View all "65I 1793" genotypes
65I 2133   bicolor, NULL India   LDregion2D nTGCTGCCTGCTGGCAGGGGAAAAAACTTGAGACGGTGGTGTGGTCGCTG
ATCGGCCGAGGACACAGGACAGCCAAGCCGAGGGCCAGGGGGAGGGGGGG
CACACGCTGTCGATCAGG--------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------TGTTGGCAAGCGTGTACCACGAGGTCGGGTCCCAAC
TCCCAACTACCCAGCTCACCCACCGGCCCGCCCGACCCACCTGTCAATGC
CCGCGCACGACTTGCACCCAACCCAGCCAGAGCCAGCCGCATCGCAGCTA
GCTTCGACTTCGAGGGCGAGCGAGCGGCTACCAACTGGTGACGCCGGCGC
GACGTCGTA-TCCACCACGTATGGCCGTAGCCCGCCAACTGCGTCTGCGT
GCCCTGCTGACTGCTCCCTCCGTCCACAGTCGCG-TTTTTTACTTGCAGA
CATTATATTTAACTGTTTGTTTTTTTATAAATTATAAAATAAATAAATTA
TTAGTAAAATATCTTTAATAATAAAATAAGTCTTAATAAAATATATAATA
TTTATGTAAAAAATCAAATAAGATGAATAAAATGTCTAAAGTTCTAAAAC
GATACTATTTTTTGAACCGAGGAGGTAGCTTGGCCAAGCTGTGCAGGACA
ACGCCAGACCTCTTGCCCTGTGCTGACTACTAATTTGTACTGAGCACGGC
GAAGATCTGTACTAGATGCTGAATAATCCGCTGAAAGCTACTCTAAAGTC
CTTCCCCGTACCAGCAAGCAAACGGGACTTTTACTGGACGCCGCTGTCAC
A
View all "65I 2133" genotypes
65I 2165   bicolor, NULL South Africa   LDregion2D CTGCTGCCTGCTGGCAGGGGAAAAAACTTGAGACGGTGGTGTGGTCGCTG
ATCGGCCGAGGACACAGGACAGCCAAGCCGAGGGCCAGGGGGAGGGGGGG
CACACGCTGTCGATCAGG--------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------TGTTGGCAAGCGTGTACCACGAGGTCGGGTCCCAAC
TCCCAACTACCCAGCTCACCCACCGGCCCGCCCGACCCACCTGTCAATGC
CCGCGCACGACTTGCACCCAACCCAGCCAGAGCCAGCCGCATCGCAGCTA
GCTTCGACTTCGAGGGCGAGCGAGCGGCTACCAACTGGTGACGCCGGCGC
GACGTCGTA-TCCACCACGTATGGCCGTAGCCCGCCAACTGCGTCTGCGT
GCACTGCTGACTGCTCCCTCCGTCCACAGTCGCG-TTTTTTACTTGCAGA
CATTATATTTAACTGTTTGTTTTTTTATAAATTATAAAATACATAAATTA
TTAGTAAAATATCTTTAATAATAAAATAAGTCTTAATAAAATATATAATA
TTTATGTAAAAAATCAAATAAGATGAATAAAATGTCTAAAGTTCTAAAAC
GATACTATTTTTTGAACCGAGGAGGTAGCTTGGCCAAGCTGTGCAGGACA
ACGCCAGACCTCTTGCCCTGTGCTGACTACTAATTTGTACTGAGCACGGC
GAAGATCTGTACTAGATGCTGAATAATCCGCTGAAAGCTACTCTAAAGTC
CTTCCCCGTACCAGCAAGCAAACGGGACTTTTACTGGACGCCGCTGTCAC
A
View all "65I 2165" genotypes
65I 2604   bicolor, NULL India   LDregion2D CTGCTGCCTGCTGGCAGGGGAAAAAACTTGAGACGGTGGTGTGGTCGCTG
ATCGGCCGAGGACACAGGACAGCCAAGCCGAGGGCCAGGGGGAGGGGGGG
CACACGCTGTCGATCAGG--------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------TGTTGGCAAGCGTGTACCACGAGGTCGGGTCCCAAC
TCCCAACTACCCAGCTCACCCACCGGCCCGCCCGACCCACCTGTCAATGC
CCGCGCACGACTTGCACCCAACCCAGCCAGAGCCAGCCGCATCGCAGCTA
GCTTCGACTTCGAGGGCGAGCGAGCGGCTACCAACTGGTGACGCCGGCGC
GACGTCGTA-TCCACCACGTATGGCCGTAGCCCGCCAACTGCGTCTGCGT
GCACTGCTGACTGCTCCCTCCGTCCACAGTCGCG-TTTTTTACTTGCAGA
CATTATATTTAACTGTTTGTTTTTTTATAAATTATAAAATAAATAAATTA
TTAGTAAAATATCTTTAATAATAAAATAAGTCTTAATAAAATATATAATA
TTTATGTAAAAAATCAAATAAGATGAATAAAATGTCTAAAGTTCTAAAAC
GATACTATTTTTTGAACCGAGGAGGTAGCTTGGCCAAGCTGTGCAGGACA
ACGCCAGACCTCTTGCCCTGTGCTGACTACTAATTTGTACTGAGCACGGC
GAAGATCTGTACTAGATGCTGAATAATCCGCTGAAAGCTACTCTAAAGTC
CTTCCCCGTACCAGCAAGCAAACGGGACTTTTACTGGACGCCGCTGTCAC
A
View all "65I 2604" genotypes
66I 4680   bicolor, NULL Uganda   LDregion2D CTGCTGCCTGCTGGCAGGGGAAAAAACTTGAGACGGTGGTGTGGTCGCTG
ATCGGCCGAGGACACAGGACAGCCAAGCCGAGGGCCAGGGGGAGAGGGGG
CACACGCTGTCGATCAGG--------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------TGTTGGCAAGCGTGTACCACGAGGTCGGGTCCCAAC
TCCCAACTACCCAGCTCACCCACCGGCCCGCCCGACCCACCTGTCAATGC
CCGCGCACGACTTGCACCCAACCCAGCCAGAGCCAGCCGCATCGCAGCTA
GCTTCGACTTCGAGGGCGAGCGAGCGGCTACCAACTGGTGACGCCGGCGC
GACGTCGTA-TCCACCACGTATGGCCGTAGCCCGCCAACTGCGTCTGCGT
GCACTGCTGACTGCTCCCTCCGTCCACAGTCGCG-TTTTTTACTTGCAGA
CATTATATTTAACTGTTTGTTTTTTTATAAATTATAAAATAAATAAATTA
TTAGTAAAATATCTTTAATAATAAAATAAGTCTTAATAAAATATATAATA
TTTATGTAAAAAATCAAATAAGATGAATAAAATGTCTAAAGTTCTAAAAC
GATACTATTTTTTGAACCGAGGAGGTAGCTTGGCCAAGCTGTGCAGGACA
ACGCCAGACCTCTTGCCCTGTGCTGACTACTAATTTGTACTGAGCACGGC
GAAGATCTGTACTAGATGCTGAATAATCCGCTGAAAGCTACTCTAAAGTC
CTTCCCCGTACCAGCAAGCAAACGGGACTTTTACTGGACGCCGCTGTCAC
A
View all "66I 4680" genotypes
Purdue No. 49506   bicolor, NULL Cameroon   LDregion2D CTGCTGCCTGCTGGCAGGGGAAAAAACTTGAGACGGTGGTGTGGTCGCTG
ATCGGCCGAGGACACAGGACAGCCAAGCCGAGGGCCAGGGGGAGGGGGGG
CACACGCTGTCGATCAGGGCCTTGTTTAGTTCCGAAAAATTTTGGGAAAA
CGACACTGTAGCACTTTCGTTTGTATTTGACAAATATTGTTCAATCGTGG
ACTAACTAGGCTCAAAAGATTTGTCTCGTTAATTCCGACCAAACTGTGCA
ATTAGTTTTTATTTTCGTTTATTTTTAATACTCCATGCATGCGTCTAAAG
ATTCGATGTGACGGAGAATGTGAAAAATTTTGCAAAATTTTCAGGGAACT
AAACAAGGCCCAGGTGTTGGCAAGCGTGTACCACGAGGTCGGGTCCCAAC
TCCCAACTACCCAGCTCACCCACCGGCCCGCCCGACCCACCTGTCAATGC
CCGCGCACGACTTGCACCCAACCCAGCCAGAGCCAGCCGCATCGCAGCTA
GCTTCGACTTCGAGGGCGAGCGAGCGGCTACCAACTGGTGACGCCGGCGC
GACGTCGTA-TCCACCACGTATGGCCGTAGCCCGCCAACTGCGTCTGCGT
GCACTGCTGACTGCTCCCTCCGTCCACAGTCGCG-TTTTTTACTTGCAGA
CATTATATTTAACTGTTTGTT-----------------------------
--------------------------------------------------
-------------------------------------AAAGTTCTAAAAC
GATACTATTTTTTGAACCGAGGAGGTAGCTTGGCCAAGCTGTGCAGGACA
ACGCCAGACCTCTTGCCCTGTGCTGACTACTAATTTGTACTGAGCACGGC
GAAGATCTGTACTAGATGCTGAATAATCCGCTGAAAGCTACTCTAAAGTC
CTTCCCCGTACCAGCAAGCAAACGGGACTTTTACTGGACGCCGCTGTCAC
A
View all "Purdue No. 49506" genotypes
74I 10917   bicolor, NULL India   LDregion2D nTGCTGCCTGCTGGCAGGGGAAAAAACTTGAGACGGTGGTGTGGTCGCTG
ATCGGCCGAGGACACAGGACAGCCAAGCCGAGGGCCAGGGGGAGAGGGGG
CACACGCTGTCGATCAGG--------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------TGTTGGCAAGCGTGTACCACGAGGTCGGGTCCCAAC
TCCCAACTACCCAGCTCACCCACCGGCCCGCCCGACCCACCTGTCAATGC
CCGCGCACGACTTGCACCCAACCCAGCCAGAGCCAGCCGCATCGCAGCTA
GCTTCGACTTCGAGGGCGAGCGAGCGGCTACCAACTGGTGACGCCGGCGC
GACGTCGTA-TCCACCACGTATGGCCGTAGCCCGCCAACTGCGTCTGCGT
GCACTGCTGACTGCTCCCTCCGTCCACAGTCGCG-TTTTTTACTTGCAGA
CATTATATTTAACTGTTTGTTTTTTTATAAATTATAAAATAAATAAATTA
TTAGTAAAATATCTTTAATAATAAAATAAGTCTTAATAAAATATATAATA
TTTATGTAAAAAATCAAATAAGATGAATAAAATGTCTAAAGTTCTAAAAC
GATACTATTTTTTGAACCGAGGAGGTAGCTTGGCCAAGCTGTGCAGGACA
ACGCCAGACCTCTTGCCCTGTGCTGACTACTAATTTGTACTGAGCACGGC
GAAGATCTGTACTAGATGCTGAATAATCCGCTGAAAGCTACTCTAAAGTC
CTTCCCCGTACCAGCAAGCAAACGGGACTTTTACTGGACGCCGCTGTCAC
A
View all "74I 10917" genotypes
PI213900   bicolor, NULL Kenya   LDregion2D CTGCTGCCTGCTGGCAGGGGAAAAAACTTGAGACGGTGGTGTGGTCGCTG
ATCGGCCGAGGACACAGGACAGCCAAGCCGAGGGCCAGGGGGAGGGGGGG
CACACGCTGTCGATCAGG--------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------TGTTGGCAAGCGTGTACCACGAGGTCGGGTCCCAAC
TCCCAACTACCCAGCTCACCCACCGGCCCGCCCGACCCACCTGTCAATGC
CCGCGCACGACTTGCACCCAACCCAGCCAGAGCCAGCCGCATCGCAGCTA
GCTTCGACTTCGAGGGCGAGCGAGCGGCTACCAACTGGTGACGCCGGCGC
GACGTCGTA-TCCACCACGTATGGCCGTAGCCCGCCAACTGCGTCTGCGT
GCACTGCTGACTGCTCCCTCCGTCCACAGTCGCG-TTTTTTACTTGCAGA
CATTATATTTAACTGTTTGTTTTTTTATAAATTATAAAATAAATAAATTA
TTAGTAAAATATTTTTAATAATAAAATAAGTCTTAATAAAATATATAATA
TTTATGTAAAAAATCAAATAAGATGAATAAAATGTCTAAAGTTCTAAAAC
GATACTATTTTTTGAACCGAGGAGGTAGCTTGGCCAAGCTGTGCAGGACA
ACGCCAGACCTCTTGCCCTGTGCTGACTACTAATTTGTACTGAGCACGGC
GAAGATCTGTACTAGATGCTGAATAATCCGCTGAAAGCTACTCTAAAGTC
CTTCCCCGTACCAGCAAGCAAACGGGACTTTTACTGGACGCCGCTGTCAC
A
View all "PI213900" genotypes
PI221540   bicolor, NULL Nigeria   LDregion2D CTGCTGCCTGCTGGCAGGGGAAAAAACTTGAGACGGTGGTGTGGTCGCTG
ATCGGCCGAGGACACAGGACAGCCAAGCCGAGGGCCAGGGGGAGGGGGGG
CACACGCTGTCGATCAGGGCCTTGTTTAGTTCCGAAAAATTTTGGGAAAA
CGACACTGTAGCACTTTCGTTTGTATTTGACAAATATTGTTCAATCGTGG
ACTAACTAGGCTCAAAAGATTTGTCTCGTTAATTCCGACCAAACTGTGCA
ATTAGTTTTTATTTTCGTTTATTTTTAATACTCCATGCATGCGTCTAAAG
ATTCGATGTGACGGAGAATGTGAAAAATTTTGCAAAATTTTCAGGGAACT
AAACAAGGCCCAGGTGTTGGCAAGCGTGTACCACGAGGTCGGGTCCCAAC
TCCCAACTACCCAGCTCACCCACCGGCCCGCCCGACCCACCTGTCAATGC
CCGCGCACGACTTGCACCCAACCCAGCCAGAGCCAGCCGCATCGCAGCTA
GCTTCGACTTCGAGGGCGAGCGAGCGGCTACCAACTGGTGACGCCGGCGC
GACGTCGTA-TCCACCACGTATGGCCGTAGCCCGCCAACTGCGTCTGCGT
GCACTGCTGACTGCTCCCTCCGTCCACAGTCGCG-TTTTTTACTTGCAGA
CATTATATTTAACTGTTTGTT-----------------------------
--------------------------------------------------
-------------------------------------AAAGTTCTAAAAC
GATACTATTTTTTGAACCGAGGAGGTAGCTTGGCCAAGCTGTGCAGGACA
ACGCCAGACCTCTTGCCCTGTGCTGACTACTAATTTGTACTGAGCACGGC
GAAGATCTGTACTAGATGCTGAATAATCCGCTGAAAGCTACTCTAAAGTC
CTTCCCCGTACCAGCAAGCAAACGGGACTTTTACTGGACGCCGCTGTCAC
A
View all "PI221540" genotypes
PI221607   bicolor, NULL Nigeria   LDregion2D CTGCTGCCTGCTGGCAGGGGAAAAAACTTGAGACGGTGGTGTGGTCGCTG
ATCGGCCGAGGACACAGGACAGCCAAGCCGAGGGCCAGGGGGAGGGGGGG
CACACGCTGTCGATCAGGGCCTTGTTTAGTTCCGAAAAATTTTGGGAAAA
CGACACTGTAGCACTTTCGTTTGTATTTGACAAATATTGTTCAATCGTGG
ACTAACTAGGCTCAAAAGATTTGTCTCGTTAATTCCGACCAAACTGTGCA
ATTAGTTTTTATTTTCGTTTATTTTTAATACTCCATGCATGCGTCTAAAG
ATTCGATGTGACGGAGAATGTGAAAAATTTTGCAAAATTTTCAGGGAACT
AAACAAGGCCCAGGTGTTGGCAAGCGTGTACCACGAGGTCGGGTCCCAAC
TCCCAACTACCCAGCTCACCCACCGGCCCGCCCGACCCACCTGTCAATGC
CCGCGCACGACTTGCACCCAACCCAGCCAGAGCCAGCCGCATCGCAGCTA
GCTTCGACTTCGAGGGCGAGCGAGCGGCTACCAACTGGTGACGCCGGCGC
GACGTCGTA-TCCACCACGTATGGCCGTAGCCCGCCAACTGCGTCTGCGT
GCACTGCTGACTGCTCCCTCCGTCCACAGTCGCG-TTTTTTACTTGCAGA
CATTATATTTAACTGTTTGTT-----------------------------
--------------------------------------------------
-------------------------------------AAAGTTCTAAAAC
GATACTATTTTTTGAACCGAGGAGGTAGCTTGGCCAAGCTGTGCAGGACA
ACGCCAGACCTCTTGCCCTGTGCTGACTACTAATTTGTACTGAGCACGGC
GAAGATCTGTACTAGATGCTGAATAATCCGCTGAAAGCTACTCTAAAGTC
CTTCCCCGTACCAGCAAGCAAACGGGACTTTTACTGGACGCCGCTGTCAC
A
View all "PI221607" genotypes
PI267523   bicolor, NULL Egypt   LDregion2D CTGCTGCCTGCTGGCAGGGGAAAAAACTTGAGACGGTGGTGTGGTCGCTG
ATCGGCCGAGGACACAGGACAGCCAAGCCGAGGGCCAGGGGGAGAGGGGG
CACACGCTGTCGATCAGG--------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------TGTTGGCAAGCGTGTACCACGAGGTCGGGTCCCAAC
TCCCAACTACCCAGCTCACCCACCGGCCCGCCCGACCCACCTGTCAATGC
CCGCGCACGACTTGCACCCAACCCAGCCAGAGCCAGCCGCATCGCAGCTA
GCTTCGACTTCGAGGGCGAGCGAGCGGCTACCAACTGGTGACGCCGGCGC
GACGTCGTA-TCCACCACGTATGGCCGTAGCCCGCCAACTGCGTCTGCGT
GCACTGCTGACTGCTCCCTCCGTCCACAGTCGCG-TTTTTTACTTGCAGA
CATTATATTTAACTGTTTGTTTTTTTATAAATTATAAAATAAATAAATTA
TTAGTAAAATATCTTTAATAATAAAATAAGTCTTAATAAAATATATAATA
TTTATGTAAAAAATCAAATAAGATGAATAAAATGTCTAAAGTTCTAAAAC
GATACTATTTTTTGAACCGAGGAGGTAGCTTGGCCAAGCTGTGCAGGACA
ACGCCAGACCTCTTGCCCTGTGCTGACTACTAATTTGTACTGAGCACGGC
GAAGATCTGTACTAGATGCTGAATAATCCGCTGAAAGCTACTCTAAAGTC
CTTCCCCGTACCAGCAAGCAAACGGGACTTTTACTGGACGCCGCTGTCAC
A
View all "PI267523" genotypes
PI267525   bicolor, NULL Egypt   LDregion2D CTGCTGCCTGCTGGCAGGGGAAAAAACTTGAGACGGTGGTGTGGTCGCTG
ATCGGCCGAGGACACAGGACAGCCAAGCCGAGGGCCAGGGGGAGGGGGGG
CACACGCTGTCGATCAGG--------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------TGTTGGCAAGCGTGTACCACGAGGTCGGGTCCCAAC
TCCCAACTACCCAGCTCACCCACCGGCCCGCCCGACCCACCTGTCAATGC
CCGCGCACGACTTGCACCCAACCCAGCCAGAGCCAGCCGCATCGCAGCTA
GCTTCGACTTCGAGGGCGAGCGAGCGGCTACCAACTGGTGACGCCGGCGC
GACGTCGTA-TCCACCACGTATGGCCGTAGCCCGCCAACTGCGTCTGCGT
GCACTGCTGACTGCTCCCTCCGTCCACAGTCGCG-TTTTTTACTTGCAGA
CATTATATTTAACTGTTTGTTTTTTTATAAATTATAAAATACATAAATTA
TTAGTAAAATATCTTTAATAATAAAATAAGTCTTAATAAAATATATAATA
TTTATGTAAAAAATCAAATAAGATGAATAAAATGTCTAAAGTTCTAAAAC
GATACTATTTTTTGAACCGAGGAGGTAGCTTGGCCAAGCTGTGCAGGACA
ACGCCAGACCTCTTGCCCTGTGCTGACTACTAATTTGTACTGAGCACGGC
GAAGATCTGTACTAGATGCTGAATAATCCGCTGAAAGCTACTCTAAAGTC
CTTCCCCGTACCAGCAAGCAAACGGGACTTTTACTGGACGCCGCTGTCAC
A
View all "PI267525" genotypes
PI287624   bicolor, NULL Zimbabwe   LDregion2D CTGCTGCCTGCTGGCAGGGGAAAAAACTTGAGACGGTGGTGTGGTCGCTG
ATCGGCCGAGGACACAGGACAGCCAAGCCGAGGGCCAGGGGGAGGGGGGG
CACACGCTGTCGATCAGG--------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------TGTTGGCAAGCGTGTACCACGAGGTCGGGTCCCAAC
TCCCAACTACCCAGCTCACCCACCGGCCCGCCCGACCCACCTGTCAATGC
CCGCGCACGACTTGCACCCAACCCAGCCAGAGCCAGCCGCATCGCAGCTA
GCTTCGACTTCGAGGGCGAGCGAGCGGCTACCAACTGGTGACGCCGGCGC
GACGTCGTA-TCCACCACGTATGGCCGTAGCCCGCCAACTGCGTCTGCGT
GCACTGCTGACTGCTCCCTCCGTCCACAGTCGCG-TTTTTTACTTGCAGA
CATTATATTTAACTGTTTGTTTTTTTATAAATTATAAAATACATAAATTA
TTAGTAAAATATCTTTAATAATAAAATAAGTCTTAATAAAATATATAATA
TTTATGTAAAAAATCAAATAAGATGAATAAAATGTCTAAAGTTCTAAAAC
GATACTATTTTTTGAACCGAGGAGGTAGCTTGGCCAAGCTGTGCAGGACA
ACGCCAGACCTCTTGCCCTGTGCTGACTACTAATTTGTACTGAGCACGGC
GAAGATCTGTACTAGATGCTGAATAATCCGCTGAAAGCTACTCTAAAGTC
CTTCCCCGTACCAGCAAGCAAACGGGACTTTTACTGGACGCCGCTGTCAC
A
View all "PI287624" genotypes
PI510906   bicolor, NULL Botswana   LDregion2D CTGCTGCCTGCTGGCAGGGGAAAAAACTTGAGACGGTGGTGTGGTCGCTG
ATCGGCCGAGGACACAGGACAGCCAAGCCGAGGGCCAGGGGGAGGGGGGG
CACACGCTGTCGATCAGG--------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------TGTTGGCAAGCGTGTACCACGAGGTCGGGTCCCAAC
TCCCAACTACCCAGCTCACCCACCGGCCCGCCCGACCCACCTGTCAATGC
CCGCGCACGACTTGCACCCAACCCAGCCAGAGCCAGCCGCATCGCAGCTA
GCTTCGACTTCGAGGGCGAGCGAGCGGCTACCAACTGGTGACGCCGGCGC
GACGTCGTA-TCCACCACGTATGGCCGTAGCCCGCCAACTGCGTCTGCGT
GCCCTGCTGACTGCTCCCTCCGTCCACAGTCGCG-TTTTTTACTTGCAGA
CATTATATTTAACTGTTTGTTTTTTTATAAATTATAAAATAAATAAATTA
TTAGTAAAATATCTTTAATAATAAAATAAGTCTTAATAAAATATATAATA
TTTATGTAAAAAATCAAATAAGATGAATAAAATGTCTAAAGTTCTAAAAC
GATACTATTTTTTGAACCGAGGAGGTAGCTTGGCCAAGCTGTGCAGGACA
ACGCCAGACCTCTTGCCCTGTGCTGACTACTAATTTGTACTGAGCACGGC
GAAGATCTGTACTAGATGCTGAATAATCCGCTGAAAGCTACTCTAAAGTC
CTTCCCCGTACCAGCAAGCAAACGGGACTTTTACTGGACGCCGCTGTCAC
A
View all "PI510906" genotypes
PI510985   bicolor, NULL Botswana   LDregion2D CTGCTGCCTGCTGGCAGGGGAAAAAACTTGAGACGGTGGTGTGGTCGCTG
ATCGGCCGAGGACACAGGACAGCCAAGCCGAGGGCCAGGGGGAGGGGGGG
CACACGCTGTCGATCAGG--------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------TGTTGGCAAGCGTGTACCACGAGGTCGGGTCCCAAC
TCCCAACTACCCAGCTCACCCACCGGCCCGCCCGACCCACCTGTCAATGC
CCGCGCACGACTTGCACCCAACCCAGCCAGAGCCAGCCGCATCGCAGCTA
GCTTCGACTTCGAGGGCGAGCGAGCGGCTACCAACTGGTGACGCCGGCGC
GACGTCGTA-TCCACCACGTATGGCCGTAGCCCGCCAACTGCGTCTGCGT
GCACTGCTGACTGCTCCCTCCGTCCACAGTCGCG-TTTTTTACTTGCAGA
CATTATATTTAACTGTTTGTTTTTTTATAAATTATAAAATACATAAATTA
TTAGTAAAATATCTTTAATAATAAAATAAGTCTTAATAAAATATATAATA
TTTATGTAAAAAATCAAATAAGATGAATAAAATGTCTAAAGTTCTAAAAC
GATACTATTTTTTGAACCGAGGAGGTAGCTTGGCCAAGCTGTGCAGGACA
ACGCCAGACCTCTTGCCCTGTGCTGACTACTAATTTGTACTGAGCACGGC
GAAGATCTGTACTAGATGCTGAATAATCCGCTGAAAGCTACTCTAAAGTC
CTTCCCCGTACCAGCAAGCAAACGGGACTTTTACTGGACGCCGCTGTCAC
A
View all "PI510985" genotypes
L-WA71   drummondii, NULL South Africa   LDregion2D CTGCTGCCTGCTGGCAGGGGAAAAAACTTGAGACGGTGGTGTGGTCGCTG
ATCGGCCGAGGACACAGGACAGCCAAGCCGAGGGCCAGGGGGAGGGGGGG
CACACGCTGTCGATCAGG--------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------TGTTGGCAAGCGTGTACCACGAGGTCGGGTCCCAAC
TCCCAACTACCCAGCTCACCCACCGGCCCGCCCGACCCACCTGTCAATGC
CCGCGCACGACTTGCACCCAACCCAGCCAGAGCCAGCCGCATCGCAGCTA
GCTTCGACTTCGAGGGCGAGCGAGCGGCTACCAACTGGTGACGCCGGCGC
GACGTCGTA-TCCACCACGTATGGCCGTAGCCCGCCAACTGCGTCTGCGT
GCACTGCTGACTGCTCCCTCCGTCCACAGTCGCG-TTTTTTACTTGCAGA
CATTATATTTAACTGTTTGTTTTTTTATAAATTATAAAATAAATAAATTA
TTAGTAAAATATCTTTAATAATAAAATAAGTCTTAATAAAATATATAATA
TTTATGTAAAAAATCAAATAAGATAAATAAAATGTCTAAAGTTCTAAAAC
GATACTATTTTTTGAACCGAGGAGGTAGCTTGGCCAAGCTGTGCAGGACA
ACGCCAGACCTCTTGCCCTGTGCTGACTACTAATTTGTACTGAGCACGGC
GAAGATCTGTACTAGATGCTGAATAATCCGCTGAAAGCTACTCTAAAGTC
CTTCCCCGTACCAGCAAGCAAACGGGACTTTTACTGGACGCCGCTGTCAC
A
View all "L-WA71" genotypes
PI221655   bicolor, NULL Nigeria   LDregion2D CTGCTGCCTGCTGGCAGGGGAAAAAACTTGAGACGGTGGTGTGGTCGCTG
ATCGGCCGAGGACACAGGACAGCCAAGCCGAGGGCCAGGGGGAGGGGGGG
CACACGCTGTCGATCAGG--------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------TGTTGGCAAGCGTGTACCACGAGGTCGGGTCCCAAC
TCCCAACTACCCAGCTCACCCACCGGCCCGCCCGACCCACCTGTCAATGC
CCGCGCACGACTTGCACCCAACCCAGCCAGAGCCAGCCGCATCGCAGCTA
GCTTCGACTTCGAGGGCGAGCGAGCGGCTACCAACTGGTGACGCCGGCGC
GACGTCGTA-TCCACCACGTATGGCCGTAGCCCGCCAACTGCGTCTGCGT
GCACTGCTGACTGCTCCCTCCGTCCACAGTCGCG-TTTTTTACTTGCAGA
CATTATATTTAACTGTTTGTTTTTTTATAAATTATAAAATAAATAAATTA
TTAGTAAAATATCTTTAATAATAAAATAAGTCTTAATAAAATATATAATA
TTTATGTAAAAAATCAAATAAGATGAATAAAATGTCTAAAGTTCTAAAAC
GATACTATTTTTTGAACCGAGGAGGTAGCTTGGCCAAGCTGTGCAGGACA
ACGCCAGACCTCTTGCCCTGTGCTGACTACTAATTTGTACTGAGCACGGC
GAAGATCTGTACTAGATGCTGAATAATCCGCTGAAAGCTACTCTAAAGTC
CTTCCCCGTACCAGCAAGCAAACGGGACTTTTACTGGACGCCGCTGTCAC
A
View all "PI221655" genotypes
65I 1633   bicolor, NULL Chad   LDregion2D CTGCTGCCTGCTGGCAGGGGAAAAAACTTGAGACGGTGGTGTGGTCGCTG
ATCGGCCGAGGACACAGGACAGCCAAGCCGAGGGCCAGGGGGAGGGGGGG
CACACGCTGTCGATCAGGGCCTTGTTTAGTTCCGAAAAATTTTGGGAAAA
CGACACTGTAGCACTTTCGTTTGTATTTGACAAATATTGTTCAATCGTGG
ACTAACTAGGCTCAAAAGATTTGTCTCGTTAATTCCGACCAAACTGTGCA
ATTAGTTTTTATTTTCGTTTATTTTTAATACTCCATGCATGCGTCTAAAG
ATTCGATGTGACGGAGAATGTGAAAAATTTTGCAAAATTTTCAGGGAACT
AAACAAGGCCCAGGTGTTGGCAAGCGTGTACCACGAGGTCGGGTCCCAAC
TCCCAACTACCCAGCTCACCCACCGGCCCGCCCGACCCACCTGTCAATGC
CCGCGCACGACTTGCACCCAACCCAGCCAGAGCCAGCCGCATCGCAGCTA
GCTTCGACTTCGAGGGCGAGCGAGCGGCTACCAACTGGTGACGCCGGCGC
GACGTCGTA-TCCACCACGTATGGCCGTAGCCCGCCAACTGCGTCTGCGT
GCACTGCTGACTGCTCCCTCCGTCCACAGTCGCG-TTTTTTACTTGCAGA
CATTATATTTAACTGTTTGTT-----------------------------
--------------------------------------------------
-------------------------------------AAAGTTCTAAAAC
GATACTATTTTTTGAACCGAGGAGGTAGCTTGGCCAAGCTGTGCAGGACA
ACGCCAGACCTCTTGCCCTGTGCTGACTACTAATTTGTACTGAGCACGGC
GAAGATCTGTACTAGATGCTGAATAATCCGCTGAAAGCTACTCTAAAGTC
CTTCCCCGTACCAGCAAGCAAACGGGACTTTTACTGGACGCCGCTGTCAC
A
View all "65I 1633" genotypes
69I 7471   bicolor, NULL Uganda   LDregion2D CTGCTGCCTGCTGGCAGGGGAAAAAACTTGAGACGGTGGTGTGGTCGCTG
ATCGGCCGAGGACACAGGACAGCCAAGCCGAGGGCCAGGGGGAGGGGGGG
CACACGCTGTCGATCAGG--------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------TGTTGGCAAGCGTGTACCACGAGGTCGGGTCCCAAC
TCCCAACTACCCAGCTCACCCACCGGCCCGCCCGACCCACCTGTCAATGC
CCGCGCACGACTTGCACCCAACCCAGCCAGAGCCAGCCGCATCGCAGCTA
GCTTCGACTTCGAGGGCGAGCGAGCGGCTACCAACTGGTGACGCCGGCGC
GACGTCGTA-TCCACCACGTATGGCCGTAGCCCGCCAACTGCGTCTGCGT
GCCCTGCTGACTGCTCCCTCCGTCCACAGTCGCG-TTTTTTACTTGCAGA
CATTATATTTAACTGTTTGTTTTTTTATAAATTATAAAATAAATAAATTA
TTAGTAAAATATCTTTAATAATAAAATAAGTCTTAATAAAATATATAATA
TTTATGTAAAAAATCAAATAAGATGAATAAAATGTCTAAAGTTCTAAAAC
GATACTATTTTTTGAACCGAGGAGGTAGCTTGGCCAAGCTGTGCAGGACA
ACGCCAGACCTCTTGCCCTGTGCTGACTACTAATTTGTACTGAGCACGGC
GAAGATCTGTACTAGATGCTGAATAATCCGCTGAAAGCTACTCTAAAGTC
CTTCCCCGTACCAGCAAGCAAACGGGACTTTTACTGGACGCCGCTGTCAC
A
View all "69I 7471" genotypes
PI152702   bicolor, NULL Sudan   LDregion2D CTGCTGCCTGCTGGCAGGGGAAAAAACTTGAGACGGTGGTGTGGTCGCTG
ATCGGCCGAGGACACAGGACAGCCAAGCCGAGGGCCAGGGGGAGGGGGGG
CACACGCTGTCGATCAGGGCCTTGTTTAGTTCCGAAAAATTTTGGGAAAA
CGACACTGTAGCACTTTCGTTTGTATTTGACAAATATTGTTCAATCGTGG
ACTAACTAGGCTCAAAAGATTTGTCTCGTTAATTCCGACCAAACTGTGCA
ATTAGTTTTTATTTTCGTTTATTTTTAATACTCCATGCATGCGTCTAAAG
ATTCGATGTGACGGAGAATGTGAAAAATTTTGCAAAATTTTCAGGGAACT
AAACAAGGCCCAGGTGTTGGCAAGCGTGTACCACGAGGTCGGGTCCCAAC
TCCCAACTACCCAGCTCACCCACCGGCCCGCCCGACCCACCTGTCAATGC
CCGCGCACGACTTGCACCCAACCCAGCCAGAGCCAGCCGCATCGCAGCTA
GCTTCGACTTCGAGGGCGAGCGAGCGGCTACCAACTGGTGACGCCGGCGC
GACGTCGTA-TCCACCACGTATGGCCGTAGCCCGCCAACTGCGTCTGCGT
GCACTGCTGACTGCTCCCTCCGTCCACAGTCGCG-TTTTTTACTTGCAGA
CATTATATTTAACTGTTTGTT-----------------------------
--------------------------------------------------
-------------------------------------AAAGTTCTAAAAC
GATACTATTTTTTGAACCGAGGAGGTAGCTTGGCCAAGCTGTGCAGGACA
ACGCCAGACCTCTTGCCCTGTGCTGACTACTAATTTGTACTGAGCACGGC
GAAGATCTGTACTAGATGCTGAATAATCCGCTGAAAGCTACTCTAAAGTC
CTTCCCCGTACCAGCAAGCAAACGGGACTTTTACTGGACGCCGCTGTCAC
A
View all "PI152702" genotypes
[ Download ]