grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "AusTRCF302660" from the experiment "Hamblin et al. (2005) Equilibrium Processes Cannot Explain High Levels of Short- and Medium-Range Linkage Disequilibrium in the Domesticated Grass Sorghum bicolor. Genetics 171: 1247-1256.".

E.g., Germplasm L-WA58, Marker/locus pSB0080.

Items 1 of 1.

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
AusTRCF302660   NULL South Africa   LDregion2F GCAGTATTACTAAAGCATGCAGCAGAACCACTTTCATCTAATTCGATCTT
CATACCAAACTCAACCAAATTGTCACTGCA-TTTAACACATTTGATTAGA
TTGCAACACAGAAATACCAAATTGGGCAGTGAACTTAAGAACAAATAAAT
ATTTGATTCGATACAGAAAATGTGGAAAGATTGCTAGTTTTAGTGTTCGT
AGCAGAGTAAGCTACTA--------TGACCCATCTGACTGAAAATAGTGA
ATGCCATTACCAAAGAAGCGTTAGGCAGTTACAGTTTTGTTACAAACCCT
AAATCCATCTATAGAAATAATTAAACCCACAGTTATAAGTGTTGCAGACA
CCATCATACTGTTACTGTGAAGAACAAAT------ATAAGTAAAGTTGAA
GGCTTCTAATTTCAACATGAACATGAAATTAATC---GTCAATGATATGA
TGACACCGGAGCACCTCAATTTACCTTTGCTCAAACATTCCACATGTTTG
CGAAAAGGAATCAGTTGATACACCAAATGAATTTAGAAGCGAATCAATTT
CCATTTGCTCTTCACATTCATACAAGAGGGGTGAGTTTTTTGAGCCATTA
TCCACAGTTCCATCTGCAGTATATACGAATGAACTTGACAGTTGATGTGA
TATATCATTCTGTCTGTCTTCAGTGTTTGTCATAAAGCCAGAAGATTCTA
TGTGAACAGGATTTGTTCCCC, GCAGTATTACTAAAGCATGCAGCAGAA
CCACTTTCATCTAATTCGATCTTCTTACCAAACTCAACCAAATTGTCACT
GCA-TTTAACACATTTGATTAGATTGCAACACAGAAATACCAAATTGGGC
AGTGAACTTAAGAACAAATAAATATTTGATTCGATACAGAAAATGTGGAA
AGATTGCTAGTTTTAGTGTTCGTAGCAGAGTAAGCTACTA--------TG
ACCCATCTGACTGAAAATAGTGAATGCCATTACCAAAGAAGCGTTAGGCA
GTTACAGTTTTGTTACAAACCCTAAATCCATCTATAGAAATAATTAAACC
CACAGTTATAAGTGTTGCAGACACCATCATACTGTTACTGTGAAGAACAA
AT------ATAAGTAAAGTTGAAGGCTTCTAATTTCAACATGAACATGAA
ATTAATC---GTCAATGATATGATGACACCGGAGCACCTCAATTTACCTT
TGCTCAAACATTCCACATGTTTGCGAAAAGGAATCAGTTGATACACCAAA
TGAATTTAGAAGCGAATCAATTTCCATTTGCTCTTCACATTCATACAAGA
GGGGTGACTTTTTTGAGCCATTATCCACTGTTCCATCTGCAGTATATACG
AATGAACTTGACACTTGATGTGATATATCGTTCTGTCTGTCTTCAGTGTT
TGTCATAAAGCCAGAAGATTCTATGTGAACAGGATTTGTTCCCC
View all "LDregion2F" genotypes
[ Download ]