grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "L-WA71" from the experiment "Hamblin et al. (2005) Equilibrium Processes Cannot Explain High Levels of Short- and Medium-Range Linkage Disequilibrium in the Domesticated Grass Sorghum bicolor. Genetics 171: 1247-1256.".

E.g., Germplasm L-WA58, Marker/locus pSB0080.

Items 1 to 25 of 26.       of 2 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
L-WA71   drummondii, NULL South Africa   LDregion1A CTTTTTGTGTTTTGAGAGAGTTCTACTATACTTCTGTTGGACTGATCATT
GTAAAGATTTGTTCAAATAGGGTCATCTTAATTGTTTGAAATCTGGGAAC
TGTGGCTTCACTGCACTCAGGAAAAGGCAATTCATGGTTATGGCATGAAT
AACTTATGGAAATAGACCTTAGAGTTGCTGCATGATTGTCACAAATCATT
GCTATGATATCTTATAATAGTTCTTTCTACTTTGCATTACATGTATAACT
GCAACTTTTAGTTGCGTTAAAAAAAACCCCTGTAACTCTTAGACCACTCA
CCACTGTAATCTTTCCTGAATTTTTGTTTAATGGCATGTATAAACTCACC
ACTTATGTACTTATCTAGGAAAAAATAGTCTAACTCTGTGCCCCATGTTT
GCAGCATTTTCAAACACAGTCCTCTAGAAAAAGTTATGCTGATGCAAACC
ATGTATCTGCTATCATTTTGGGTGGAGGCACTGGATCTCAGCTCTTTCCT
CTGACAAGCACAAGAGCTACGCCTGCTGTAAGAGATAACATTGAACATCA
AATGTTGATTACTCTATTATAGTATTATACAGAATATAAATTTCGAATTT
ATCTTAGTTTTGTACAGTATTTAGTGGATTCTTCTCATTTTCAAGATACA
CAATTGAACCATAATTGAAGTATGTAAGACAGCCAGTTAAAAAACTATAT
TCTTTTGGGAGACTTTCAGTCAAAATTTCTTAGAAGGTTTTTTGGTCCAG
ATGTTCTGATACCTTATTTTTT, CTTTTTGTGTTTTGAGAGAGTTCTAC
TATACTTCTGTTGGACTGATCATTGTAAAGATTTGTTCAAATAGGGTCAT
CTTAATTGTTTGAAATCTGGGAACTGTGGCTTCACTGCACTCAGGAAAAG
GCAATTCATGGTTATGGCATGAATAACTTATGGAAATAGACCTTAGAGTT
GCTGCATGATTGTCACAAATCATTGCTATGATATCTTATAATAGTTCTTT
CTACTTTGCATTACATGTATAACTGCAACTTTTAGTTGCGTTAAAAAAAA
CCCCTGTAACTCTTAGACCACTCACCACTGTAATCTTTCCTGAATTTTTG
TTTAATGGCATGTATAAACTCACCACTTATGTACTTATCTAGGAAAAAAT
AGTCTAACTCTGTGCCCCATGTTTGCAGCATTTTCAAACACAGTCCTCTA
GAAAAAGTTATGCTGATGCAAACCATGTATCTGCTATCATTTTGGGTGGA
GGCACTGGATCTCAGCTCTTTCCTCTGACAAGCACAAGAGCTACGCCTGC
TGTAAGAGATAACATTGAACATCAAATGTTGATTACTCTATTATAGTATT
ATACAGAATATAAATTTCGAATTTATCTTAGTTTTGTACAGTATTTAGTG
GATTCTTCTCATTTTCAAGATACACAATTGAACCTTAATTGAAGTATGTA
AGACAGCCAGTTAAAAAACTATATTCTTTTGGGAGACTTTCAGTCAAAAT
TTCTTAGAAGGTTTTTTGGTCCAGATGTTCTGATACCTTATTTTTT
View all "LDregion1A" genotypes
L-WA71   drummondii, NULL South Africa   LDregion1B CAAGCTTCTAGTATTGATATAATATTCAATCTGTTTAGCACGTGAACACC
TCAATTCTTGTTGTTACTGTACATCCCACCCAATCCCAGAGGCCCAGATT
ACCACGACATGAATACAAGAAGAATGTTGAACCCAGATCTAGAGTTTCTT
CTGTTTGGTGGTACTGTTGCAAATTGGTGGTGATTCATTTTGTTTTTGCA
CTTTCTGATAACAACAGGACTGTGTGATGATGGGAGCGGACATCTATGAA
ACTGAAGAAGAAGCTTCAAAGCTACTGTTAGCTGGGGAGGTCCCAGTTGG
AATAGGAGGAAACACAAAGATAAGGTGAGTATTGGATGTGGAACAACATT
GTATATGTATAACGACCGGTAGTTCCCAAATATCACACTCACTGACACCT
GATGGTATCCTCTGATGATTTCCAGGAACTGCATCATTGACATAAATGCT
AGGATTGGGAAGAACGTGGTGATCACAAACAGTAAGGTGAGCAAGCGCAC
CTACATGGGCGCAGAAACTTGTGTGCTCATCTATCCATTCCAATGCTGGT
GT-GTGACCATGCG-TTGTTCCACTCTTTGTGACAGGGCATCCAAGAGGC
TGATCACCCTGAGGAAGGGTACTACATAAAGTCTGGAATTGTGGTGATCT
TGAAGAATGCAACCATCAAGGATGGGTCTGTCATATAAACCGGGTGCCTG
TGCGCCTGCAAAACAAGAACCTACAATGGTATCACATCGATGGATCGTGT
AACCTTGGTAGGGAAGAGCCGCTTGCCAGAAAGTCCAGCGTTCGGGCGCA
A, CAAGCTTCTAGTATTGATATAATATTCAATCTGTTTAGCACGTGAAC
ACCTCAATTCTTGTTGTTACTGTACATCCCACCCAATCCCAGAGGCCCAG
ATTACCACGACATGAATACAAGAAGAATGTTGAACCCAGATCTAGAGTTT
CTTCTGTTTGGTGGTACTGTTGCAAATTGGTGGTGATTCATTTTGTTTTT
GCACTTTCTGATAACAACAGGACTGTGTGATGATGGGAGCGGACATCTAT
GAAACTGAAGAAGAAGCTTCAAAGCTACTGTTAGCTGGGGAGGTCCCAGT
TGGAATAGGAGGGAACACAAAGATAAGGTGAGTATTGGATGTGGAACAAC
ATTGTATATGTATAACGACCGGTAGTTCCCAAATATCACACTCACTGACA
CCTGATGGTATCCTCTGATGATTTCCAGGAACTGCATCATTGACATAAAT
GCTAGGATTGGGAAGAACGTGGTGATCACAAACAGTAAGGTGAGCAAGCG
CACCTACATGGGCGCAGAAACTTGTGTGCTCATCTATCCATTCCAATGCT
GGTGT-GTGACCATGCG-TTGTTCCACTCTTTGTGACAGGGCATCCAAGA
GGCTGATCACCCTGAGGAAGGGTACTACATAAAGTCTGGAATTGTGGTGA
TCTTGAAGAATGCAACCATCAAGGATGGGTCTGTCATATAAACCGGGTGC
CTGTGCGCCTGCAAAACAAGAACCTACAATGGTATCACATCGATGGATCG
TGTAACCTTGGTAGGGAAGAGCCGCTTGCCAGAAAGTCCAGCGTTCGGGC
GCAA
View all "LDregion1B" genotypes
L-WA71   drummondii, NULL South Africa   LDregion1C CGCGTCCTCACTCCCGTGCGGCAACTGGGACACTGGGTCTGGGTGCGCCG
GCGCCCTACTCCATTCGCCTGCGGCCCAGGCGTTCGTCGCGTCCTTCGCC
GGCGACGAGCACCCAGCCACCCACCAGGTACCCTTTCACTCGTCCCTGCT
GTGCGAAACTGGGCACTCGAACCAGTAAGCTATTTGGCAATTTTTGTTCG
GATCTGATCTAATTACAATGTATCCATGCCTGCTAACTTCAA-TTTTTTT
TTAATTTTCTTTACC--AAAAAAAAAGCGTACAAGGGTACACCCATGTCT
CTGCTCCTCTGCCCCTGGATTCCACGTCTAGCAG-------CATTGCTTT
TGGCTATCCATTTCGGGTCATAATTGGTGTCAGTATCACCCGTATGTTGA
AGGGTGTTAGTTAGGCTTGCAAAGGGATCGGTGTGGGGGTGCTCCTAATC
CTGATCCGCGAATCCGTTTACTCAATTTGAGGGTCTGGGGTCAATCCGTC
CGTTTATTTTTTTCTGGCAATGAAGATCCGTGCGCATCTAGGTTTGGCCC
TCTCTTCACTTGTTCGTTAAGGACTGTCTTCACCCTGAAGTTTGCAAACA
GAGCAACAGACCTGAAACTAGCAAGTTGAGATTTCTGCTCAATCGTGTTG
CTTTCAACTTCTCTGTGCATGCAAAGCACAATGCACACTCAATGACTAAA
TATAGAAGAGAAAATAAATAAAATTATAAAAAGTTAGTATTGAACAAAGA
TTAACAAATTACAG
View all "LDregion1C" genotypes
L-WA71   drummondii, NULL South Africa   LDregion1D TCTTCACTTTTAGCTACTTCCATACATGTCCCTAGCTTTGTAGCCTTCTC
CTTCCGTCCCACAATAAGTGCAATT--AGTTTTCAAACT--GTCTCAAAA
TAAGTGTTTCTAGCTTGTGCACCACCTAGCACTAGAGGGCTTAGTTGCCC
TCTGTTTCCAAAGAATAATCATTGCATGTTGGGACACTTTTTATAGGGGC
ATATATGTCATGTCCTAATAACACTGATCTACCCAAATAATCGTAGAACT
GCACTTACTGTCGGACAGAGTATAATTTCCTCCCTGAATCGTACAACTGC
ACTGTCCTATCCTGTCAAGTAGAAGTTGTTAATTTCCTCCATGAATCATC
AGATCTCATACCTTGTATGAGTATTGTTTAGTGCTACATCCTGTACTTTA
TCTCTCCCTCCCTCTCTCCCCCCAAAAAAGAAACAGGGGTGGGGAGATAC
CTTATGTTTCAGTTGTAGTAACTACCTGCGGTCATGTTTCAAAAAAAAAA
AAAA---------GGAAAAGAAAAAACAAACCTACTTGCGGTCATGTACA
GGCAATGATATGGATGCTGACCTGTAACCTCATTAGTTTGAGTGCTATTT
GTATGATTGTATCCTTCGTTTCCTGTTTAATTTA---GTGAACTGTGCAT
CCTCGATCACTGTCCAATCTTACGGATACCTCACATTTTGTAAACATGCA
TTGGGTTATACTACCTTATCTAACTCT-AAGCGGCGCATGCTGTAATGTA
GGAGATAATCGAGGACGACGCAAAGCTTCGAGCACTCAAAGAAGAACATG
GAGAAGAAATCTATGCACTGGTGACAAAGGCGCTG, TCTTCACTTTTAG
CTACTTCCATACATGTCCCTAGCTTTGTAGCCTTCTCCTTCCGTCCCACA
ATAAGTGCAATT--AGTTTTCAAACT--GTCTCAAAATAAGTGTTTCTAG
CTTGTGCACCACCTAGCACTAGAGGGCTTAGTTGCCCTCTGTTTCCAAAG
AATAATCATTGCATGTTGGGACACTTTTTATAGGGGCATATATGTCATGT
CCTAATAACACTGATCTACCCAAATAATCGTAGAACTGCACTTACTGTCG
GACAGAGTATAATTTCCTCCCTGAATCGTACAACTGCACTGTCCTATCCT
GTCAAGTAGAAGTTGTTAATTTCCTCCATGAATCATCAGATCTCATACCT
TGTATGAGTATTGTTTAGTGCTACATCCTGTACTTTATCTCTCCCTCCCT
CTCTCCCCCCAAAAAAGAAACAGGGGTGGGGAGATACCTTATGTTTCAGT
TGTAGTAACTACCTGCGGTCATGTTTCAAAAAAAAAAAAAA---------
GGAAAAGAAAAAACAAACCTACTTGCGGTCATGTACAGGCAATGATATGG
ATGCTGACCTGTAACCTCATTAGTTTGAGTGCTATTTGTATGATTGTATC
CTTCGTTTCCTGTTTAATTTA---GTGAACTGTGCATCCTCGATCACTGT
CCAATCTTACGGATACCTCACATTTTGTAAACATGCATTGGGTTATACTA
CCTTATCTAACTCT-AAGTGGCGCATGCTGTAATGTAGGAGATAATCGAG
GACGACGCAAAGCTTCGAGCACTCAAAGAAGAACATGGAGAAGAAATCTA
TGCACTGGTGACAAAGGCGCTG
View all "LDregion1D" genotypes
L-WA71   drummondii, NULL South Africa   LDregion1E CTTACGCCTTGCCCCTATAGTAGAGACCCTACAAATAAGTTGTCTGTATT
CTTTTTGCAACAACTCAAAACACATCTCTTCGTAAATTCAACAGAATTTC
TTATATGAAAACTATCTATGTATAGGGAACATTATTTTTAATGAACGCTT
TCTCCATCCCA----------------AGGCGATGGCTTCTTCTTGCTTC
GGGTTTAGAAATGAGGGCTTGGGGAAATAGGTAGGCACAATGGTTGATGA
GGACATGACATCTATATAACTATTGATTATAAGGTGAGCTCATTTCTATA
TTTGTATAGTGATTTTT-GGTACAATTCACTTGGTTTTACATGTACATAT
CATTATTTGATTGTAGATTCAAATATATCTCAAAGTGCAAGTCCATCAAA
GTGGATCTTTCAATTCATCGGCAGCTCGATAGTGCTTTATTGGGAAAGCC
ATAACTTATCCATCCAAAGTGAGATCGAAGTCAATGAGCACTTGATGGAA
AGCTTGTTTGATAAGCTTTCAAATAGATCTGATCCTACCTCAATATCACA
CTGACAAGGACTTCAAATCATCATGATATTCTGTCACTGTTTCTGCCAAA
AGCTATATCATCATCATGAGCATATTTTCATCCTTAGGACCCTG--GCCT
AAGTGGGAGCACACCCCAAAGAGAAGGAGAACCCACCGAGAAATCCCTTG
GACGTCCTCCTCCTTGGCCACCACTTTAGAGGGTCAGCAATTTCGTTCAA
GCCAAGTCAGAGATCCCATCCATATCAAGTTCGAATCCATCTCGGG-CTC
CAGGAGCAGTCTATAGTAAAACAAATGCTCAGGATACATTCTAGACTCTA
TTTT-GATGATCCACATATGGATGGAAATATAATTTCATAATCTAATCAA
TGGCTTTAGTTTTAGGCCCAAACTCCATCGGAGTCAATGGGAATCGTCAA
AACAAGTTGACGTCCAGAATCTGTCAGGGCA, CTTACGCCTTGCCCCTA
TAGTAGAGACCCTACAAATAAGTTGTCTGTATTCTTTTTGCAACAACTCA
AAACACATCTCTTCGTAAATTCAACAGAATTTCTTATATGAAAACTATCT
ATGTATAGGGAACATTATTTTTAATGAACGCTTTCTCCATCCCA------
----------AGGCGATGGCTTCTTCTTGCTTCGGGTTTAGAAATGAGGG
CTTGGGGAAATAGGTAGGCACAATGGTTGATGAGGACATGACATCTATAT
AACTATTGATTATAAGGTGAGCTCATTTCTATATTTGTATAGTGATTTTT
-GGTACAATTCACTTGGTTTTACATGTACATATCATTATTTGATTGTAGA
TTCAAATATATCTCAAAGTGCAAGTCCATCAAAGTGGATCTTTCAATTCA
TCGGCAGCTCGATAGTGCTTTATTGGGAAAGCCATAACTTATCCATCCAA
AGTGAGATCGAAGTCAATGAGCACTTGATGGAAAGCTTGTTTGATAAGCT
TTCAAATAGATCTGATCCTACCTCAATATCACACTGACAAGGACTTCAAA
TCATCATGATATTCTGTCACTGTTTCTGCCAAAAGCTATATCATCATCAT
GAGCATATTTTCATCCTTAGGACCCTG--GCCTAAGTGGGAGCACACTCC
AAAGAGAAGGAGAACCCACCGAGAAATCCCTTGGACGTCCTCCTCCTTGG
CCACCACTTTAGAGGGTCAGCAATTTCGTTCAAGCCAAGTCAGAGATCCC
ATCCATATCAAGTTCGAATCCATCTCGGG-CTCCAGGAGCAGTCTATAGT
AAAACAAATGCTCAGGATACATTCTAGACTCTATTTT-GATGATCCACAT
ATGGATGGAAATATAATTTCATAATCTAATCAATGGCTTTAGTTTTAGGC
CCAAACTCCATCGGAGTCAATGGGAATCGTCAAAACAAGTTGACGTCCAG
AATCTGTCAGGGCA
View all "LDregion1E" genotypes
L-WA71   drummondii, NULL South Africa   LDregion1F CCCTGGCGGAGAAGGCGGCGCTGGCGTACGCGGCGGAGCACGGCATGGAG
CTCGTCACCATCATCACGACGCTCGTGGTCGGGCCTTTCCTCAGCACGGG
CATGCCGCCGAGCATGATCACCGCGCTGGCGCTCGTCACGGGGAACGAGG
CGCACTACTCGATCCTGAAGCAGGTGCAGTTCGTCCACCTCGACGACCTC
TGCGACGCCCACATCTTCCTCTTCGAGCACCCGGCCGCCGCCGGACGCTA
CGTCTGCTCCTCGTGCGACACCACCATACACGACCTCGCCGCCATGCTCA
GGGATAGGTACCCCGAGTACGACATCCCGGAGAGGTTCCCAGCTGGGA,
CCCTGGCGGAGAAGGCGGCGCTGGCGTACGCGGCGGAGCACGGCATGGAG
CTCGTCACCATCATCACGACGCTCGTGGTCGGGCCTTTCCTCAGCACGGG
CATGCCGCCGAGCATGATCACCGCGCTGGCGCTCGTCACGGGGAACGAGG
CGCACTACTCGATCCTGAAGCAGGTGCAGTTCGTCCACCTCGACGACCTC
TGCGACGCCCACATCTTTCTCTTCGAGCACCCGGCCGCCGCCGGGCGCTA
CGTCTGCTCCTCGTGCGACACCACCATACACGACCTCGCCGCCATGCTCA
GGGATAGGTACCCCGAGTACGACATCCCGGAGAGGTTCCCAGCTGGGA
View all "LDregion1F" genotypes
L-WA71   drummondii, NULL South Africa   LDregion2A CCATCCGCCATGGATAGGCCGGCTTCATGGGTCATGCCTGCGTGACCGCT
CTGTGTTGT---GTAACGTGTAGTATTGCTGGGCCAGAAACATCACGCCT
CGTTTGTCATGCCCCGGCAATAGTTGTAGTGGACTGTAGTCTGTAGTAAT
TCCGTTGCGACTTGATGACAGAATCCGAGCAAAATACGTTTGAAGGCCCC
CTGTCAGAAAGGAAAATCTGCACTTAAGGCGAGTTTT-ACTACTAGTGTG
CTCGTGCGTTGGTCTGTGCCCTT-GTACATACACGTTCCAACGCTGCACG
GAATTCATGTTTACTGTCATTANTCTTTAAGATGGAAATTTTTTGTGGCT
TGTGGTATTGATGCTTGGTTTTTTTttttnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnn
View all "LDregion2A" genotypes
L-WA71   drummondii, NULL South Africa   LDregion2B GCGTGTGACATTGTTTTGCACGAAGGCTTTAAGGGCTTGT----TGCTAG
TTTTAGCGGGTTAGTGATTACTATCCTGATTCTAATTGGAAATGAAGTGT
CTTCCCTTTTCGTACATAATGTTATGATTTGTTATTCAGGCATCAATTGA
AATTTCTTTAGTTTCTTTTGTGCTGGGCATCTTTTATTATCGAGAAATTA
TTCTTACCTTTT-GAATTCTTATTGCTAGAATAGGCTTATATTTGTTGGT
GGAGATTATGCTGAAATGTGCATGATTCTGGATGATGAAGAAAATCAATC
GGATTCCCATTGATTTTACAATATGATTTTAACAACCAGCTACTTCTGAC
AAAATCATGCTATATCAGGATATACTTTGCCTCTTTGGTCCAGCAATCTA
ATCCTTTCGCTGATGTTTTTGTCATCGTGGTTGATTATTTGATACATGCA
TTTGTTATGATGATACACCATTTTCAGATCATTATGTATGGTTCTGTATC
ATCTTAACTCCTTTAAATTGATTCATTCATTTATTTATATTGTGATGTGC
CTATGATGTGATCAAAATATTTGCTACTCTTGATGGGTGTT---CCCATT
TGATGATCTTAACCACCAAGATCTCTGAGGCCCATCACATTGCAATTAGA
AAGACTCAGTTCATATGAGCACTTAAGAGTGGCAGTAGGAGTTGC-TGAT
GTAGTGTGTT
View all "LDregion2B" genotypes
L-WA71   drummondii, NULL South Africa   LDregion2C AGTGCATAAGAAAAGGTAAGTATAACTATAAAAATTTGCATTTTATCAGC
AAGTGACAATTATATCCAGCTTATGGCCCATCTACAAGACAAACTAGCTA
AATAGCAAATCATCTGATCAAGAATACAAGTCCTGCATTACATTCCTCAT
ACAATGAATGAAGGAAAAAATGCTACCCAAACACAGAGAAAAGACATCCC
ATGG---CTTCATCTTTAAGGAGGGGAGTATCAAACTGTAGCTGTTCAGG
AAACTCACTCAAAATAGTTCAGGGAGGAACAGGGGTGGAGCCAGAATATC
AAGTCACTAAGTCAAATACACTTTTTGGTTAACTAAGAAGGGTGGTTTGC
AAACCTTAAGGAACTTCTAATGGAATTTGAATTTTTCATCAGGTCAGCTG
AACCCAACGAATACACATAGCTCAGTTCCTGTGGAGGGACACACAAGGAA
CACTTGTCCATGGACACTTGTA------AAGTTTCATGATTTCTAAAACA
CAATCACGTGCAAGAGAATGATCTAACATTTTTATGATTAAGAATTAAAT
ATCACTACATCAGTACATTAATCATAATTGGAATTTGTTACTATTTGGTC
GAGAGAGTTGGACAGAGCAAAAGAGAAGGAAAAATAGTTTATAATACCTC
GGCCTCAATTTGCTGAAGTAAGCCAATCTCTGCTTGCTATTCCTAGTAAG
ACGGTGGTCTGA
View all "LDregion2C" genotypes
L-WA71   drummondii, NULL South Africa   LDregion2D CTGCTGCCTGCTGGCAGGGGAAAAAACTTGAGACGGTGGTGTGGTCGCTG
ATCGGCCGAGGACACAGGACAGCCAAGCCGAGGGCCAGGGGGAGGGGGGG
CACACGCTGTCGATCAGG--------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------TGTTGGCAAGCGTGTACCACGAGGTCGGGTCCCAAC
TCCCAACTACCCAGCTCACCCACCGGCCCGCCCGACCCACCTGTCAATGC
CCGCGCACGACTTGCACCCAACCCAGCCAGAGCCAGCCGCATCGCAGCTA
GCTTCGACTTCGAGGGCGAGCGAGCGGCTACCAACTGGTGACGCCGGCGC
GACGTCGTA-TCCACCACGTATGGCCGTAGCCCGCCAACTGCGTCTGCGT
GCACTGCTGACTGCTCCCTCCGTCCACAGTCGCG-TTTTTTACTTGCAGA
CATTATATTTAACTGTTTGTTTTTTTATAAATTATAAAATAAATAAATTA
TTAGTAAAATATCTTTAATAATAAAATAAGTCTTAATAAAATATATAATA
TTTATGTAAAAAATCAAATAAGATAAATAAAATGTCTAAAGTTCTAAAAC
GATACTATTTTTTGAACCGAGGAGGTAGCTTGGCCAAGCTGTGCAGGACA
ACGCCAGACCTCTTGCCCTGTGCTGACTACTAATTTGTACTGAGCACGGC
GAAGATCTGTACTAGATGCTGAATAATCCGCTGAAAGCTACTCTAAAGTC
CTTCCCCGTACCAGCAAGCAAACGGGACTTTTACTGGACGCCGCTGTCAC
A
View all "LDregion2D" genotypes
L-WA71   drummondii, NULL South Africa   LDregion2E nnnnCAGCAGGACCATATCAAATCTAAAAATAGATTAATGATCCACTATA
TTAATAACAATACCAAGATGTGCACATGAAA-----------CTAACCGG
ACCAATGTGAAGTTCAATTTTACATCAACACCCAGCTACCACGGATTTTA
TTTTTCCTTAACCCAGCAGACCTTGCTACCTGCTCATCATTACCAGCTAT
CACATGACCACCAGGAACTTGCTCTTTCCTTTTTGAAACCCACCAAAGCT
TTGCCACTGGCTCAACATTGAGATTCCCTGACCAGTGACCAGCTCCTAGC
CTACCCATCCTAACCATAGGATTCAATCACGATGTGGTCTTCAGCTATTC
CATTATCAAGTTGAAACATCAGAACACTACTCAGGAAGACAGGTACAAAC
AACTCATGTTCATCAAAAGTTCACTTAATTTCCAGTCTTTTACCTACTTA
TTCTACTCAGCAATCGAACACTAGCAAAACATACAAACATTACTAATTAT
CATTCAAACCTGAAAATACAATCAAAAGTTTCATGATCTGGTATAGATTT
CTCACAGCTCA-TTTTTACCAACAAGTTCATCTCTCGTTAGCTCCACTTG
CCCCTACTTTTCAAGAAGGAATTCCCCCTGCCTTTCACTAGTCAATAACT
TTTTT-AAACTACACGCACAGCATAGTAC-TTTTTTTCATGGAAAGCATT
CCCTTAATAAACATCAAATGACCAAATCAAC-AACCTAATCAAAGCACGG
AGAGTTTCATAACC
View all "LDregion2E" genotypes
L-WA71   drummondii, NULL South Africa   LDregion2F GTAGTATTACTAAAGCATGCAGCAGAACCACTTTCATCTAACTCGATCTT
CATACCAAACTCAACCAAATTGTCGCTGCATTTTAACACATTTGATTAGA
TCGCAACACAGAAATAATAAATTGGGCAGTGAACTTAAGAACAAATAAAT
ATTTGATTCGATACACAAAATGTGGACAATTTGCTAGTTTTAGTGTTAAT
AGCAGAGTAAGCTACTAGCCTACTATGACCCATCTGACTGAAAATAGTGA
ATGCCATTACCAAAGAAGTGTTTGGCAGTTACATTTTTGTTACAAACCAA
AAATACATCTAAAGAAATAGTTAAGCCCACA-TTATAAGTGTTGCAGACA
CCATCATGCTGTTACTGTGAAGAACAACT------ATTAGTAAAGTTGCA
GGCTCCTAATTTCAACATAAAAATGAAATTAAGAATCATCAATGATATGA
TGACACTGCAGCACCTCAATTTACCTTTGCTCAAACATTCCACATGTTTG
CGAAAAGGAATCAGTTGATACACCAAATGAATTTAGAAGTGAATCAATTT
CCATTTGCTCTTCACATTCATACAAGATGGGTGACTTTTTTGAGCCATTA
TCCACAATTCCATCTGGAGTATGTATGAATGAACTTGACAGTTGATGTGA
TATATCGTTCTGTCTGTCTCCAGTGCTTGGCATAAAGCCAGAAGATTCTA
TGTGACCAGGATTTGTTCCCC
View all "LDregion2F" genotypes
L-WA71   drummondii, NULL South Africa   LDregion3A CGCCGCACTGTCCGGCGCCCGCCGCCGACGAGCGCGGCCTGATGAGCTCC
GTTGCACTCGCACCACCACCACCGCTGCCGCTGCTGCTGCTGCTGC---T
GGATGCGCCGCTGCGCACGGACGGCGCGGCGGAGGACGCGAACCTGCCCG
CCGCGTCGACCTGTTTCCGGTTCACGTTGCAGGGCTCGGTCGCCCTGCCG
AAGCTGCTGCCGGGCCGCTTCAGGTGCGGCATCGCCTCCTTCTCGCTCAG
CAAGGTGCGCAGCTTCTTCTGCTCCTGCGCCATGGAAATCACCACTTTCA
GGTTAATTATTCAGAATTCTTGTGAGTGCTGTTCTTTTCTTGCATTTTCT
CGCAGGTGTCAAACGATACAGTTGCAGTAATGTCTGTTTACCCTGAGTCG
CCTCCTCTCCTCTTCCTGCCTGATCCTGGCTTGCTTGTGCTCCTCCAAGA
CTGCAACCAGGCGAGCCTTGAAAACGGCAAGAAACAGATCAAATTCGTCA
GTTTCTACGACCACGACCACTGAATCATGCCGCCACAGCAGGAACTGGAA
AAGTAGCATACCCCGTCGTACAGGAACGGCTTCTTTCTTTCGCTCTCCCA
TGCGAGTGTTCGAATGATCAGGTTGTCAACAACGGCTGCAGATTTACCAA
CAACGAATTGCTTTAACCGAACTTCAGAGATGCAATCGGAATAACCAAGT
AGGTATCACATTTGGTCTTGTATGAAATGTACCTGGAATCTTGGTGATGA
TAAGnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnAAACACACAGCAGTTGT-CC
CTGTCTTTATCTGTCTTTCGCATTGGAAATCACTGTTCAACGTATTGAAA
ATGCGCATTTTGGACCTACCATGTTGTACTCCTCGAGCCATTTCTCTTCC
TCGCACGCCAGCAGCCACTTGTTTATCTTCTCCATGACTTCTCTCCTGGA
CTGGAGCTCTTCCCTGGCTTTCGCTATCTGTTCGTCAATGCTGGCCATGA
GCTCAGAAGGATTCACGAGACCTG-----G-TAAAGTTTTGTCAGCATTA
GAAATATCAACCTATCTGAACTTTATCATCTCGGTCATAAGTACAGTATA
AGCAGGAACTCTGAACTCGTCGTACCAGAGTCGATCAGCGCAATGGATTT
CTCCGGTACGGTGCTCGCATCAGGCTCCACGTGCATGCTGCGGCAGATGT
TCTCCAGCTCCAGCCGCCTCTTGAGCACGAGCTCCTTCATCCGGCCGGnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
View all "LDregion3A" genotypes
L-WA71   drummondii, NULL South Africa   LDregion3BC TGGGCCGTTCCTGTGCGACGCCGTGAACTGATACCTCGGTGCGATGAGGG
CGAAAATCGGTGCCATGACCTGCAGTTGGCAGCAGAAACGTTTTTCTTGA
AGATGAGTGATGGTGTCTGCAGACTGCACACACTACCGTAAGCACAAAAT
TGGTAGC-AAGCGTGAAGTAATATTTTCTCAGAACAATCAACCCATAAAA
A-TGTGGAACAATAT--------------------CTGACCCCGTGACAC
AATGTTTAGGAAACCACAAGGGACCGTGCTTCTGCTTCATTTTTTC---A
ATGGTATAAATATACTGCTAGATTATATTGTTTAAGAAATAACAAGACAA
ATATTACTGAACATTCAACCTGCTTCATTTTTTCAAGGACATAAGTAGTA
GATATTGTTTAAGAAAGAACAAGACATACCGCTATGACTGGGTGGGCAGG
CTGAACACGGACAGCTGGTGATGTCAGGACAATACCGCTAATGAGAGTTT
TTACCTCTGGATCAAGCGCAGCCTGTTGTGAATCAAAACAGTTAGATTTA
AACAGCACAAAAGAAATGTGCAACAACAGTCCTGAA-GAAGTAAGTTCCA
CAATAATGCAATTCATATGGCACCGCTGCCATTACCTTCAGAATGATACC
TCCACCAGTCGAATGGCCGAAGCAGAAGCATGGAAGACCAGGGTTCTCGG
CTAATACTTTCTTGAGGTACATTTTCTACATTAATCAGAAGATTTTGAAT
AAGGACTTACACAGATGGGTCTCAGAGAGCTGTGAAGATATTCAATTGCT
CTTACCAAATCATTGACAGCATAATnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnTAAATTTATCACTGATTCTCAGAGTGATGCCTGCAGTTCTGA
CAAATTCCAAATATTAGTTAGCTCAATTGTTTGCTGCATTATTACTATTG
CTATCTGGTTCCTTATTATAATCTAGAATCTCATCCTATGCTCCTACATC
TTGACATAGTTAATATTTTACATGGTTATACGTAGT-AAAAAAACTATAA
GCAACTCCAAACTAGCACGCAGTTTGTCTAATTCAACAAAGAGAAGCTAA
CCTGAATAAGGGAAAAATAGTTCATAGGCCATTTTTTTGTAATTGTTAAA
TGATGATGTGTACCCAACAATCTGTATCCCTCAAACAGAGTTAAGTGTCC
AAGCCGACAATTATGAATAATCAACACTTCAATTACAATATGGAATGGGA
ATCCACTGAACTGGTGCACTTTATCTAAGCTCCCAGATCACAACCAGATA
ATACACGATACAATAAGGCAACCACAAAGTAACCATGAAAGCGGAGAAGC
ATCATAGCTAAGCTCCCAGCTACAAACCAGATAACATTATCCATCTCAAC
TTCTCAAGGTCAGGGCCTACTTTGGCAGGCCACATGGCTTAGAATCCACC
AAATACAGTGGTAGGGAAAGCAGAAGTGCAACCTATAGGTCAGGAGTTCA
AATCCCTGTTCTCACCACAAAAATAAATAAATAAAAGGCCAATCGTTGCT
ATTTTCAGTGAATGGGTCGGTAACATTAGAATCGGATTTAGACGGAGTAA
GGACAACCAAGGAATGAACAGCTAAAATGAAGCCCTATTTT-GAATGGAG
CAATAAAATTAGAATGGGACTAAGACGGAGTCGGACAACCCAAGGAATGA
ACAGCCAAAATGAAGACAACAAAACACCTGGACACTAAAGTGTAAAAAAT
AGACAGCCTTGCATTTCACTTTAGAAATTGGGTCCATTTCGTCCTACTGA
GAAATTGGCATCTTTATTCATTGCTCTCGTCATAGCTGGTGAATTGTTTG
TGGCACTAGTTAATTAAGTTCACAATCACACAATCATCAACATGGATGAA
AATCAAATCAAAACATACATGCATAAGTAGTTCGTGATACTATA--AGAT
TTGAAGCATGACAACCAAAAAAGGAGAAAAAAG
View all "LDregion3BC" genotypes
L-WA71   drummondii, NULL South Africa   LDregion3D GTGAATCATCACCAAGTGTTGCAAAACCAGATACCAGATCAGAGGTATCT
TCTGCAATACCTTGACTGACAGACAACCAACTACTGCCAATTGTACGTCT
TCCACCTGAATATGTGAGTGCAAGGTTATTATTCAGGAGCCAAACAATAT
GATACAGAAAAATTAAAATAATCAGCATTAAGAAGTAAGAACATGCAGCC
ATCACCTCACACTTCAGGGGAAAAAAGAAGAAAAACGTAGAAGATGAATG
GAAAACAAAACAACTATAGAAAGATGAAACGTCGGTCAATGATCTATCTA
GGGGAAAAGAAAGAAACCATTAAGCAAAATAGTTTCTTTTTGTGTGTGTG
GAGAGGGAAGGGGGGCGAGGGGGGCATTGCTTTAAAAAAAATAATTACAA
CATATGGATTATCACTAATAATTTATACACGGTAGAGCAAGTATCGCATG
CAATATATGTACTTGAAACGTCTGGAAAAACAAAAAACTAATAATTTTCT
CACATTGTAGTGGCAATAGACGAGGCTTAAAAAAATAAATGGGTCTGACA
AAAATTTGCAAGTACATGTATCATTTCAAATTGAAGATCGTTAATAGTCA
TGTAAGTGTAAAAGATATGTTGCTACTTAGGATGTGCCTAGCCATGTCAA
TGAAGAGAATAAATAAATGTTGGTAATTCAGTAATTTACTAGTAACACCA
ATAGGCAACATTTCACAAGAAAAGATGAGATTCTTATTCTGTATTATTAT
AACAAATGTACAGCAATAAACTACATATCAATCAATGTCCTTAGCCATTC
ACAAATATGATACACAAAACATGAATATTAGTCGAACGTTCAAATTTCTT
TGGCCTACTGAACTAAAGTCAGCATTATGGCGTGGGAATATTTTGCATTG
ATTGCAGTCTATTAAACAAAAGTGCCATATCACTATTGAACTCGCTAGCA
ACATACCTGAAGATGTTATTTCTTGCCCAATGGGAACATCAAGATAAGAG
CCAATCATAAAGGCATGATCAACACTAGACTGCTTGGCTCCAGATCCATG
GTGATTGATCTTTTCCTCCCAGTTCATGTTGACTAGCTTATCTTCAGACT
TGAGCCTCACAGGAGGTAACTTCGGAAGCTCCTCACGCTGATTATCTCCA
ACAAGCTGTAAATCGAAGCATCGGTCAGACACCTGATCTGTATCTAGGGA
TTTTTCGAAGTAATATTGCCTGTTCCCCTCATCAAGCTGTCCTTTTGCAC
CTTTTCCAACACCATCTCCATTAGTGCTCCTCTTTACTTCTTTCCTCTCA
TTTTCATGGTGCGTGCTATTGTAACTAGATGATGGGTTTTCCGCAGGGAA
TGGAAGCACTGTCTTAACTGTGCAACCATTCAACATCTCCTCTTTTTCTG
GTACTAGATTTTTATCCCTGGAATGACCTTGTTCATTGATTTCAGTCCTC
CCAGCAGCATCGACTTTTCCCTTCCCTCTTCCAAAAGAGACTTTTTGCTC
CAACACTGGGACAGGCTGTTCTGTCCCAACACCTCGATCCCTCTTCTCTG
CCAGCATCGCACCACGCCTATGCCTTGGCACCTCTTCTGACACCAGCAGC
TCAGCTAGCTGTTCAGCAGTGCTGTTTGCAATGCTGAAGGTCCAAGGATA
CAGATCCCCCACGTTGTTCTCCTGAGGCTGGCCAATCCCAGAGCCCTTCT
TTCCATCCGAACC
View all "LDregion3D" genotypes
L-WA71   drummondii, NULL South Africa   LDregion3E GACCTTCATGACCATGTTGTTGGGGTGTGCTTTGTAGCCCAGGATATGAC
TGTTCATAAGTTGGTCATGGACAAATTTACTCGGGTTGAGGGGGACTACA
AGGCAATCATTCACAACCCAAACCCGCTCATTCCTCCTATATTTGGTGCT
GACCAATTTGGATGGTGCTCTGAGTGGAATGTAGCCATGACCAAGCTTAC
TGGGTGGCACAGAGATGAAGTGATAGATAAGATGCTCCTTGGTGAGGTTT
TTGACAGTAGCAATGCTTCCTGCCTTTTGAAGAGCAAAGATGATTTTGTA
CGTCTTTGCATTATCATCAACAGTGCATTAGCCGGTGAAGAGGCAGAAAA
GGCTCCATTCGGTTTGTTTGACCGCAATGGGAAATATATTGAATGCCTTC
TGTCAGTGAACAGAAAAGTAAATGCAGATGGTGTTGTCACTGGAGTGTTC
TGTTTCATTCATGTTCCTAGTGATGACCTGCAGCATGCGCTACATGTGCA
GCAAGCCTCTGAGCAGACAGCACAAAGAAGGTTGAAGGCTTTCTCGTACA
TGCGACATGCCATCAACAAACCTnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnAATGAAGAGCAGATGAGGCAGGTCCATGT
TGCAGATAGTTGTCATCGCCAGCTAAACAAGATACTTGCCGACTTAGATC
AAGATAACATTACTGACAAGTAATCTTCTAGTCTTTTAAACTGTTCTATT
AGGTTATTGTGTTTACTTTCATCTACCTCGTTATTTGACAACTTTCTGAA
CTGTAGGTTAATGGTATCACTTAATTTTATTTCACTAACTACTACTGAAG
CTTATAGCCATATTCGTTACTACCAACTTAATATTTATGTACCATTATGT
TCACAGGTCAAGTTGCTTGGATTTGGATATGGCTGAATTTGTGTTGGAAG
ATGTGGTGGTGTCTGCTGTAAGTCAAGTACTGATAGGTTGCCAGGGTAAA
GGTATCAGAGTTGCTTGCAACCTGCCAGAGAGATTCATGAAGCAAAAAGT
TTACGGGGATGGTATCCGACTCCAACAGATCCTCTCCGACTTCTTATTTG
TTTCGGTGAAGTTCTCTCCTGTTGGTGGCTCTGTTGATATCTCTTCCAAA
CTGACTAAGAACAGCATTGGGGAAAACCTTCATCTCATAGACTTCGAACT
TAGGTACACTTGCCATGCTAATTTGCATGCATACACTCATTTCTGAATAG
GAAATCATAAGGTATGAAGGCTTAAATTACTCTTGTGTTTATGGATTTAT
GGTTTTCAGGATCAAGCACCAAGGAGCAGGAGTCCCAGCAGAAATATTGT
CACAAATGTATGAGGAGGACAATAAAGAGCAGTCAGAGGAGGGTTTGAGC
CTTCTTGTTTCTAGAAACCTTCTGAGGCTCATGAATGGTAAC
View all "LDregion3E" genotypes
L-WA71   drummondii, NULL South Africa   LDregion4A --------------------------------------------------
--------------------------------------------------
--------------------------------------------------
----------------ATTCCATCTCCAACTCCCGTCCGCTCTCCTTTGC
ATTGCA-----TTGCATAATGGCAACACGGAACAGGAACAGCTTGCGATT
TCTTA
View all "LDregion4A" genotypes
L-WA71   drummondii, NULL South Africa   LDregion4C CAAATGGGTATGACACATGGACACAGTTTTCAGTTTCTTGTAAAGTTGAG
GTGTGAATAATATATTAGTTTTTTCTATTAAAAAATATTATCTTGTTATm
AAAAACATTGAAATTCCTAAGTCTGAAAAGGAACTGCACTTATGTwTCCT
TGTGAACTGTTAAGATATATTGTGCTGTACTCCATCTAGTTCAGTGTGAA
GATCAATTATAAAAGCATGGCTTCATATTACAACCAACATTkTTATGGCC
CTGTCCTAAGATTCTTGATTTAAGTATTAATTTTAGGTCTTGAGCTTCGT
TCAGAACTGCCTTGAAATATTCCATATAAACTTGTTACTGAAACAAATTG
AATCTATGTGGCTGCAAACAmCAGAAATGGCAAGATAAATTGCTAAACTC
CGGAACACATTCAGGATGTACACATAGTGCAAGAGAAATTGCTTTGAGTA
CCTCATCTACCTTGCAAATTCAATTTCATCTCACTGGCTCCATTGGAGCT
TGTTAATCTCATCryCTyTACTCATAATTCTCTGTGTCAGATTTTCTGTA
CATCTGGCCTAATAAGGTTCAATACCTTTCTCCACATTAGTAmTAACAT-
------------nnnnnnnnnnnnnnnAAATGTTAAATCACATCTTTCAT
CCTGATTTTTGTACTTTTCTGAATTTGCTGTTTTCTTATATCATATTTAA
GTA
View all "LDregion4C" genotypes
L-WA71   drummondii, NULL South Africa   LDregion5A CGCATGGGAGGTCTCCAGGGCAGGGATGATGCCCTCCAGACGAGAGACAC
GCTTGAAAGCTGAATGTGAGAGTAGCCATGTGATTAGATGTTCAACATAG
CATTGATGACATAAACAGAGTGAATACCCTACTGAATAAGCTGTkGAGAC
AGTTTCTCAATTATTCAGGAAAAAAAATCCTACAGGCCTTACGGATGCTG
AACAGTCAACAATGTATCTAGTGTCACATCTGAGTATAAGAGTGTTCAAG
ACTTGAACATTGTGTTTGGTTATTAAAAAAAAkCACATGTCAGCATCAGC
TAAGGAATAAGACTTGTCTTAAATATTTGTCTTATCTACTGAGGAAAACC
TTGGAGGCTAGGATTATGTTATTGGCATTGCAAATATCCAGAACAGCTAC
ATCGACTGAATATATAACATTTCGTCAATTAAAGATAGCATCCTGCTGAT
TCAACACGTTTGACATATTTTTCACATGTTTAAAACAATTTCAGGCACAA
ATGACCAAACAGTGCAGTTGTGCAGTTCTACTGATATAGCATACAGTGGG
ATTTGGACACACATTCATAATTCATTGCTGCCCCTATCACATCAAGAAAT
ATCAGAATGCCCATGTGTTATTTAGAAAAGTTAGTAATTTGATAGTGATC
TCATCATGTTTGAAAGCTGACACCAATGCAAGCATCATTTTGTAGGTGCA
TTGGAAATCAACTTGTCAAAAATTAGTTCAACCAATACAGAAGA
View all "LDregion5A" genotypes
L-WA71   drummondii, NULL South Africa   LDregion5B AGATGCATTCAGGTATGCATGCAGTGTGTTGGCAGTTTGAATAGTGGCTC
AGATCCTTTAATCGTCTCATACTTTC-AAAGATCATA-TTTCTGTTTACA
CTTTATGCTGAGGACTATGTATGTCAACAACATAATAAAAATGCCTTAAA
GACAGTACTGGTTACAGCACATAAAAATAATACAGAACTGATAGGATTT-
TTTTAGCATTGAGACATCTGCAAGAACTTAAGGGAATCAAATTCTAAATA
AAAGAACCATATGTGCTGAACGTGTTCAGTTAAACGGTTATCCCTCCATC
CCAAATTATAGGTCGTTTTGGATTTTCTAGATACATAATAATAATAAGAA
AAATGTATATCTAAAAAAAGCCAAAACGGACTATAATTTGGAATGGAGGG
AGCATATGCTAAACATTAAGTCACTCATTCTTAGCCAAAAAGTAGGCTAC
AGGTCCTAAACGTCCATTTAATCAGCCCAAAAAGACCTTTTAGCGTTTAT
ATGATGTTTAATCAGCCTAAACACAATTGAACATAAATAAATATTTTCAA
GGTGTACTTTTCAGAAATTTCCAAACTGTAGATTATGATTTAAGACTAGA
TGCCTTATGAGTTATGAAGCAAACCATACAGCAGACAAGTCAGTGAGAGA
CTGAGAATCCAAAAAATATTTGGACCAAA
View all "LDregion5B" genotypes
L-WA71   drummondii, NULL South Africa   LDregion5C TAAGAGGAATGATTCAAATTCCGCAATTATAACGCGCCCATCAGTTTCAT
GCTTAGAAGCTGAAAAGTGCAAGGAAGTGGAATCTAAGAAAGAACTGTAC
TACATGTGAAATTTAGTTATGAAAAACAAACAACCATTCAATATGCCTAT
TTGTTAAGGAGCTTGCTGGTCTGGAACTTTTCATTCCTTAATTTTAGTTT
TTATACAAAAAAACGTGCATAGATATATCAAGAGAAGATGATCAGGTACA
CAGATGCATGCCTTAAGTTTTGTTTTCCAACAGATTCTTGCAATGATTAT
CCTAATTCTAACACAATCTATGAAAGTGACCATATTCTTTTAGGACTTTG
TAACTGGCATAATACACCCACATG---CTCTAGTCATGACATGAAAACAT
GAGTACTGGCTGTCACGATCTGTAAGATGCTTTGCTCTGTTCTGATTTTC
AACTCAAAAATTTCTAAATTAAAAAATTCAATAGTTTGGACAACTTTGTC
ATAGAATATGACTACCAAATTAGAAGCAGTTACTAAACCAGGTCTTGAAA
TACAATCATAAAACCATAATTTGAAAAGCAGAATGGCTGCAGCCTTAGAG
TAGAAAATAGAAAATTGTGTATAGAGCTAGGATAGCAGGGAATCATCTCC
AAACATACATGTTCTATCCAAGTTGAAAGACACC, TAAGAGGAATGATT
CAAATTCCGCAATTATAACGCGCCCATCAGTTTCATGCTTAGAAGCTGAA
AAGTGCAAGGAAGTGGAATCTAAGAAAGAACTGTACTACATGTGAAATTT
AGTTATGAAAAACAAACAACCATTCAATATGCCTATTTGTTAAGGAGCTT
GCTGGTCTGGAACTTTTCATTCCTTAATTTTAGTTTTTATACAAAAAAAC
GTGCATAGATATATCAAGAGAAGATGATCAGGTACACAGATGCATGCCTT
AAGTTTTGTTTTCCAACAGATTCTTGCAATGATTATCCTAATTCTAACAC
AATCTATGAAAGTGATCATATTCTTTTAGGACTTTGTAACTGGCATAATA
CACCCACATG---CTCTAGTCATGACATGAAAACATGAGTACTGGCTGTC
ACGATCTGTAAGATGCTTTGCTCTGTTCTGATTTTCAACTCAAAAATTTC
TAAATTAAAAAATTCAATAGTTTGGACAACTTTGTCATAGAATATGACTA
CCAAATTAGAAGCAGTTACTAAACCAGGTCTTGAAATACAATCATAAAAC
CATAATTTGAAAAGCAGAATGGCTGCAGCCTTAGAGTAGAAAATAGAAAA
TTGTGTATAGAGCTAGGATAGCAGGGAATCATCTCCAAACATACATGTTC
TATCCAAGTTGAAAGACACC
View all "LDregion5C" genotypes
L-WA71   drummondii, NULL South Africa   LDregion5D CTCTTCTCGGCCTCCCCCACCTGCTCGACCGAATGCCCAGCTGGGGATTC
CAAAATGTCTCTGCGTGTGTGGTTACGGCGAAGGTTTCGGATCGTCTCGT
AGTTTTCCTTTGTCTTAAGTCTGATGCTGCTGCGAACAwGTGAAGGACTA
ACTGTTTAATTTGCTTGsTTGCCTGCrTTCTGTGAAGTAAAGTCCACAAA
TGACAATACTGAATGTCTGCCACTGAAACTGyGTTGCCACTTACAAAGCC
TTCATCTCTTGCTTATCCATTGCATAAGATTTTTAGTCCArTAGTTGTAC
AGAyGGTAGAGTGmTGCGTATGGCAGTCATGTTTACCAGAAAAGATGAAT
CTGTTGTTTGTGTTAACCATAGTTGAAAyGTGTTGkAAAATATGGAGTAG
ACTATTCCGTTGCCTAACAAACTTTAGTTCAAAATGTGCTCrCTGTGA-T
TGCTTTCAACTTTTTTTNC-CCTTGGAGATAAATAATTATGGCCTTCTAT
GCAGTTTGATGCACTTGTTGCGGCATTGCCACTATCATCAGAAGAGGATC
AAGTGAAAAGAATCCAAGAGCTACAGGTAGATATCTGACAGTCAGATTAA
TTTATCGAGCACTGATTTTTCAAGGATGGGCATCTGTCAAGCTCCTCCAT
TAAATTGTATATGAACTTAAAATTTG
View all "LDregion5D" genotypes
L-WA71   drummondii, NULL South Africa   LDregion5E CGAGACGCCGCGCGACGACGAAAAC---CGGCCGGACGACGTGCGAACAG
ACGGCACGGCAGGAATCGTCGGAGTTGGATTGGATGATGATGATAAAGTA
TGTAGCTGGAGACCGTATATAGCTAGGGACGGATTGATTCTTTTCGAAAA
TGTTGTTAAAGATAAAGAGGATTATTGGGACGAAGGTGCAATGAAACTTC
TTTGAGCCTTTCTTCGCCGCAGCTTGCTCGACGACAGGACCTAGTACTTG
TGTGTGGGGGAAGAAGAGGAAAAGCTCTTTATTCCATGCTCATCTTTGCT
GTCTCTGAGAAGATAAAAGAGAACCCACGACGCTCACGCAACCACGTACG
CACTGCAGCCCTGCAGGTTCGCTACGGCTACGGCCTCCCGTGGTTTTTTG
CCGGGATCGATGATCCAACACAACACCACGCTCGCTCTGGATCGATGTCA
GGCGCCCCGTGCTCCACATTAACCTCCAGTTCTCGTAGAACAGTGGTTC-
TTTTnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnTTTTTTTTACCCTCAAGTT
TAATCAAACGTCTTATAATTTAGGATGAATTGAGTAGCTAACTAATAAAT
C--ATAGCTAATATTATTAGCTATTATATAGTTTGGTCCAACTAAACCTA
TTTGCATCGAAGAAGCTAATTATATTATT-AT-TAGCATCTAACTAGTAT
TACCTTTATATAGATCCAAACACAAAAAACTTCATTTTCAAG
View all "LDregion5E" genotypes
L-WA71   drummondii, NULL South Africa   LDregion6B nnnnnnnACAGGCAAGCAGTACGCTGAAAGCAGGCCCCCAAACCAGAAGG
AAAGCGAACAGAAACTTGCACAGGTCGCACGGGCCTTAGTTGGAAATATC
TCTGAGCAGAGAACGTTGGGTATTGGTCCCAAACCAATGACATAGGAGCA
GAAGCAAACTGTTAATGCGAAGTGGAAGACGATGGCACGGTCGAACGGTC
CCATATTGAACAGGATGGACATAGACATAACGCTCAATGATAATATAAGG
ATAGGAGTAGTGGCCAGCACAAGAACCCTACAAAAAAAAGGTTGAGTTGT
ATTAAAAAGTAGTTTCTATCAGGAAGACAGGAACAGGAACAAACATGTAA
AAAGAATTAACTAAAATGAATATTTACTTCCAAATCATGATCACTACATG
ACAAACTTGTTGCTGGATAAGCCGGCAAAGCGAAATGTTGGTAGATAATG
TTGGCAAGGGA-TTTTTTTAGGATACCCAATGCAAATAAACCTAAGAAGC
AGAGTGTGGAATGACAACTATACAATGTCAGAGTATTGGAGTTCAGAAAT
GGTACAACATCTAATGCTGCTGGTGAGGCAGCAAAAGGCTATATAATGAG
ACCAGATGGTGTATCTATGAACAGACCTCTTTCTCTTGGTCATGAGGATG
CATTTCTACTGATTGTAAATCAACATTATTGTGAAACTGTAATGTTGATG
GTGTCTCAAAGTTTACCTTCTTCCGCAGACATCCATCAGCAGCATTGCGG
CAGTTATACAAGGGAG
View all "LDregion6B" genotypes
L-WA71   drummondii, NULL South Africa   LDregion6C CACCC-------AATCGCCTGAAAAATTGTGGCTGCCGTTTCAGATTGCT
CTCTGCATCTGATTTTTGGCTTTGCTTTACCTGCATGTCTCAAGTCTAGT
TACCATGGGAATACACATGTGTAACATGCTTTGCATATTTTCATTTTCAT
GGTCTTAGGCTCTTGTTTTGATGAATTAAATGCCTGCATTAATTCTTTCA
ATACTTTCTGCTAAGTTTGAGTTATCTTGTGCTTAATTGTATATTAGCTG
TATTAAAAGCACTGTGATACATAAAAATTTT--TTTAGTCACTTGAAAAT
ATTAAGAGAAATTTAGTTATCGGGGAGAAGGGGAGGGGATTGGGTTGGGT
TTTGATTCTCCCTTTTTAATTGTAGATATTATGCTAAGTCTTTTTTAGGA
ACAAAAGTTCAATTTCAGCTGGCTGACTACAATCAGCGGTGTGCTAATCT
TCTTTTACTGGAATGAAAGCACACATGCAGTTCAGCCTAACCTATTT-AT
CTAGGTGGGCATAAGAGTTTCATTGCTATTCATGTTAGTTTTTAAAAGTG
TGATGAGTGCAATATGGTGAATTGAGATAGCATCGGGGAGCTGAGCCATG
TATGTTACTGTGGTTTGACTTGTGGTGTGCTGTAGACTAATTTATT-GAC
ATGTGCTTCCATACCCATCTCTAAATTATTATGCTGTACTATCAGTTCAA
ACACATATGAGAATTAAACGTTTGTGGTTAAAACTGATCCATCCATTCTG
TAGTTGTTGTCTACCGCCTTTTAGAATTTAGAGTGACACCTTTCGACTAG
CATATATATCAGGGAGTTGGGAGAATGCCATAGTTAGAACTTAGAAGCTA
TTAGATGCAAGGGACATTTTGAATGTGAGACATTTATTTTATTGGCTAAA
CTTTGAATGAATGAAAATAATTATGATTTTAAGTATGGTTGTTCTAGTGC
TGCCAAGGATTAGGATACCTTAATTTGGGATACTAGGTTTGCTTATCCTC
TATAAATTACATTGTTTATTAGCAATGTGGCCTTAACACTTTCCATTCTG
ATGTTGCAGTCATCCTTTGGTTTCATTGACTACTATGACCGCAGATATGC
TGCACTAGCAATTTTATCTCTCAATGGCAGACCACTGTAAGCTTTTTGGT
TTTGTATTCCCTCCATTTGTAATTGTAAGTCGTTTTGGCTTTTCTAGATT
CATAGGTGTATAGCAAAACTATGTACCTAGAAAAGCCAAAATAACTTGCA
ATTGGAATGGAAGGAGTATGTGCTAATTTCTATGATCACTGCCCTGTTTT
TTGGCACTAATTTTCTAATTATCACCAAAAATCCAGGTATGGTCAGCCAA
TAAAAG
View all "LDregion6C" genotypes
[ Download ]