grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "PI22913" from the experiment "Hamblin et al. (2005) Equilibrium Processes Cannot Explain High Levels of Short- and Medium-Range Linkage Disequilibrium in the Domesticated Grass Sorghum bicolor. Genetics 171: 1247-1256.".

E.g., Germplasm L-WA58, Marker/locus pSB0080.

Items 1 to 25 of 27.       of 2 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
PI22913   bicolor, NULL China   LDregion1A CTTTTTGTGTTTTGAGAGAGTTCTACTATACTTCTGTTGGACTGATCATT
GTAAAGATTTGTTCAAATAGGGTCATCTTAATTGTTTGAAATCTGGGAAC
TGTGGCTTCACTGCACTCAGGAAAAGGCAATTCATGGTTATGGCATGAAT
AACTTATGGAAATAGACCTTAGAGTTGCTGCATGATTGTCACAAATCATT
GCTATGATATCTTATAATAGTTCTTTCTACTTTGCATTACATGTATAACT
GCAACTTTTAGTTGCGTTAAAAAAAACCCCTGTAACTCTTAGACCACTCA
CCACTGTAATCTTTCCTGAATTTTTGTTTAATGGCATGTATAAACTCACC
ACTTATGTACTTATCTAGGAAAAAATAGTCTAACTCTGTGCCCCATGTTT
GCAGCATTTTCAAACACAGTCCTCTAGAAAAAGTTATGCTGATGCAAACC
ATGTATCTGCTATCATTTTGGGTGGAGGCACTGGATCTCAGCTCTTTCCT
CTGACAAGCACAAGAGCTACGCCTGCTGTAAGAGATAACATTGAACATCA
AATGTTGATTACTCTATTATAGTATTATACAGAATATAAATTTCGAATTT
ATCTTAGTTTTGTACAGTATTTAGTGGATTCTTCTCATTTTCAAGATACA
CAATTGAACCATAATTGAAGTATGTAAGACAGCCAGTTAAAAAACTATAT
TCTTTTGGGAGACTTTCAGTCAAAATTTCTTAGAAGGTTTTTTGGTCCAG
ATGTTCTGATACCTTATTTTTT
View all "LDregion1A" genotypes
PI22913   bicolor, NULL China   LDregion1B CAAGCTTCTAGTATTGATATAATATTCAATCTGTTTAGCACGTGAACACC
TCAATTCTTGTTGTTACTGTACATCCCACCCAATCCCAGAGGCCCAGATT
ACCACGACATGAATACAAGAAGAATGTTGAACCCAGATCTAGAGTTTCTT
CTGTTTGGTGGTACTGTTGCAAATTGGTGGTGATTCATTTTGTTTTTGCA
CTTTCTGATAACAACAGGACTGTGTGATGATGGGAGCGGACATCTATGAA
ACTGAAGAAGAAGCTTCAAAGCTACTGTTAGCTGGGGAGGTCCCAGTTGG
AATAGGAGGGAACACAAAGATAAGGTGAGTATTGGATGTGGAACAACATT
GTATATGTATAACGACCGGTAGTTCCCAAATATCACACTCACTGACACCT
GATGGTATCCTCTGATGATTTCCAGGAACTGCATCATTGACATAAATGCT
AGGATTGGGAAGAACGTGGTGATCACAAACAGTAAGGTGAGCAAGCGCAC
CTACATGGGCGCAGAAACTTGTGTGCTCATCTATCCATTCCAATGCTGGT
GT-GTGACCATGCG-TTGTTCCACTCTTTGTGACAGGGCATCCAAGAGGC
TGATCACCCTGAGGAAGGGTACTACATAAAGTCTGGAATTGTGGTGATCT
TGAAGAATGCAACCATCAAGGATGGGTCTGTCATATAAACCGGGTGCCTG
TGCGCCTGCAAAACAAGAACCTACAATGGTATCACATCGATGGATCGTGT
AACCTTGGTAGGGAAGAGCCGCTTGCCAGAAAGTCCAGCGTTCGGGCGCA
A
View all "LDregion1B" genotypes
PI22913   bicolor, NULL China   LDregion1C CGCGTCCTCACTCCCGTGCGGCAACTGGGACACTGGGTCTGGGTGCGCCG
GCGCCCTACTCCATTCGCCTGCGGCCCAGGCGTTCGTCGCGTCCTTCGCC
GGCGACGAGCACCCAGCCACCCACCAGGTACCCTTTCACTCGTCCCTGCT
GTGCGAAACTGGGCACTCGAACCAGTAAGCTATTTGGCAATTTTTGTTCG
GATCTGATCTAATTACAATGTATCCATGCCTGCTAACTTCAATTTTTTTT
TTAATTTTCTTTACC-AAAAAAAAAAGCGTACAAGGGTACACCCATGTCT
CTGCTCCTCTGCCCCTGGATTCCACGTCTAGCAG-------CATTGCTTT
TGGCTATCCATTTCGGGTCATAATTGGTGTCAGTATCACCCGTATGTTGA
AGGGTGTTAGTTAGGCTTGCAAAGGGATCGGTGTGGGGGTGCTCCTAATC
CTGATCCGCGAATCCGTTTACTCAATTTGAGGGTCTGGGGTCAATCCGTC
CGTTTATTTTTTTCTGGCAATGAAGATCCGTGCGCATCTAGGTTTGGCCC
TCTCTTCACTTGTTCGTTAAGGACTGTCTTCACCCTGAAGTTTGCAAACA
GAGCAACAGACCTGAAACTAGCAAGTTGAGATTTCTGCTCAATCGTGTTG
CTTTCAACTTCTCTGTGCATGCAAAGCACAATGCACACTCAATGACTAAA
TATAGAAGAGAAAATAAATAAAATTATAAAAAGTTAGTATTGAACAAAGA
TTAACAAATTACAG
View all "LDregion1C" genotypes
PI22913   bicolor, NULL China   LDregion1D TCTTCACTTTTAGCTACTTCCATACATGTCCCTAGCTTTGTAGCCTTCTC
CTTCCGTCCCACAATAAGTGCAATT--AGTTTTCAAACT--GTCTCAAAA
TAAGTGTTTCTAGCTTGTGCACCACCTAGCACTAGAGGGCTTAGTTGCCC
TCTGTTTCCAAAGAATAATCATTGCATGTTGGGACACTTTTTATAGGGGC
ATATATGTCATGTCCTAATAACACTGATCTACCCAAATAATCGTAGAACT
GCACTTACTGTCGGACAGAGTATAATTTCCTCCCTGAATCGTACAACTGC
ACTGTCCTATCCTGTCAAGTAGAAGTTGTTAATTTCCTCCATGAATCATC
AGATCTCATACCTTGTATGAGTATTGTTTAGTGCTACATCCTGTACTTTA
TCTCTCCCTCCCTCTCTCCCCCCAAAAAAGAAACAGGGGTGGGGAGATAC
CTTATGTTTCAGTTGTAGTAACTACCTGCGGTCATGTTTCAAAAAAAAAA
AAA----------GGAAAAGAAAAAACAAACCTACTTGCGGTCATGTACA
GGCAATGATATGGATGCTGACCTGTAACCTCATTAGTTTGAGTGCTATTT
GTATGATTGTATCCTTCGTTTCCTGTTTAATTTA---GTGAACTGTGCAT
CCTCGATCACTGTCCAATCTTACGGATACCTCACATTTTGTAAACATGCA
TTGGGTTATACTACCTTATCTAACTCT-AAGCGGCGCATGCTGTAATGTA
GGAGATAATCGAGGACGACGCAAAGCTTCGAGCACTCAAAGAAGAACATG
GAGAAGAAATCTATGCACTGGTGACAAAGGCGCTG
View all "LDregion1D" genotypes
PI22913   bicolor, NULL China   LDregion1E CTTACGCCTTGCCCCTATAGTAGAGATCCTACAAATAAGTTGTCTGTATT
CTTTTTACAACAACTCAAAACACATGTCTTCGTAAATTCAACAGAATTTC
TTATATGAAAACTATCTATGTACAGGGAACATTATTTTTAATGAACGTTT
TCTCCATCCCAGTCTTCGAGTGTGTTCAGGTGATGGCTTCTTCTTCCTTC
GGGTTTAGAAAGGAGGGCTTGGGGAAATAGGTAGGCACAGTGATTGATGA
GGACATGACATCTATATAACTATTGATTATAAG-TGAGCTCATTCCTATA
TTTGTATAGTGATTTTTTGGTATAATTCACTTGGTTTTACATGTACATAT
CATTATTTGATTGTAGATTCAAATATATCTCAAAGTGCAAGTCCATCAAA
GTGAATCTTTCAGTTCATCGGCAGCTCGATATTGCTTTATTGGGAAGACC
ATAACTTATCCATCCAAAGTGAGATCGAAGTCGATGAGCACTTGATGGAA
AGCTTGTTTGATAAGCTTTCAAATAGATCTGATCCTACCTCAATATCACA
CTGACAAGGACTTCAAATCATCATGATATTCTGTCACTATTTCTGCCAAA
AGCTATATCATCATCATGGGCATATTTTCGTCCTTAGGACCCTG--GCCT
AAGTGGGAGCACACCCCAAAGAGAAGGAGAACCCACCAAGGAAGCCCTTG
GACGTCCTCCTCCTTGGCCACCACTTTAAAGGGTCAGCAATTTCGTTCAA
GCCAAGTCAGAGATCCTATTCATATCAAGTTCGAATCCATCTCGGG-CTC
CAGGAGCAGTCTATAGTAAAACAAACGCTCAGGATACATTTTGGACTCTG
TTTTTGATGATCCACATATGGATGGAAATATAATTTCATGATCTAACCAA
TGGCTTTAGTTTCAGGCCCAAACTCCATCGGAGTCAATGGAAATCGTTGA
AACAAGTTGACGTCCAGAATCTGTCAAGGCA
View all "LDregion1E" genotypes
PI22913   bicolor, NULL China   LDregion1F CCCTGGCGGAGAAGGCGGCGCTGGCGTACGCGGCGGAGCACGGCATGGAG
CTCGTCACCATCATCACGACGCTCGTGGTCGGGCCTTTCCTCAGCACGGG
CATGCCGCCGAGCATGATCACCGCGCTGGCGCTCGTCACGGGGAACGAGG
CGCACTACTCGATCCTGAAGCAGGTGCAGTTCGTCCACCTCGACGACCTC
TGCGACGCCCACATCTTCCTCTTCGAGCACCCGGCCGCCGCCGGGCGCTA
CGTCTGCTCCTCGTGCGACACCACCATACACGACCTCGCCGCCATGCTCA
GGGATAGGTACCCCGAGTACGACATCCCGGAGAGGTTCCCAGCTGGGACT
GGGATCGAGGACGACCTCCAAATGGTGCACATGTCGGCCAAGAAGCTCCA
AGACCTTGGGTTCACTTTCAGGTACACGAGGATGGAGGACATGTACGACG
ACGCCATCCGGACGTGCCGGGAGAAGGGCCTCATCCCCCTCGCCGCTGCC
GGAAGGGACGACGGCTCTGCCTCAGTGCGCGCACCCGGCGAGAGGGATGT
GACGGCCACTGCCGGAGGGGACGTC---TCTGCCCCAGTGCGCGCACCCG
GCGGCGAGACGGATGTGACGATTGGCGCTTAGGCAACAATCGCTGGTTTG
ACAAAAAATTACGGCT-CCCCGTGGATGATGATGCTAT----CAGCTATC
TATCGTACGTCCCTTCGAGCGCCGCTGGCAATGCGGGAGGGAATTTACAA
CAACAATGCCTCGACGCGCGAAGTAAATT-----CGGTGTGTTTGAATTC
C
View all "LDregion1F" genotypes
PI22913   bicolor, NULL China   LDregion2A CCATCCGCCATGGATAGGCCGGCTTCATGGGTCATGCCTGCGTGACCGCT
CTGTGTTGT---GTAACGTGTAGTATTGCTGGGCCAGAAACATCACGCCT
CGTTTGTCATGCCCCGGCAATAGTTGTAGTGGACTGTAGTCTGTAGTAAT
TCCGTTGCGACTTGATGACAGAATCCGAGCAAAATACGTTTGAAGGCCCC
CTGTCAGAAAGGAAAATCTGCACTTAAGGCGAGTTTT-ACTACTAGTGTG
CTCGTGCGTTGGTCTGTGCCCTT-GTACATACACGTTCCAACGCTGCACG
GAATTCATGTTTACTGTCATTAGTCTTTAAGATGGAAATTTTTTGTGGCT
TGTGGTATTGATGCTTGGTTTTTTTttttTTTTTGCTCCAGAATGTTTGG
AAATTGTTTCGGCGCACTGAATAGGTGATCACTTTGATTAGTTCTAGATA
TNTGAACAGTATTTTGATACGGTGTATGTTTCACCTTCCAAACATTTTTA
TCAGAAAAAAAA-TAATAATAA---AAGATAGACCG--------------
--------------------------TATCATTTCCTTTGTCATATTTCT
CTAGTTCAATTTTGTTGTAGGATGTTGAGCTTATTTTACACTGAAAAAAT
TATACACTAATGGTTAAGGAGATTGTCATGACACTG--AATTGTCTGGCA
GATGCCATTTCACCTTTCAAACATTTTTTATTAGGGAAAAAAA-GATAGA
CAAGCGTATCATTTCCTTTGTCATATTTCTTTAGTTTAATTTTGTTGTAG
GATGTTGAGCTTATTTTACACTGCAAAAAATATACAGTAATGGTTAAGGA
GATTGTCATGACACTGCG
View all "LDregion2A" genotypes
PI22913   bicolor, NULL China   LDregion2B GCGTGTGACATTGTTTTGCACGAAGGCTTTAAGGGCTTGT----TGCTAG
TTTTAGCGGGTTAGTGATTACTATCCTGATTCTAATTGGAAATGAAGTGT
CTTCCCTTTTCGTACATAATGTTATGATTTGTTATTCAGGCATCAATTGA
AATTTCTTTAGTTTCTTTTGTGCTGGGCATCTTTTATTATCGAGAAATTA
TTCTTACCTTTT-GAATTCTTATTGCTAGAATAGGCTTATATTTGTTGGT
GGAGATTATGCTGAAATGTGCATGATTCTGGATGATGAAGAAAATCAATC
GGATTCCCATTGATTTTACAATATGATTTTAACAACCAGCTACTTCTGAC
AAAATCATGCTATATCAGGATATACTTTGCCTCTTTGGTCCAGCAATCTA
ATCCTTTCGCTGATGTTTTTGTCATCGTGGTTGATTATTTGATACATGCA
TTTGTTATGATGATACACCATTTTCAGATCATTATGTATGGTTCTGTATC
ATCTTAACTCCTTTAAATTGATTCATTCATTTATTTATATTGTGATGTGC
CTATGATGTGATCAAAATATTTGCTACTCTTGATGGGTGTT---CCCATT
TGATGATCTTAACCACCAAGATCTCTGAGGCCCATCACATTGCAATTAGA
AAGACTCAGTTCATATGAGCACTTAAGAGTGGCAGTAGGAGTTGC-TGAT
GTAGTGTGTT
View all "LDregion2B" genotypes
PI22913   bicolor, NULL China   LDregion2C AGTGCATAAGAAAAGGTAAGTATAACTATAAAAATTTGCATTTTATCAGC
AAGTGACAATTATATCCAGCTTATGGCCCATCTACAAGACAAACTAGCTA
AATAGCAAATCATCTGATCAAGAATACAAGTCCTGCATTACATTCCTCAT
ACAATGAATGAAGGAAAAAATGCTACCCAAACACAGAGAAAAGACATCCC
ATGG---CTTCATCTTTAAGGAGGGGAGTATCAAACTGTAGCTGTTCAGG
AAACTCACTCAAAATAGTTCAGGGAGGAACAGGGGTGGAGCCAGAATATC
AAGTCACTAAGTCAAATACACTTTTTGGTTAACTAAGAAGGGTGGTTTGC
AAACCTTAAGGAACTTCTAATGGAATTTGAATTTTTCATCAGGTCAGCTG
AACCCAACGAATACACATAGCTCAGTTCCTGTGGAGGGACACACAAGGAA
CACTTGTCCATGGACACTTGTA------AAGTTTCATGATTTCTAAAACA
CAATCACGTGCAAGAGAATGATCTAACATTTTTATGATTAAGAATTAAAT
ATCACTACATCAGTACATTAATCATAATTGGAATTTGTTACTATTTGGTC
GAGAGAGTTGGACAGAGCAAAAGAGAAGGAAAAATAGTTTATAATACCTC
GGCCTCAATTTGCTGAAGTAAGCCAATCTCTGCTTGCTATTCCTAGTAAG
ACGGTGGTCTGA
View all "LDregion2C" genotypes
PI22913   bicolor, NULL China   LDregion2D CTGCTGCCTGCTGGCAGGGGAAAAAACTTGAGACGGTGGTGTGGTCGCTG
ATCGGCCGAGGACACAGGACAGCCAAGCCGAGGGCCAGGGGGAGAGGGGG
CACACGCTGTCGATCAGG--------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------TGTTGGCAAGCGTGTACCACGAGGTCGGGTCCCAAC
TCCCAACTACCCAGCTCACCCACCGGCCCGCCCGACCCACCTGTCAATGC
CCGCGCACGACTTGCACCCAACCCAGCCAGAGCCAGCCGCATCGCAGCTA
GCTTCGACTTCGAGGGCGAGCGAGCGGCTACCAACTGGTGACGCCGGCGC
GACGTCGTA-TCCACCACGTATGGCCGTAGCCCGCCAACTGCGTCTGCGT
GCACTGCTGACTGCTCCCTCCGTCCACAGTCGCG-TTTTTTACTTGCAGA
CATTATATTTAACTGTTTGTTTTTTTATAAATTATAAAATAAATAAATTA
TTAGTAAAATATCTTTAATAATAAAATAAGTCTTAATAAAATATATAATA
TTTATGTAAAAAATCAAATAAGATGAATAAAATGTCTAAAGTTCTAAAAC
GATACTATTTTTTGAACCGAGGAGGTAGCTTGGCCAAGCTGTGCAGGACA
ACGCCAGACCTCTTGCCCTGTGCTGACTACTAATTTGTACTGAGCACGGC
GAAGATCTGTACTAGATGCTGAATAATCCGCTGAAAGCTACTCTAAAGTC
CTTCCCCGTACCAGCAAGCAAACGGGACTTTTACTGGACGCCGCTGTCAC
A
View all "LDregion2D" genotypes
PI22913   bicolor, NULL China   LDregion2E TGTACAGCAGGACCATATCAAATCTAAAAATAGATTAATGATCCACTATA
TTAATAACAATACCAAGATGTGCACATGAAA-----------CTAACCGG
ACCAATGTGAAGTTCAATTTTACATCAACACCCAGCTACCACGGATTTTA
TTTTTCCTTAACCCAGCAGACCTTGCTACCTGCTCATCATTACCAGCTAT
CACATGACCACCAGGAACTTGCTCTTTCCTTTTTGAAACCCACCAAAGCT
TTGCCACTGGCTCAACATTGAGATTCCCTGACCAGTGACCAGCTCCTAGC
CTACCCATCCTAACCATAGGATTCAATCACGATGTGGTCTTCAGCTATTC
CATTATCAAGTTGAAACATCAGAACACTACTCAGGAAGACAGGTACAAAC
AACTCATGTTCATCAAAAGTTCACTTAATTTCCAGTCTTTTACCTACTTA
TTCTACTCAGCAATCGAACACTAGCAAAACATACAAACATTACTAATTAT
CATTCAAACCTGAAAATACAATCAAAAGTTTCATGATCTGGTATAGATTT
CTCACAGCTCA-TTTTTACCAACAAGTTCATCTCTCGTTAGCTCCACTTG
CCCCTGCTTTTCAAGAAGGAATTCCCCCTGCCTTTCACTAGTCAATAACT
TTTTT-AAACTACACGCACAGCATAGTAC-TTTTTTTCATGGAAAGCATT
CCCTTAATAAACATCAAATGACCAAATCAAC-AACCTAATCAAAGCACGG
AGAGTTTCATAACC
View all "LDregion2E" genotypes
PI22913   bicolor, NULL China   LDregion2F GTAGTATTACTAAAGCATGCAGCAGAACCACTTTCATCTAACTCGATCTT
CATACCAAACTCAACCAAATTGTCGCTGCATTTTAACACATTTGATTAGA
TCGCAACACAGAAATAATAAATTGGGCAGTGAACTTAAGAACAAATAAAT
ATTTGATTCGATACACAAAATGTGGACAATTTGCTAGTTTTAGTGTTAAT
AGCAGAGTAAGCTACTAGCCTACTATGACCCATCTGACTGAAAATAGTGA
ATGCCATTACCAAAGAAGTGTTTGGCAGTTACATTTTTGTTACAAACCAA
AAATACATCTAAAGAAATAGTTAAGCCCACA-TTATAAGTGTTGCAGACA
CCATCATGCTGTTACTGTGAAGAACAACT------ATTAGTAAAGTTGCA
GGCTCCTAATTTCAACATAAAAATGAAATGAAGAATCATCAATGATATGA
TGACACTGCAGCACCTCAATTTACCTTTGCTCAAACATTCCACATGTTTG
CGAAAAGGAATCAGTTGATACACCAAATGAATTTAGAAGTGAATCAATTT
CCATTTGCTCTTCACATTCATACAAGATGGGTGACTTTTTTGAGCCATTA
TCCACAATTCCATCTGGAGTATGTATGAATGAACTTGACAGTTGATGTGA
TATATCGTTCTGTCTGTCTCCAGTGCTTGGCATAAAGCCAGAAGATTCTA
TGTGACCAGGATTTGTTCCCC
View all "LDregion2F" genotypes
PI22913   bicolor, NULL China   LDregion3A CGCCGCACTGTCCGGCGCCCGCCGCCGACGAGCGCGGCCTGATGAGCTCC
GTTGCACTCGCACCACCACCACCGCTGCCGCTGCTGCTGCTGCTGC---T
GGATGCGCCGCTGCGCACGGACGGCGCGGCGGAGGACGCGAACCTGCCCG
CCGCGTCGACCTGTTTCCGGTTCACGTTGCAGGGCTCGGTCGCCCTGCCG
AAGCTGCTGCCGGGCCGCTTCAGGTGCGGCATCGCCTCCTTCTCGCTCAG
CAAGGTGCGCAGCTTCTTCTGCTCCTGCGCCATGGAAATCACCACTTTCA
GGTTAATTATTCAGAATTCTTGTGAGTGCTGTTCTTTTCTTGCATTTTCT
CGCAGGTGTCAAACGATACAGTTGCAGTAATGTCTGTTTACCCTGAGTCG
CCTCCTCTCCTCTTCCTGCCTGATCCTGGCTTGCTTGTGCTCCTCCAAGA
CTGCAACCAGGCGAGCCTTGAAAACGGCAAGAAACAGATCAAATTCGTCA
GTTTCTACGACCACGACCACTGAATCATGCCGCCACAGCAGGAACTGGAA
AAGTAGCATACCCCGTCGTACAGGAACGGCTTCTTTCTTTCGCTCTCCCA
TGCGAGTGTTCGAATGATCAGGTTGTCAACAACGGCTGCAGATTTACCAA
CAACGAATTGCTTTAACCGAACTTCAGAGATGCAATCGGAATAACCAAGT
AGGTATCACATTTGGTCTTGTATGAAATGTACCTGGAATCTTGGTGATGA
TAAGnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnAAACACACAGCAGTTGT-CC
CTGTCTTTATCTGTCTTTCGCATTGGAAATCACTGTTCAACGTATTGAAA
ATGCGCATTTTGGACCTACCATGTTGTACTCCTCGAGCCATTTCTCTTCC
TCGCACGCCAGCAGCCACTTGTTTATCTTCTCCATGACTTCTCTCCTGGA
CTGGAGCTCTTCCCTGGCTTTCGCTATCTGTTCGTCAATGCTGGCCATGA
GCTCAGAAGGATTCACGAGACCTG-----G-TAAAGTTTTGTCAGCATTA
GAAATATCAACCTATCTGAACTTTATCATCTCGGTCATAAGTACAGTATA
AGCAGGAACTCTGAACTCGTCGTACCAGAGTCGATCAGCGCAATGGATTT
CTCCGGTACGGTGCTCGCATCAGGCTCCACGTGCATGCTGCGGCAGATGT
TCTCCAGCTCCAGCCGCCTCTTGAGCACGAGCTCCTTCATCCGGCCGGCC
TTGAGCCTCGTCAGCCTCTCCACCTCCTCCTCCGTCTGCACCACGGCCAC
GCCGATGAAACGCCCAACAGGTCAGACACTGACTCTGGAACTACGGCAAT
CGAGTCTGGTAGTGTCAC---AGATCACTGCTGTGTAGTGTGTGTACCTT
CTTTATGGTCGCCACTGACAGGACGCCGGA
View all "LDregion3A" genotypes
PI22913   bicolor, NULL China   LDregion3BC TGGGCCGTTCCTGTGCGACGCCGTGAACTGATACCTCGGTGCGATGAGGG
CGAAAATCGGTGCCATGACCTGCAGTTGGCAGCAGAAACGTTTTTCTTGA
AGATGAGTGATGGTGTCTGCAGACTGCACACACTACCGTAAGCACAAAAT
TGGTAGC-AAGCGTGAAGTAATATTTTCTCAGAACAATCAACCCATAAAA
A-TGTGGAACAATAT--------------------CTGACCCCGTGACAC
AATGTTTAGGAAACCACAAGGGACCGTGCTTCTGCTTCATTTTTTC---A
ATGGTATAAATATACTGCTAGATTATATTGTTTAAGAAATAACAAGACAA
ATATTACTGAACATTCAACCTGCTTCATTTTTTCAAGGACATAAGTAGTA
GATATTGTTTAAGAAAGAACAAGACATACCGCTATGACTGGGTGGGCAGG
CTGAACACGGACAGCTGGTGATGTCAGGACAATACCGCTAATGAGAGTTT
TTACCTCTGGATCAAGCGCAGCCTGTTGTGAATCAAAACAGTTAGATTTA
AACAGCACAAAAGAAATGTGCAACAACAGTCCTGAA-GAAGTAAGTTCCA
CAATAATGCAATTCATATGGCACCGCTGCCATTACCTTCAGAATGATACC
TCCACCAGTCGAATGGCCGAAGCAGAAGCATGGAAGACCAGGGTTCTCGG
CTAATACTTTCTTGAGGTACATTTTCTACATTAATCAGAAGATTTTGAAT
AAGGACTTACACAGATGGGTCTCAGAGAGCTGTGAAGATATTCAATTGCT
CTTACCAAATCATTGACAGCATAATCAAGAGATnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnTAAATTTATCACTGATTCTCAGAGTGATGCCTGCAGTTCTGA
CAAATTCCAAATATTAGTTAGCTCAATTGTTTGCTGCATTATTACTATTG
CTATCTGGTTCCTTATTATAATCTAGAATCTCATCCTATGCTCCTACATC
TTGACATAGTTAATATTTTACATGGTTATACGTAGT-AAAAAAACTATAA
GCAACTCCAAACTAGCACGCAGTTTGTCTAATTCAACAAAGAGAAGCTAA
CCTGAATAAGGGAAAAATAGTTCATAGGCCATTTTTTTGTAATTGTTAAA
TGATGATGTGTACCCAACAATCTGTATCCCTCAAACAGAGTTAAGTGTCC
AAGCCGACAATTATGAATAATCAACACTTCAATTACAATATGGAATGGGA
ATCCACTGAACTGGTGCACTTTATCTAAGCTCCCAGATCACAACCAGATA
ATACACGATACAATAAGGCAACCACAAAGTAACCATGAAAGCGGAGAAGC
ATCATAGCTAAGCTCCCAGCTACAAACCAGATAACATTATCCATCTCAAC
TTCTCAAGGTCAGGGCCTACTTTGGCAGGCCACATGGCTTAGAATCCACC
AAATACAGTGGTAGGGAAAGCAGAAGTGCAACCTATAGGTCAGGAGTTCA
AATCCCTGTTCTCACCACAAAAATAAATAAATAAAAGGCCAATCGTTGCT
ATTTTCAGTGAATGGGTCGGTAACATTAGAATCGGATTTAGACGGAGTAA
GGACAACCAAGGAATGAACAGCTAAAATGAAGCCCTATTTT-GAATGGAG
CAATAAAATTAGAATGGGACTAAGACGGAGTCGGACAACCCAAGGAATGA
ACAGCCAAAATGAAGACAACAAAACACCTGGACACTAAAGTGTAAAAAAT
AGACAGCCTTGCATTTCACTTTAGAAATTGGGTCCATTTCGTCCTACTGA
GAAATTGGCATCTTTATTCATTGCTCTCGTCATAGCTGGTGAATTGTTTG
TGGCACTAGTTAATTAAGTTCACAATCACACAATCATCAACATGGATGAA
AATCAAATCAAAACATACATGCATAAGTAGTTCGTGATAC--TATAAGAT
TTGAAGCATGACAACCAAAAAAGGAGAAAAAAG
View all "LDregion3BC" genotypes
PI22913   bicolor, NULL China   LDregion3D GTGAATCATCACCAAGTGTTGCAAAACCAGATACCAGATCAGAGGTATCT
TCTGCAATACCTTGACTGACAGACAACCAACTACTGCCAATTGTACGTCT
TCCACCTGAATATGTGAGTGCAAGGTTATTATTCAGGAGCCAAACAATAT
GATACAGAAAAATTAAAATAATCAGCATTAAGAAGTAAGAACATGCAGCC
ATCACCTCACACTTCAGGGGAAAAAAGAAGAAAAACGTAGAAGATGAATG
GAAAACAAAACAACTATAGAAAGATGAAACGTCGGTCAATGATCTATCTA
GGGGAAAAGAAAGAAACCATTAAGCAAAATAGTTTCTTTTTGTGTGTGTG
GAGAGGGAAGGGGGGCGAGGGGGGCATTGCTTTAAAAAAAATAATTACAA
CATATGGATTATCACTAATAATTTATACACGGTAGAGCAAGTATCGCATG
CAATATATGTACTTGAAACGTCTGGAAAAACAAAAAACTAATAATTTTCT
CACATTGTAGTGGCAATAGACGAGGCTTAAAAAAATAAATGGGTCTGACA
AAAATTTGCAAGTACATGTATCATTTCAAATTGAAGATCGTTAATAGTCA
TGTAAGTGTAAAAGATATGTTGCTACTTAGGATGTGCCTAGCCATGTCAA
TGAAGAGAATAAATAAATGTTGGTAATTCAGTAATTTACTAGTAACACCA
ATAGGCAACATTTCACAAGAAAAGATGAGATTCTTATTCTGTATTATTAT
AACAAATGTACAGCAATAAACTACATATCAATCAATGTCCTTAGCCATTC
ACAAATATGATACACAAAACATGAATATTAGTCGAACGTTCAAATTTCTT
TGGCCTACTGAACTAAAGTCAGCATTATGGCGTGGGAATATTTTGCATTG
ATTGCAGTCTATTAAACAAAAGTGCCATATCACTATTGAACTCGCTAGCA
ACATACCTGAAGATGTTATTTCTTGCCCAATGGGAACATCAAGATAAGAG
CCAATCATAAAGGCATGATCAACACTAGACTGCTTGGCTCCAGATCCATG
GTGATTGATCTTTTCCTCCCAGTTCATGTTGACTAGCTTATCTTCAGACT
TGAGCCTCACAGGAGGTAACTTCGGAAGCTCCTCACGCTGATTATCTCCA
ACAAGCTGTAAATCGAAGCATCGGTCAGACACCTGATCTGTATCTAGGGA
TTTTTCGAAGTAATATTGCCTGTTCCCCTCATCAAGCTGTCCTTTTGCAC
CTTTTCCAACACCATCTCCATTAGTGCTCCTCTTTACTTCTTTCCTCTCA
TTTTCATGGTGCGTGCTATTGTAACTAGATGATGGGTTTTCCGCAGGGAA
TGGAAGCACTGTCTTAACTGTGCAACCATTCAACATCTCCTCTTTTTCTG
GTACTAGATTTTTATCCCTGGAATGACCTTGTTCATTGATTTCAGTCCTC
CCAGCAGCATCGACTTTTCCCTTCCCTCTTCCAAAAGAGACTTTTTGCTC
CAACACTGGGACAGGCTGTTCTGTCCCAACACCTCGATCCCTCTTCTCTG
CCAGCATCGCACCACGCCTATGCCTTGGCACCTCTTCTGACACCAGCAGC
TCAGCTAGCTGTTCAGCAGTGCTGTTTGCAATGCTGAAGGTCCAAGGATA
CAGATCCCCCACGTTGTTCTCCTGAGGCTGGCCAATCCCAGAGCCCTTCT
TTCCATCCGAACC
View all "LDregion3D" genotypes
PI22913   bicolor, NULL China   LDregion3E GACCTTCATGACCATGTTGTTGGGGTGTGCTTTGTAGCCCAGGATATGAC
TGTTCATAAGTTGGTCATGGACAAATTTACTCGGGTTGAGGGGGACTACA
AGGCAATCATTCACAACCCAAACCCGCTCATTCCTCCTATATTTGGTGCT
GACCAATTTGGATGGTGCTCTGAGTGGAATGTAGCCATGACCAAGCTTAC
TGGGTGGCACAGAGATGAAGTGATAGATAAGATGCTCCTTGGTGAGGTTT
TTGACAGTAGCAATGCTTCCTGCCTTTTGAAGAGCAAAGATGATTTTGTA
CGTCTTTGCATTATCATCAACAGTGCATTAGCCGGTGAAGAGGCAGAAAA
GGCTCCATTCGGTTTGTTTGACCGCAATGGGAAATATATTGAATGCCTTC
TGTCAGTGAACAGAAAAGTAAATGCAGATGGTGTTGTCACTGGAGTGTTC
TGTTTCATTCATGTTCCTAGTGATGACCTGCAGCATGCGCTACATGTGCA
GCAAGCCTCTGAGCAGACAGCACAAAGAAGGTTGAAGGCTTTCTCGTACA
TGCGACATGCCATCAACAAACCTnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnAATGAAGAGCAGATGAGGCAGGTCCATGT
TGCAGATAGTTGTCATCGCCAGCTAAACAAGATACTTGCCGACTTAGATC
AAGATAACATTACTGACAAGTAATCTTCTAGTCTTTTAAACTGTTCTATT
AGGTTATTGTGTTTACTTTCATCTACCTCGTTATTTGACAACTTTCTGAA
CTGTAGGTTAATGGTATCACTTAATTTTATTTCACTAACTACTACTGAAG
CTTATAGCCATATTCGTTACTACCAACTTAATATTTATGTACCATTATGT
TCACAGGTCAAGTTGCTTGGATTTGGATATGGCTGAATTTGTGTTGGAAG
ATGTGGTGGTGTCTGCTGTAAGTCAAGTACTGATAGGTTGCCAGGGTAAA
GGTATCAGAGTTGCTTGCAACCTGCCAGAGAGATTCATGAAGCAAAAAGT
TTACGGGGATGGTATCCGACTCCAACAGATCCTCTCCGACTTCTTATTTG
TTTCGGTGAAGTTCTCTCCTGTTGGTGGCTCTGTTGATATCTCTTCCAAA
CTGACTAAGAACAGCATTGGGGAAAACCTTCATCTCATAGACTTCGAACT
TAGGTACACTTGCCATGCTAATTTGCATGCATACACTCATTTCTGAATAG
GAAATCATAAGGTATGAAGGCTTAAATTACTCTTGTGTTTATGGATTTAT
GGTTTTCAGGATCAAGCACCAAGGAGCAGGAGTCCCAGCAGAAATATTGT
CACAAATGTATGAGGAGGACAATAAAGAGCAGTCAGAGGAGGGTTTGAGC
CTTCTTGTTTCTAGAAACCTTCTGAGGCTCATGAATGGTAAC
View all "LDregion3E" genotypes
PI22913   bicolor, NULL China   LDregion4A CGGCGGGCCGGAGAAGCAAGGAGGAGGAGGAGG---CATGGGGATGGGCA
GCGACGCTGCCGCCGTGTTGTTCCCCTTCTCT---------ACCACCACC
ACCACCACGTCGCCGCGGCTCTGCGGCACCGCCGTCAGTAGTCACAGGAG
GTCAGCAAGGATCCCCATTCCATCTCCAACTCCCGTCCGCTCTCCTTTGC
ATTGCA-----TTGCATAATGGCAACACGGAACAGGAACAGCTTGCGATT
TCTTACCTCTTTAGATTTGATCCCTCCCTTCGCCGTTTGCTTCCCCGGCT
CGACTTCTCAACTCCGTCCATCTATCGTTTTGCAAGGACAAGCATCCCAC
GGCCACTCTGAAAAAGGGGG--GAAAAAATTGCTTTTGCTCCTCTGAAGG
TCCCGTCCAGCAGATGCCACTTCTGCTTCTCTTCATAATACCATCAGTCG
CCACCACCCCTGGATCTCTACAACATCCTTTCTTAGTTCATACAGTGCTT
TGTTATCATTTCCTAGAGAGTGAAATTTCATTACCTGTTCCGTGGTACAA
GCAGGTACTAGCAGCCATTCCCTGGAACAGTCTGTTTCAGACTTTCAGTC
AGTTGATTCTTCAGCATCCGCTGTTCTTGGGAGGGAGAGTGTGGCAAAGG
CAAAATGGTGTCATTACAAGCAATGCACTAGACGTTTACTACACATTGCC
AACTCAAGTGCTAACTAATCTTGGCGTCTAATAAAACTTTTGGGGG-ACA
TTGCATTGACCTGC
View all "LDregion4A" genotypes
PI22913   bicolor, NULL China   LDregion4C CAAATGGGTATGACACATGGACACAGTTTTCAGTTTCTTGTAAAGTTGAG
GTGTGAATAATATATTAGTTTTTTCTATTAAAAAATATTATCTTGTTATC
AAAAACATTGAAATTCCTAAGTCTGAAAAGGAACTGCACTTATGTATCCT
TGTGAACTGTTAAGATATATTGTGCTGTACTCCATCTAGTTCAGTGTGAA
GATCAATTATAAAAGCATGGCTTCATATTACAACCAACATTTTTATGGCC
CTGTCCTAAGATTCTTGATTTAAGTATTAATTTTAGGTCTTGAGCTTCGT
TCAGAACTGCCTTGAAATATTCCATATAAACTTGTTACTGAAACAAATTG
AATCTATGTGGCTGCAAACAACAGAAATGGCAAGATAAATTGCTAAACTC
CGGAACACATTCAGGATGTACACATAGTGCAAGAGAAATTGCTTTGAGTA
CCTCATCTACCTTGCAAATTCAATTTCATCTCACTGGCTCCATTGGAGCT
TGTTAATCTCATCACCTTTACTCATAATTCTCTGTGTCAGATTTTCTGTA
CATCTGGCCTAATAAGGTTCAATACCTTTCTCCACATTAGTAATAACAT-
------------TAGCAAGCCAATATAAAATGTTAAATCACATCTTTCAT
CCTGATTTTTGTACTTTTCTGAATTTGCTGTTTTCTTATATCATATTTAA
GTA
View all "LDregion4C" genotypes
PI22913   bicolor, NULL China   LDregion4E TAAAGAAAGTACATTAGTTCAAAAGCAACCAAAGGAGGGTGAACTTCAGA
ACTTGGCATATAATGATCAAGAATTGCTGCATTGGCTAAACAAGTTTTCA
AGAGAGTAAAGGTAGAGGAGAAT-AGTCAT---CCATGACGTACTAAATG
CTTCACTAGTCAAAATACAGTGTGTTGTACTGGAACTTTTTTCGAATCAC
AAGGAAGGAACCTCAATTAAGGGACCTGGGGACCAATCTGGGTCCTCAAA
AATATCAATAAACACTGCAGGATAGTTTTTTTTTATCTTAACACTGCAGG
ATAGTTACTTCC-AAACTTAACTCTCTTGTCATTAATTTGAGAAATGGTA
AACACAGGTTATCGCATCATCTGCCAGCTTACTGCAAATTATAATCAGTA
TATGTTGATTTGCAACCATTACCTACTGAATCTGAGAAACAATTTGATGT
GCCTTTGTGTGCAGAACCAGAACTTATACAGACAAAACATACAAATTTAA
TTTCAGAGCTAAGTGCTTTGATTTGACAGTTGTTCTCAGTCAGTGAACCT
ATGATGATCCAATTAGATCCGCACCTTTTATCACACCCGAAAACACCATT
TGTAACACGCAGGCTAGTTTGCTCTGGTCACAAAGTGATCAATTGCACAG
ATCGATTGGAACATGAGCAGTAGACATTTATGTGGCTTTTTTTCTCCTTC
TGATCAGAATTGTACCGTTCTCATCAGAATTAAGTTTAAGGATGTGAATT
GCAACGCACAGGATACTTATTTCCGATCACGAAACGCTGA
View all "LDregion4E" genotypes
PI22913   bicolor, NULL China   LDregion5A CGCATGGGAGGTCTCCAGGGCAGGGATGATGCCCTCCAGACGAGAGACAC
GCTTGAAAGCTGAATGTGAGAGTAGCCATGTGATTAGATGTTCAACATAG
CATTGATGACATAAACAGAGTGAATACCCTACTGAATAAGCTGTGGAGAC
AGTTTCTCAATTATTCAGGAAAAAAAATCCTACAGGCCTTACGGATGCTG
AACAGTCAACAATGTATCTAGTGTCACATCTGAGTATAAGAGTGTTCAAG
ACTTGAACATTGTGTTTGGTTATTAAAAAAAAGCACATGTCAGCATCAGC
TAAGGAATAAGACTTGTCTTAAATATTTGTCTTATCTACTGAGGAAAACC
TTGGAGGCTAGGATTATGTTATTGGCATTGCAAATATCCAGAACAGCTAC
ATCAACTGAATATATAACATTTCGTCAATTAAAGATAGCATCCTGCTGAT
TCAACACGTTTGACATATTTTTCACATGTTTAAAACAATTTCAGGCACAA
ATGACCAAACAGTGCAGTTGTGCAGTTCTACTGATATAGCATACAGTGGG
ATTTGGACACACATTCATAATTCATTGCTGCCCCTATCACATCAAGAAAT
ATCAGAATGCCCATGTGTTATTTAGAAAAGTTAGTAATTTGATAGTGATC
TCATCATGTTTGAAAGCTGACACCAATGCAAGCATCATTTTGTAGGTGCA
TTGGAAATCAACTTGTCAAAAATTAGTTCAACCAATACAGAAGA
View all "LDregion5A" genotypes
PI22913   bicolor, NULL China   LDregion5B AGATGCATTCAGGTATGCATGCAGTGTGTTGGCAGTTTGAATAGTGGCTC
AGATCCTTTAATCGTCTCATACTTTC-AAAGATCATA-TTTCTGTTTACA
CTTTATGCTAAGGACTATGTATGTCAACAACATAATAAAAATGCCTTAAA
GACAGTACTGGTTACAGCACATAAAAA-CATACAGAACTGATAGGATTT-
TTTTAGCATTGAGACATCTGCAAGAACTTAAGGGAATCAAATTCTAAATA
AAAGAACCATATGTGCTGAACGTGTTCAGTTAAACGGTTCTCCCTCCATC
CCAAATTATAGGTCGTTTTGGTTTTTCTAGATAC------ATAATAAGAA
AAATGTATATCTAAAAAAAGCCAAAACGGACTATAATTTGGAATGGAGGG
AGCATATGCTAAACATTCAGTCACTCATTCTTAGCCAAAAAGTAGGCTAC
AGGTCCTAAACGTCCATTTAATCGGCCCAAAAAGACCTTTTAGCGTTTAT
ATGATGTTTAATCAGCCTAAACACAATTGAACATAAATAAATATCTTCAA
GGTGTACTTTTCAGAAATTTCCAAACTGTAGATTATGATATAAGACTAGA
TGCCTTATGAGTTATGAAGCAAACCATACAGCAGACAAGTCAGTGAGAGA
CTGAGAATCCAAAAAATATTTGGACCAAA
View all "LDregion5B" genotypes
PI22913   bicolor, NULL China   LDregion5C TAAGAGGAATGATTCAAATTCCGCAATTATAGCGCGCCCATCGGTTTCAT
GCTTAGAAGCTGAAAAGTGCAAGGAAGTGGAATCTAAGACAGAACTGTAC
TACATGTGAAATTTAGTTATGAAAAACTAACAACCATTCAATATGCCTAT
TTGTTAAGGAGCTTGCTGGCCTGGAACTTTTCATTCCTTAATTTTAGTTT
TTATACAGAAAAACGTGCATAGATATATCAAGAGAAGATGAACAGATACA
CAGATGCATGCCTTAAGATTTGTTTTCCAACATATTCTTGCAATGATTAT
CCTAATTCTAACACAATCTATGAAAGTGACCATATTCTTTTAGGACTTTA
TAACTGGCATAATACACCCACATGCTCCTCTAGTCATGACATGAAAACAT
GAGTACTGGCTGTCACGATCTGTAAGATGCTTTGCTCTGTTCTAATTTTC
AACTCAAAAAATTCTAAATTAAAAAATTCAATAGTCTGGACAACTTTGTC
ATAGAATATGACTACCAAATTAGAAGCAGTTACTAAACCAGGTCTTGAAA
TACAATCATAAAACTATAATTTGAAAAACAGAATGGCTGCGGCATTAGAA
TAGAAAATAGAAAATTGTGTATGGAGCTAGGATAGCATGGAATCATCTCC
AAACATACATGTTCTATCCAAGTTGAAAGACACC
View all "LDregion5C" genotypes
PI22913   bicolor, NULL China   LDregion5D CTCTTCTCGGCCTCCCCCACCTGCTCGACCGAATGCCCAGCTGGGGATTC
CAAAATGTCTCTGCGTGTGTGGTTACGGCGAAGGTTTCGGATCGTCTCGT
AGTTTTCCTTTGTCTTAAGTCTGATGCTGCTGCGAACATGTGAAGGACTA
ACTGTTTAATTTGCTTGGTTGCCTGCATTCTGTGAAGTAAAGTCCACAAA
TGACAATACTGAATGTCTGCCACTGAAACTGTGTTGCCACTTACAAAGCC
TTCATCTCTTGCTTATCCATTGCATAAGATTTTTAGTCCAGTAGTTGTAC
AGACGGTAGAGTGCTGCGTATGGCAGTCATGTTTACCAGAAAAGATGAAT
CTGTTGTTTGTGTTAACCATAGTTGAAACGTGTTGGAAAATATGGAGTAG
ACTATTCCGTTGCCTAACAAACTTTAGTTCAAAATGTGCTCGCTGTGA-T
TGCTTTCAACTTTTTTTTT-CCTTGGAGATAAATAATTATGGCCTTCTAT
GCAGTTTGATGCACTTGTTGCGGCATTGCCACTATCATCAGAAGAGGATC
AAGTGAAAAGAATCCAAGAGCTACAGGTAGATATCTGACAGTCAGATTAA
TTTATCGAGCACTGATTTTTCAAGGATGGGCATCTGTCAAGCTCCTCCAT
TAAATTGTATATGAACTTAAAATTTG
View all "LDregion5D" genotypes
PI22913   bicolor, NULL China   LDregion5E CGAGACGCCGCGCGACGACGAAAAC---CGGCCGGACGACGTGCGAACAG
ACGGCACGGCAGGAATCGTCGGAGTTGGATTGGATGATGATGATAAAGTA
TGTAGCTGGAGACCGTATATAGCTAGGGACGGATTGATTCTTTTCGAAAA
TGTTGTTAAAGATAAAGAGGATTATTGGGACGAAGGTGCAATGAAACTTC
TTAGAGCCTTTCTTCGCCGCAGCTTGCTCGACGACAGGACCTAGTACTTG
TGTGTGGGGGAAGAAGAGGAAAAGCTCTTTATTCCATGCACATCTTTGCT
GTCTCTGAGAAGATAAAAGAGAACCCACGACGCTCACGCAACCACGTACG
CACTGCAGCCCTGCAGGTTCGCTACGGCTACGGCCTCCCGTGGTTTTTTG
CCGGGATCGATGATCCAACACAACACCACGCTCGCTCTGGATCGATGTCA
GGCGCCCCGTGCTCCACATTAACCTCCAGTTCTCGTAGAACAGTGGTTC-
TTTTCTTATATGGCGTATAGTCAGGCGTCCATTAATCATTAATAGTTACT
TCCTCCATTCCAAATTACAAGAAATTTGACTTTTTTTTTACCCTCAAGTT
TAATCAAACGTCTTATAATTTAGGATGAATTGAGTAGCTAACTAATAAAT
C--ATAGCTAATATTATTAGCTATTATATAGTTTGGTCCAACTAAACCTA
TTTGCATCGAAGAAGCTAATTATATTATTATATTAGCATCTAACTAGTAT
TACCTTTATATAGATCCAAACACAAAAAACTTCATTTTCAAG
View all "LDregion5E" genotypes
PI22913   bicolor, NULL China   LDregion6B CATCATCACAGGCAAGCAGTACGCTGAAAGCAGGCCCCCAAACCAGAAGG
AAAGCGAACAGAAACTTGCACAGGTCGCACGGGCCTTAGTTGGAAATATC
TCTGAGCAGAGAATGTTGGGTATTGGTCCCAAACCAATGACATAGGAGCA
GAAGCAAACTGTTAATGCGAAGTGGAAGACGATGGCACGGTCAAACGGTC
CCATATTGAACAGGATGGACATAGACATAACGCTCAATGATAATATAAGG
ATAGGAGTAGTGGCCAGCACAAGAACCCTACAAA-AAAAGGTTGAGTTGT
ATTAAAAAGTAGTTTCTATCAGGAAGACAGGAACAGGAACAAACATGT-A
AAAGAATTAACTAAAATGAATATTTACTTCCAAATCATGATCACTACATG
ACAAACTTGTTGCTGGATAAGCCGGCAAAGCGAAATGTTGGTAGATAATG
TTGGCAAGGGA-TTTTTTTAGGATACCCAATGCAAATAAACCTAAGAAGC
AGAGTGTGGAATCACAACTATACAATGTCAGAGTATTGGAGTTCAGAAAT
GGTACAACATCTAATGCTGCTGGTGAGGCAGCAAAAGGCTATATAATGAG
ACCAGATGGTGTATCTATGAACAGACCTCTTTCTCTTGGTCATGAGGATG
CATTTCTACTAATTGTAAATCAACATTATTGTGAAACTGTAATGTTGATG
GTGTCTCAAAGTTTACCTTCTTCCACAGACATCCATCAGCAGCATTGCGG
CAGTTATACAAGGGAG
View all "LDregion6B" genotypes
[ Download ]