grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for marker "CSU784" from the experiment "Hamblin, Casa, et al. (2006) Challenges of Detecting Directional Selection After a Bottleneck: Lessons From Sorghum bicolor. Genetics 173: 953-964.".

E.g., Germplasm L-WA58, Marker/locus pSB0080.

Items 1 to 17 of 17.

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Germplasm
65I 1633   bicolor, NULL Chad   CSU784 GCCCTCTCCAATGCGCATGCGTGGGTCTTACGGTGTCTTGCATCGTTTCT
CGCTGTGGCGCAGGTGCGTACAAGTACGTATCGGAGCTATGGAGGAGGAA
GCAGTCCGACGTGATGCGGTTCGTGCAGCGCGTGCGCTGCTGGGAGTACA
GGCAGCAGCCGGCCATCGTCCGCCTCACAAGGCCCACCCGCCCCGACAAG
GCCCGCCGCCTCGGCTACAAGGCCAAGCAGGTAGATCTCCCCTCTTGACC
CCATTGGCGCGTGCGACCTTGGCTATGGATTTGTGGGTAGGCGGAAGGTC
AGGGTGGTGCAGGGATTACCGTTTTCATTTAGGATTGTGATTTCCCAAAG
TGCTACAGTCGTATGCCTGTCTGCCTTAAAATTTTCAGCCTTCCTGCAAG
CCAGGCCTGTGTAGTATTTCTGGTGATTATAGTGACAATCTTCCTGGACG
AAATGAAGGGTTGTTGAGGTTCCGGAGAGCTCGACCCTTATTCGATTTAC
CTTTTCCGAACGTTGTAGTATATTTTGTTTCTGCTAATATAAGATGTTCA
AGTTTGGACTATGATTTTGGTATTACGAGTCCTGCTAATTCTGTAGGTTT
TAACCTCCTGTTGAGTCAGAATATATGCAGGTGTTGGATCTATTTGTTAT
ATTGTACT
View all "65I 1633" genotypes
65I 1791   bicolor, NULL Mali   CSU784 GCCCTCTCCAATGCGCATGCGTGGGTCTTACGGTGTCTTGCATCGTTTCT
CGCTGTGGCGCAGGTGCGTACAAGTACGTATCGGAGCTATGGAGGAGGAA
GCAGTCCGACGTGATGCGGTTCGTGCAGCGCGTGCGCTGCTGGGAGTACA
GGCAGCAGCCGGCCATCGTCCGCCTCACAAGGCCCACCCGCCCCGACAAG
GCCCGCCGCCTCGGCTACAAGGCCAAGCAGGTAGATCTCCCCTCTTGACC
CCATTGGCGCGTGCGACCTTGGCTATGGATTTGTGGGTAGGCGGAAGGTC
AGGGTGGTGCAGGGATTACCGTTTTCATTTAGGATTGTGATTTCCCAAAG
TGCTACAGTCGTATGCCTGTCTGCCTTAAAATTTTCAGCCTTCCTGCAAG
CCAGGCCTGTGTAGTATTTCTGGTGATTATAGTGACAATCTTCCTGGACG
AAATGAAGGGTTGTTGAGGTTCCGGAGAGCTCGACCCTTATTCGATTTAC
CTTTTCCGAACGTTGTAGTATATTTTGTTTCTGCTAATATAAGATGTTCA
AGTTTGGACTATGATTTTGGTATTACGAGTCCTGCTAATTCTGTAGGTTT
TAACCTCCTGTTGAGTCAGAATATATGCAGGTGTTGGATCTATTTGTTAT
ATTGTACT
View all "65I 1791" genotypes
65I 2133   bicolor, NULL India   CSU784 GCCCTCTCCAATGCGCATGCGTGGGTCTTACGGTGTCTTGCATCGTTTCT
CGCTGTGGCGCAGGTGCGTACAAGTACGTATCGGAGCTATGGAGGAGGAA
GCAGTCCGACGTGATGCGGTTCGTGCAGCGCGTGCGCTGCTGGGAGTACA
GGCAGCAGCCGGCCATCGTCCGCCTCACAAGGCCCACCCGCCCCGACAAG
GCCCGCCGCCTCGGCTACAAGGCCAAGCAGGTAGATCTCCCCTCTTGACC
CCATTGGCGCGTGCGACCTTGGCTATGGATTTGTGGGTAGGCGGAAGGTC
AGGGTGGTGCAGGGATTACCGTTTTCATTTAGGATTGTGATTTCCCAAAG
TGCTACAGTCGTATGCCTGTCTGCCTTAAAATTTTCAGCCTTCCTGCAAG
CCAGGCCTGTGTAGTATTTCTGGTGATTATAGTGACAATCTTCCTGGACG
AAATGAAGGGTTGTTGAGGTTCCGGAGAGCTCGACCCTTATTCGATTTAC
CTTTTCCGAACGTTGTAGTATATTTTGTTTCTGCTAATATAAGATGTTCA
AGTTTGGACTATGATTTTGGTATTACGAGTCCTGCTAATTCTGTAGGTTT
TAACCTCCTGTTGAGTCAGAATATATGCAGGTGTTGGATCTATTTGTTAT
ATTGTACT
View all "65I 2133" genotypes
66I 4961   bicolor, NULL Kenya   CSU784 GCCCTCTCCAATGCGCATGCGTGGGTCTTACGGTGTCTTGCATCGTTTCT
CGCTGTGGCGCAGGTGCGTACAAGTACGTATCGGAGCTATGGAGGAGGAA
GCAGTCCGACGTGATGCGGTTCGTGCAGCGCGTGCGCTGCTGGGAGTACA
GGCAGCAGCCGGCCATCGTCCGCCTCACAAGGCCCACCCGCCCCGACAAG
GCCCGCCGCCTCGGCTACAAGGCCAAGCAGGTAGATCTCCCCTCTTGACC
CCATTGGCGCGTGCGACCTTGGCTATGGATTTGTGGGTAGGCGGAAGGTC
AGGGTGGTGCAGGGATTACCGTTTTCATTTAGGATTGTGATTTCCCAAAG
TGCTACAGTCGTATGCCTGTCTGCCTTAAAATTTTCAGCCTTCCTGCAAG
CCAGGCCTGTGTAGTATTTCTGGTGATTATAGTGACAATCTTCCTGGACG
AAATGAAGGGTTGTTGAGGTTCCGGAGAGCTCGACCCTTATTCGATTTAC
CTTTTCCGAACGTTGTAGTATATTTTGTTTCTGCTAATATAAGATGTTCA
AGTTTGGACTATGATTTTGGTATTACGAGTCCTGCTAATTCTGTAGGTTT
TAACCTCCTGTTGAGTCAGAATATATGCAGGTGTTGGATCTATTTGTTAT
ATTGTACT
View all "66I 4961" genotypes
66I 5133   bicolor, NULL Ethiopia   CSU784 GCCCTCTCCAATGCGCATGCGTGGGTCTTACGGTGTCTTGCATCGTTTCT
CGCTGTGGCGCAGGTGCGTACAAGTACGTATCGGAGCTATGGAGGAGGAA
GCAGTCCGACGTGATGCGGTTCGTGCAGCGCGTGCGCTGCTGGGAGTACA
GGCAGCAGCCGGCCATCGTCCGCCTCACAAGGCCCACCCGCCCCGACAAG
GCCCGCCGCCTCGGCTACAAGGCCAAGCAGGTAGATCTCCCCTCTTGACC
CCATTGGCGCGTGCGACCTTGGCTATGGATTTGTGGGTAGGCGGAAGGTC
AGGGTGGTGCAGGGATTACCGTTTTCATTTAGGATTGTGATTTCCCAAAG
TGCTACAGTCGTATGCCTGTCTGCCTTAAAATTTTCAGCCTTCCTGCAAG
CCAGGCCTGTGTAGTATTTCTGGTGATTATAGTGACAATCTTCCTGGACG
AAATGAAGGGTTGTTGAGGTTCCGGAGAGCTCGACCCTTATTCGATTTAC
CTTTTCCGAACGTTGTAGTATATTTTGTTTCTGCTAATATAAGATGTTCA
AGTTTGGACTATGATTTTGGTATTACGAGTCCTGCTAATTCTGTAGGTTT
TAACCTCCTGTTGAGTCAGAATATATGCAGGTGTTGGATCTATTTGTTAT
ATTGTACT
View all "66I 5133" genotypes
69I 7471   bicolor, NULL Uganda   CSU784 GCCCTCTCCAATGCGCATGCGTGGGTCTTACGGTGTCTTGCATCGTTTCT
CGCTGTGGCGCAGGTGCGTACAAGTACGTATCGGAGCTATGGAGGAGGAA
GCAGTCCGACGTGATGCGGTTCGTGCAGCGCGTGCGCTGCTGGGAGTACA
GGCAGCAGCCGGCCATCGTCCGCCTCACAAGGCCCACCCGCCCCGACAAG
GCCCGCCGCCTCGGCTACAAGGCCAAGCAGGTAGATCTCCCCTCTTGACC
CCATTGGCGCGTGCGACCTTGGCTATGGATTTGTGGGTAGGCGGAAGGTC
AGGGTGGTGCAGGGATTACCGTTTTCATTTAGGATTGTGATTTCCCAAAG
TGCTACAGTCGTATGCCTGTCTGCCTTAAAATTTTCAGCCTTCCTGCAAG
CCAGGCCTGTGTAGTATTTCTGGTGATTATAGTGACAATCTTCCTGGACG
AAATGAAGGGTTGTTGAGGTTCCGGAGAGCTCGACCCTTATTCGATTTAC
CTTTTCCGAACGTTGTAGTATATTTTGTTTCTGCTAATATAAGATGTTCA
AGTTTGGACTATGATTTTGGTATTACGAGTCCTGCTAATTCTGTAGGTTT
TAACCTCCTGTTGAGTCAGAATATATGCAGGTGTTGGATCTATTTGTTAT
ATTGTACT
View all "69I 7471" genotypes
69I 7776   bicolor, NULL Chad   CSU784 GCCCTCTCCAATGCGCATGCGTGGGTCTTACGGTGTCTTGCATCGTTTCT
CGCTGTGGCGCAGGTGCGTACAAGTACGTATCGGAGCTATGGAGGAGGAA
GCAGTCCGACGTGATGCGGTTCGTGCAGCGCGTGCGCTGCTGGGAGTACA
GGCAGCAGCCGGCCATCGTCCGCCTCACAAGGCCCACCCGCCCCGACAAG
GCCCGCCGCCTCGGCTACAAGGCCAAGCAGGTAGATCTCCCCTCTTGACC
CCATTGGCGCGTGCGACCTTGGCTATGGATTTGTGGGTAGGCGGAAGGTC
AGGGTGGTGCAGGGATTACCGTTTTCATTTAGGATTGTGATTTCCCAAAG
TGCTACAGTCGTATGCCTGTCTGCCTTAAAATTTTCAGCCTTCCTGCAAG
CCAGGCCTGTGTAGTATTTCTGGTGATTATAGTGACAATCTTCCTGGACG
AAATGAAGGGTTGTTGAGGTTCCGGAGAGCTCGACCCTTATTCGATTTAC
CTTTTCCGAACGTTGTAGTATATTTTGTTTCTGCTAATATAAGATGTTCA
AGTTTGGACTATGATTTTGGTATTACGAGTCCTGCTAATTCTGTAGGTTT
TAACCTCCTGTTGAGTCAGAATATATGCAGGTGTTGGATCTATTTGTTAT
ATTGTACT
View all "69I 7776" genotypes
74L 11921   bicolor, NULL Central Africa Rep   CSU784 GCCCTCTCCAATGCGCATGCGTGGGTCTTACGGTGTCTTGCATCGTTTCT
CGCTGTGGCGCAGGTGCGTACAAGTACGTATCGGAGCTATGGAGGAGGAA
GCAGTCCGACGTGATGCGGTTCGTGCAGCGCGTGCGCTGCTGGGAGTACA
GGCAGCAGCCGGCCATCGTCCGCCTCACAAGGCCCACCCGCCCCGACAAG
GCCCGCCGCCTCGGCTACAAGGCCAAGCAGGTAGATCTCCCCTCTTGACC
CCATTGGCGCGTGCGACCTTGGCTATGGATTTGTGGGTAGGCGGAAGGTC
AGGGTGGTGCAGGGATTACCGTTTTCATTTAGGATTGTGATTTCCCAAAG
TGCTACAGTCGTATGCCTGTCTGCCTTAAAATTTTCAGCCTTCCTGCAAG
CCAGGCCTGTGTAGTATTTCTGGTGATTATAGTGACAATCTTCCTGGACG
AAATGAAGGGTTGTTGAGGTTCCGGAGAGCTCGACCCTTATTCGATTTAC
CTTTTCCGAACGTTGTAGTATATTTTGTTTCTGCTAATATAAGATGTTCA
AGTTTGGACTATGATTTTGGTATTACGAGTCCTGCTAATTCTGTAGGTTT
TAACCTCCTGTTGAGTCAGAATATATGCAGGTGTTGGATCTATTTGTTAT
ATTGTACT
View all "74L 11921" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   CSU784 GCCCTCTCCAATGCGCATGCGTGGGTCTTACGGTGTCTTGCATCGTTTCT
CGCTGTGGCGCAGGTGCGTACAAGTACGTATCGGAGCTATGGAGGAGGAA
GCAGTCCGACGTGATGCGGTTCGTGCAGCGCGTGCGCTGCTGGGAGTACA
GGCAGCAGCCGGCCATCGTCCGCCTCACAAGGCCCACCCGCCCCGACAAG
GCCCGCCGCCTCGGCTACAAGGCCAAGCAGGTAGATCTCCCCTCTTGACC
CCATTGGCGCGTGCGACCTTGGCTATGGATTTGTGGGTAGGCGGAAGGTC
AGGGTGGTGCAGGGATTACCGTTTTCATTTAGGATTGTGATTTCCCAAAG
TGCTACAGTCGTATGCCTGTCTGCCTTAAAATTTTCAGCCTTCCTGCAAG
CCAGGCCTGTGTAGTATTTCTGGTGATTATAGTGACAATCTTCCTGGACG
AAATGAAGGGTTGTTGAGGTTCCGGAGAGCTCGACCCTTATTCGATTTAC
CTTTTCCGAACGTTGTAGTATATTTTGTTTCTGCTAATATAAGATGTTCA
AGTTTGGACTATGATTTTGGTATTACGAGTCCTGCTAATTCTGTAGGTTT
TAACCTCCTGTTGAGTCAGAATATATGCAGGTGTTGGATCTATTTGTTAT
ATTGTACT
View all "Purdue No. 49018" genotypes
HD-043   bicolor, NULL Swaziland   CSU784 GCCCTCTCCAATGCGCATGCGTGGGTCTTACGGTGTCTTGCATCGTTTCT
CGCTGTGGCGCAGGTGCGTACAAGTACGTATCGGAGCTATGGAGGAGGAA
GCAGTCCGACGTGATGCGGTTCGTGCAGCGCGTGCGCTGCTGGGAGTACA
GGCAGCAGCCGGCCATCGTCCGCCTCACAAGGCCCACCCGCCCCGACAAG
GCCCGCCGCCTCGGCTACAAGGCCAAGCAGGTAGATCTCCCCTCTTGACC
CCATTGGCGCGTGCGACCTTGGCTATGGATTTGTGGGTAGGCGGAAGGTC
AGGGTGGTGCAGGGATTACCGTTTTCATTTAGGATTGTGATTTCCCAAAG
TGCTACAGTCGTATGCCTGTCTGCCTTAAAATTTTCAGCCTTCCTGCAAG
CCAGGCCTGTGTAGTATTTCTGGTGATTATAGTGACAATCTTCCTGGACG
AAATGAAGGGTTGTTGAGGTTCCGGAGAGCTCGACCCTTATTCGATTTAC
CTTTTCCGAACGTTGTAGTATATTTTGTTTCTGCTAATATAAGATGTTCA
AGTTTGGACTATGATTTTGGTATTACGAGTCCTGCTAATTCTGTAGGTTT
TAACCTCCTGTTGAGTCAGAATATATGCAGGTGTTGGATCTATTTGTTAT
ATTGTACT
View all "HD-043" genotypes
PI152702   bicolor, NULL Sudan   CSU784 GCCCTCTCCAATGCGCATGCGTGGGTCTTACGGTGTCTTGCATCGTTTCT
CGCTGTGGCGCAGGTGCGTACAAGTACGTATCGGAGCTATGGAGGAGGAA
GCAGTCCGACGTGATGCGGTTCGTGCAGCGCGTGCGCTGCTGGGAGTACA
GGCAGCAGCCGGCCATCGTCCGCCTCACAAGGCCCACCCGCCCCGACAAG
GCCCGCCGCCTCGGCTACAAGGCCAAGCAGGTAGATCTCCCCTCTTGACC
CCATTGGCGCGTGCGACCTTGGCTATGGATTTGTGGGTAGGCGGAAGGTC
AGGGTGGTGCAGGGATTACCGTTTTCATTTAGGATTGTGATTTCCCAAAG
TGCTACAGTCGTATGCCTGTCTGCCTTAAAATTTTCAGCCTTCCTGCAAG
CCAGGCCTGTGTAGTATTTCTGGTGATTATAGTGACAATCTTCCTGGACG
AAATGAAGGGTTGTTGAGGTTCCGGAGAGCTCGACCCTTATTCGATTTAC
CTTTTCCGAACGTTGTAGTATATTTTGTTTCTGCTAATATAAGATGTTCA
AGTTTGGACTATGATTTTGGTATTACGAGTCCTGCTAATTCTGTAGGTTT
TAACCTCCTGTTGAGTCAGAATATATGCAGGTGTTGGATCTATTTGTTAT
ATTGTACT
View all "PI152702" genotypes
PI221607   bicolor, NULL Nigeria   CSU784 GCCCTCTCCAATGCGCATGCGTGGGTCTTACGGTGTCTTGCATCGTTTCT
CGCTGTGGCGCAGGTGCGTACAAGTACGTATCGGAGCTATGGAGGAGGAA
GCAGTCCGACGTGATGCGGTTCGTGCAGCGCGTGCGCTGCTGGGAGTACA
GGCAGCAGCCGGCCATCGTCCGCCTCACAAGGCCCACCCGCCCCGACAAG
GCCCGCCGCCTCGGCTACAAGGCCAAGCAGGTAGATCTCCCCTCTTGACC
CCATTGGCGCGTGCGACCTTGGCTATGGATTTGTGGGTAGGCGGAAGGTC
AGGGTGGTGCAGGGATTACCGTTTTCATTTAGGATTGTGATTTCCCAAAG
TGCTACAGTCGTATGCCTGTCTGCCTTAAAATTTTCAGCCTTCCTGCAAG
CCAGGCCTGTGTAGTATTTCTGGTGATTATAGTGACAATCTTCCTGGACG
AAATGAAGGGTTGTTGAGGTTCCGGAGAGCTCGACCCTTATTCGATTTAC
CTTTTCCGAACGTTGTAGTATATTTTGTTTCTGCTAATATAAGATGTTCA
AGTTTGGACTATGATTTTGGTATTACGAGTCCTGCTAATTCTGTAGGTTT
TAACCTCCTGTTGAGTCAGAATATATGCAGGTGTTGGATCTATTTGTTAT
ATTGTACT
View all "PI221607" genotypes
PI267408   bicolor, NULL Uganda   CSU784 GCCCTCTCCAATGCGCATGCGTGGGTCTTACGGTGTCTTGCATCGTTTCT
CGCTGTGGCGCAGGTGCGTACAAGTACGTATCGGAGCTATGGAGGAGGAA
GCAGTCCGACGTGATGCGGTTCGTGCAGCGCGTGCGCTGCTGGGAGTACA
GGCAGCAGCCGGCCATCGTCCGCCTCACAAGGCCCACCCGCCCCGACAAG
GCCCGCCGCCTCGGCTACAAGGCCAAGCAGGTAGATCTCCCCTCTTGACC
CCATTGGCGCGTGCGACCTTGGCTATGGATTTGTGGGTAGGCGGAAGGTC
AGGGTGGTGCAGGGATTACCGTTTTCATTTAGGATTGTGATTTCCCAAAG
TGCTACAGTCGTATGCCTGTCTGCCTTAAAATTTTCAGCCTTCCTGCAAG
CCAGGCCTGTGTAGTATTTCTGGTGATTATAGTGACAATCTTCCTGGACG
AAATGAAGGGTTGTTGAGGTTCCGGAGAGCTCGACCCTTATTCGATTTAC
CTTTTCCGAACGTTGTAGTATATTTTGTTTCTGCTAATATAAGATGTTCA
AGTTTGGACTATGATTTTGGTATTACGAGTCCTGCTAATTCTGTAGGTTT
TAACCTCCTGTTGAGTCAGAATATATGCAGGTGTTGGATCTATTTGTTAT
ATTGTACT
View all "PI267408" genotypes
PI267539   bicolor, NULL India   CSU784 GCCCTCTCCAATGCGCATGCGTGGGTCTTACGGTGTCTTGCATCGTTTCT
CGCTGTGGCGCAGGTGCGTACAAGTACGTATCGGAGCTATGGAGGAGGAA
GCAGTCCGACGTGATGCGGTTCGTGCAGCGCGTGCGCTGCTGGGAGTACA
GGCAGCAGCCGGCCATCGTCCGCCTCACAAGGCCCACCCGCCCCGACAAG
GCCCGCCGCCTCGGCTACAAGGCCAAGCAGGTAGATCTCCCCTCTTGACC
CCATTGGCGCGTGCGACCTTGGCTATGGATTTGTGGGTAGGCGGAAGGTC
AGGGTGGTGCAGGGATTACCGTTTTCATTTAGGATTGTGATTTCCCAAAG
TGCTACAGTCGTATGCCTGTCTGCCTTAAAATTTTCAGCCTTCCTGCAAG
CCAGGCCTGTGTAGTATTTCTGGTGATTATAGTGACAATCTTCCTGGACG
AAATGAAGGGTTGTTGAGGTTCCGGAGAGCTCGACCCTTATTCGATTTAC
CTTTTCCGAACGTTGTAGTATATTTTGTTTCTGCTAATATAAGATGTTCA
AGTTTGGACTATGATTTTGGTATTACGAGTCCTGCTAATTCTGTAGGTTT
TAACCTCCTGTTGAGTCAGAATATATGCAGGTGTTGGATCTATTTGTTAT
ATTGTACT
View all "PI267539" genotypes
PI585454   bicolor, NULL Ghana   CSU784 GCCCTCTCCAATGCGCATGCGTGGGTCTTACGGTGTCTTGCATCGTTTCT
CGCTGTGGCGCAGGTGCGTACAAGTACGTATCGGAGCTATGGAGGAGGAA
GCAGTCCGACGTGATGCGGTTCGTGCAGCGCGTGCGCTGCTGGGAGTACA
GGCAGCAGCCGGCCATCGTCCGCCTCACAAGGCCCACCCGCCCCGACAAG
GCCCGCCGCCTCGGCTACAAGGCCAAGCAGGTAGATCTCCCCTCTTGACC
CCATTGGCGCGTGCGACCTTGGCTATGGATTTGTGGGTAGGCGGAAGGTC
AGGGTGGTGCAGGGATTACCGTTTTCATTTAGGATTGTGATTTCCCAAAG
TGCTACAGTCGTATGCCTGTCTGCCTTAAAATTTTCAGCCTTCCTGCAAG
CCAGGCCTGTGTAGTATTTCTGGTGATTATAGTGACAATCTTCCTGGACG
AAATGAAGGGTTGTTGAGGTTCCGGAGAGCTCGACCCTTATTCGATTTAC
CTTTTCCGAACGTTGTAGTATATTTTGTTTCTGCTAATATAAGATGTTCA
AGTTTGGACTATGATTTTGGTATTACGAGTCCTGCTAATTCTGTAGGTTT
TAACCTCCTGTTGAGTCAGAATATATGCAGGTGTTGGATCTATTTGTTAT
ATTGTACT
View all "PI585454" genotypes
BTx623   bicolor, NULL     CSU784 GCCCTCTCCAATGCGCATGCGTGGGTCTTACGGTGTCTTGCATCGTTTCT
CGCTGTGGCGCAGGTGCGTACAAGTACGTATCGGAGCTATGGAGGAGGAA
GCAGTCCGACGTGATGCGGTTCGTGCAGCGCGTGCGCTGCTGGGAGTACA
GGCAGCAGCCGGCCATCGTCCGCCTCACAAGGCCCACCCGCCCCGACAAG
GCCCGCCGCCTCGGCTACAAGGCCAAGCAGGTAGATCTCCCCTCTTGACC
CCATTGGCGCGTGCGACCTTGGCTATGGATTTGTGGGTAGGCGGAAGGTC
AGGGTGGTGCAGGGATTACCGTTTTCATTTAGGATTGTGATTTCCCAAAG
TGCTACAGTCGTATGCCTGTCTGCCTTAAAATTTTCAGCCTTCCTGCAAG
CCAGGCCTGTGTAGTATTTCTGGTGATTATAGTGACAATCTTCCTGGACG
AAATGAAGGGTTGTTGAGGTTCCGGAGAGCTCGACCCTTATTCGATTTAC
CTTTTCCGAACGTTGTAGTATATTTTGTTTCTGCTAATATAAGATGTTCA
AGTTTGGACTATGATTTTGGTATTACGAGTCCTGCTAATTCTGTAGGTTT
TAACCTCCTGTTGAGTCAGAATATATGCAGGTGTTGGATCTATTTGTTAT
ATTGTACT
View all "BTx623" genotypes
KFS1   NULL South Africa   CSU784 GCCCTCTCCAATGCGCATGCGTGGGTCTTACGGTGTGTTGCATCGTTTCT
CGCTGTGGCGCAGGTGCGTACAAGTACGTCTCGGAGCTATGGAGGAGGAA
GCAGTCCGACGTGATGCGGTTCGTGCAGCGCGTGCGCTGCTGGGAGTACA
GGCAGCAGCCGGCCATCGTCCGCCTCACAAGGCCCACCCGCCCCGACAAG
GCCCGCCGCCTCGGCTACAAGGCCAAGCAGGTAGATCTCCCCTCTTGACC
CCATTGGCGCGTGCGACCTTGGCTATGGATTTGTGGGTAGGCGGAAGGTC
AGGGTGGTGCAGGGATTACCGTTTTCATTTAGGATTGTGATTTTTAAAAG
TGCTACAGTCGTATGCCTGTCTGCCTTAAAGTTTCCAGCCTTCCTGCAAG
CCAGGCCTGTGTAGTATTTCTGGTGATTATAGTGACAATCTTCCTGGACG
AAATGAAGGGCTGTTTAGGTTCCGGAGAGCTCGACCCTTATTCGATTTAC
CTTTTCCGAACGTTGTAGTATA-TTTGTTTCTGCTAATATAAGATGTTCA
AGTTTAGACTATGATTTTGGTATTACGAGGCCTGCTAATTCTGTAGGTTT
T--CCTCCTGTTGAGTCAGAATATATGCAGGTGCTGGATCTATTTGTTAT
ATTGTACT
View all "KFS1" genotypes
[ Download ]