grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for marker "lga15" from the experiment "Hamblin, Casa, et al. (2006) Challenges of Detecting Directional Selection After a Bottleneck: Lessons From Sorghum bicolor. Genetics 173: 953-964.".

E.g., Germplasm L-WA58, Marker/locus pSB0080.

Items 1 to 15 of 15.

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Germplasm
65I 1791   bicolor, NULL Mali   lga15 AATGTGCAATA-----ATATGCAGGGGCATGGCGGTTGCCGATGCATCGA
GCCCGTACAAGGTGAAGCTGCTGGTGGAGGACTACCCATACGCGTCGGAC
GGGCTGGCAATCTGGCACGCGATCGAGCAGTGGGTGACGGAGTACCTGGG
CATCTACTACCCCAACGACGGCGTGCTGCAGGCGGACGTGGAGCTGCAGG
CATGGTGGAAGGAGGTGCGCGAGGTCGGGCACGCCGACCTCAAGGACGAG
CCATGGTGGCCCAAGATGGAGACGGTGCCGGAGCTCGTCAAGGCCTGCAC
CACCATCATCTGGATCGCGTCGGCGCTCCACGCCGCCGTCAACTTCGGGC
AGTACCCGTACGCCGGGTACATCCCGAACCGTCCGTCGGTCAGCCGGAAG
CCGATGCCGGCGCCGGGCAGCGAGGAGTACGCGGAGCTGGGGAAGAACCC
GGAGAAGGTGTTCGTGCGCACCATCACGAGCCAGTTCCAGACACTCGTCG
GCATCTCGCTGCTGGAGATCCTGTCCAGCCACTCCTCCGACGAGGTGTAC
CTCGGCCAGCGCGACACGCCGGAGTGGACGTCGGACGCCAAGGCGCAGGA
GGCGTTCCGGCGGTTCGGGGCGCGGCTGACCGAGATCGAGAGCCGCGTGA
TGACCATGAACGCCGACCCAAGTCTCAAGAACCGCAACGGGCCGGCCAAG
TTCCCCTACACGCTGCTCTACCCCAACACCTCCGACAAGAATGGCGATGC
CGCCGGCATCACCGCCAAGGGCATTCCAAACAGCATCTCCATCTGAGTTC
TGAGTTCTGA
View all "65I 1791" genotypes
65I 2133   bicolor, NULL India   lga15 AATGTGCAATA-----ATATGCAGGGGCATGGCGGTTGCCGATGCATCGA
GCCCGTACAAGGTGAAGCTGCTGGTGGAGGACTACCCATACGCGTCGGAC
GGGCTGGCAATCTGGCACGCGATCGAGCAGTGGGTGACGGAGTACCTGGG
CATCTACTACCCCAACGACGGCGTGCTGCAGGCGGACGTGGAGCTGCAGG
CATGGTGGAAGGAGGTGCGCGAGGTCGGGCACGCCGACCTCAAGGACGAG
CCATGGTGGCCCAAGATGGAGACGGTGGCGGAGCTCGTCAAGGCCTGCAC
CACCATCATCTGGATCGCGTCGGCGCTCCACGCCGCCGTCAACTTCGGGC
AGTACCCGTACGCCGGGTACATTCCCAACCGTCCGTCGGTCAGCCGGAAG
CCGATGCCGGCGCCGGGCAGCGAGGAGTACGCGGAGCTGGGGAAGAACCC
GGAGAAGGTGTTCGTGCGCACCATCACGAGCCAGTTCCAGACACTCGTCG
GCATCTCGCTGCTGGAGATCCTGTCCAGCCACTCCTCCGACGAGGTGTAC
CTCGGCCAGCGCGACACGCCGGAGTGGACGTCGGACGCCAAGGCGCAGGA
GGCGTTCCGGCGGTTCGGGGCGCGGCTGACCGAGATCGAGAGCCGCGTGA
TGACCATGAACGCCGACCCAAGTCTCAAGAACCGCAACGGGCCGGCCAAG
TTCCCCTACACGCTGCTCTACCCCAACACCTCCGACAAGAATGGCGATGC
CGCCGGCATCACCGCCAAGGGCATTCCAAACAGCATCTCCATCTGAGTTC
TGAGTTCTGA
View all "65I 2133" genotypes
66I 4156   bicolor, NULL Algeria   lga15 AATGTGCAATA-----ATATGCAGGGGCATGGCGGTTGCCGATGCATCGA
GCCCGTACAAGGTGAAGCTGCTGGTGGAGGACTACCCATACGCGTCGGAC
GGGCTGGCAATCTGGCACGCGATCGAGCAGTGGGTGACGGAGTACCTGGG
CATCTACTACCCCAACGACGGCGTGCTGCAGGCGGACGTGGAGCTGCAGG
CATGGTGGAAGGAGGTGCGCGAGGTCGGGCACGCCGACCTCAAGGACGAG
CCATGGTGGCCCAAGATGGAGACGGTGCCGGAGCTCGTCAAGGCCTGCAC
CACCATCATCTGGATCGCGTCGGCGCTCCACGCCGCCGTCAACTTCGGGC
AGTACCCGTACGCCGGGTACATTCCCAACCGTCCGTCGGTCAGCCGGAAG
CCGATGCCGGCGCCGGGCAGCGAGGAGTACGCGGAGCTGGGGAAGAACCC
GGAGAAGGTGTTCGTGCGCACCATCACGAGCCAGTTCCAGACACTCGTCG
GCATCTCGCTGCTGGAGATCCTGTCCAGCCACTCCTCCGACGAGGTGTAC
CTCGGCCAGCGCGACACGCCGGAGTGGACGTCGGACGCCAAGGCGCAGGA
GGCGTTCCGGCGGTTCGGGGCGCGGCTGACCGAGATCGAGAGCCGCGTGA
TGACCATGAACGCCGACCCAAGTCTCAAGAACCGCAACGGGCCGGCCAAG
TTCCCCTACACGCTGCTCTACCCCAACACCTCCGACAAGAATGGCGATGC
CGCCGGCATCACCGCCAAGGGCATTCCAAACAGCATCTCCATCTGAGTTC
TGAGTTCTGA
View all "66I 4156" genotypes
69I 7471   bicolor, NULL Uganda   lga15 AATGTGCAATA-----ATATGCAGGGGCATGGCGGTTGCCGATGCATCGA
GCCCGTACAAGGTGAAGCTGCTGGTGGAGGACTACCCATACGCGTCGGAC
GGGCTGGCAATCTGGCACGCGATCGAGCAGTGGGTGACGGAGTACCTGGG
CATCTACTACCCCAACGACGGCGTGCTGCAGGCGGACGTGGAGCTGCAGG
CATGGTGGAAGGAGGTGCGCGAGGTCGGGCACGCCGACCTCAAGGACGAG
CCATGGTGGCCCAAGATGGAGACGGTGGCGGAGCTCGTCAAGGCCTGCAC
CACCATCATCTGGATCGCGTCGGCGCTCCACGCCGCCGTCAACTTCGGGC
AGTACCCGTACGCCGGGTACATTCCCAACCGTCCGTCGGTCAGCCGGAAG
CCGATGCCGGCGCCGGGCAGCGAGGAGTACGCGGAGCTGGGGAAGAACCC
GGAGAAGGTGTTCGTGCGCACCATCACGAGCCAGTTCCAGACACTCGTCG
GCATCTCGCTGCTGGAGATCCTGTCCAGCCACTCCTCCGACGAGGTGTAC
CTCGGCCAGCGCGACACGCCGGAGTGGACGTCGGACGCCAAGGCGCAGGA
GGCGTTCCGGCGGTTCGGGGCGCGGCTGACCGAGATCGAGAGCCGCGTGA
TGACCATGAACGCCGACCCAAGTCTCAAGAACCGCAACGGGCCGGCCAAG
TTCCCCTACACGCTGCTCTACCCCAACACCTCCGACAAGAATGGCGATGC
CGCCGGCATCACCGCCAAGGGCATTCCAAACAGCATCTCCATCTGAGTTC
TGAGTTCTGA
View all "69I 7471" genotypes
69I 7776   bicolor, NULL Chad   lga15 AATGTGCAATA-----ATATGCAGGGGCATGGCGGTTGCCGATGCATCGA
GCCCGTACAAGGTGAAGCTGCTGGTGGAGGACTACCCATACGCGTCGGAC
GGGCTGGCAATCTGGCACGCGATCGAGCAGTGGGTGACGGAGTACCTGGG
CATCTACTACCCCAACGACGGCGTGCTGCAGGCGGACGTGGAGCTGCAGG
CATGGTGGAAGGAGGTGCGCGAGGTCGGGCACGCCGACCTCAAGGACGAG
CCATGGTGGCCCAAGATGGAGACGGTGCCGGAGCTCGTCAAGGCCTGCAC
CACCATCATCTGGATCGCGTCGGCGCTCCACGCCGCCGTCAACTTCGGGC
AGTACCCGTACGCCGGGTACATTCCCAACCGTCCGTCGGTCAGCCGGAAG
CCGATGCCGGCGCCGGGCAGCGAGGAGTACGCGGAGCTGGGGAAGAACCC
GGAGAAGGTGTTCGTGCGCACCATCACGAGCCAGTTCCAGACACTCGTCG
GCATCTCGCTGCTGGAGATCCTGTCCAGCCACTCCTCCGACGAGGTGTAC
CTCGGCCAGCGCGACACGCCGGAGTGGACGTCGGACGCCAAGGCGCAGGA
GGCGTTCCGGCGGTTCGGGGCGCGGCTGACCGAGATCGAGAGCCGCGTGA
TGACCATGAACGCCGACCCAAGTCTCAAGAACCGCAACGGGCCGGCCAAG
TTCCCCTACACGCTGCTCTACCCCAACACCTCCGACAAGAATGGCGATGC
CGCCGGCATCACCGCCAAGGGCATTCCAAACAGCATCTCCATCTGAGTTC
TGAGTTCTGA
View all "69I 7776" genotypes
74L 11921   bicolor, NULL Central Africa Rep   lga15 AATGTGCAATA-----ATATGCAGGGGCATGGCGGTTGCCGATGCATCGA
GCCCGTACAAGGTGAAGCTGCTGGTGGAGGACTACCCATACGCGTCGGAC
GGGCTGGCAATCTGGCACGCGATCGAGCAGTGGGTGACGGAGTACCTGGG
CATCTACTACCCCAACGACGGCGTGCTGCAGGCGGACGTGGAGCTGCAGG
CATGGTGGAAGGAGGTGCGCGAGGTCGGGCACGCCGACCTCAAGGACGAG
CCATGGTGGCCCAAGATGGAGACGGTGGCGGAGCTCGTCAAGGCCTGCAC
CACCATCATCTGGATCGCGTCGGCGCTCCACGCCGCCGTCAACTTCGGGC
AGTACCCGTACGCCGGGTACATTCCCAACCGTCCGTCGGTCAGCCGGAAG
CCGATGCCGGCGCCGGGCAGCGAGGAGTACGCGGAGCTGGGGAAGAACCC
GGAGAAGGTGTTCGTGCGCACCATCACGAGCCAGTTCCAGACACTCGTCG
GCATCTCGCTGCTGGAGATCCTGTCCAGCCACTCCTCCGACGAGGTGTAC
CTCGGCCAGCGCGACACGCCGGAGTGGACGTCGGACGCCAAGGCGCAGGA
GGCGTTCCGGCGGTTCGGGGCGCGGCTGACCGAGATCGAGAGCCGCGTGA
TGACCATGAACGCCGACCCAAGTCTCAAGAACCGCAACGGGCCGGCCAAG
TTCCCCTACACGCTGCTCTACCCCAACACCTCCGACAAGAATGGCGATGC
CGCCGGCATCACCGCCAAGGGCATTCCAAACAGCATCTCCATCTGAGTTC
TGAGTTCTGA
View all "74L 11921" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lga15 AATGTGCAATA-----ATATGCAGGGGCATGGCGGTTGCCGATGCATCGA
GCCCGTACAAGGTGAAGCTGCTGGTGGAGGACTACCCATACGCGTCGGAC
GGGCTGGCAATCTGGCACGCGATCGAGCAGTGGGTGACGGAGTACCTGGG
CATCTACTACCCCAACGACGGCGTGCTGCAGGCGGACGTGGAGCTGCAGG
CATGGTGGAAGGAGGTGCGCGAGGTCGGGCACGCCGACCTCAAGGACGAG
CCATGGTGGCCCAAGATGGAGACGGTGGCGGAGCTCGTCAAGGCCTGCAC
CACCATCATCTGGATCGCGTCGGCGCTCCACGCCGCCGTCAACTTCGGGC
AGTACCCGTACGCCGGGTACATTCCCAACCGTCCGTCGGTCAGCCGGAAG
CCGATGCCGGCGCCGGGCAGCGAGGAGTACGCGGAGCTGGGGAAGAACCC
GGAGAAGGTGTTCGTGCGCACCATCACGAGCCAGTTCCAGACACTCGTCG
GCATCTCGCTGCTGGAGATCCTGTCCAGCCACTCCTCCGACGAGGTGTAC
CTCGGCCAGCGCGACACGCCGGAGTGGACGTCGGACGCCAAGGCGCAGGA
GGCGTTCCGGCGGTTCGGGGCGCGGCTGACCGAGATCGAGAGCCGCGTGA
TGACCATGAACGCCGACCCAAGTCTCAAGAACCGCAACGGGCCGGCCAAG
TTCCCCTACACGCTGCTCTACCCCAACACCTCCGACAAGAATGGCGATGC
CGCCGGCATCACCGCCAAGGGCATTCCAAACAGCATCTCCATCTGAGTTC
TGAGTTCTGA
View all "Purdue No. 49018" genotypes
HD-043   bicolor, NULL Swaziland   lga15 AATGTGCAATA-----ATATGCAGGGGCATGGCGGTTGCCGATGCATCGA
GCCCGTACAAGGTGAAGCTGCTGGTGGAGGACTACCCATACGCGTCGGAC
GGGCTGGCAATCTGGCACGCGATCGAGCAGTGGGTGACGGAGTACCTGGG
CATCTACTACCCCAACGACGGCGTGCTGCAGGCGGACGTGGAGCTGCAGG
CATGGTGGAAGGAGGTGCGCGAGGTCGGGCACGCCGACCTCAAGGACGAG
CCATGGTGGCCCAAGATGGAGACGGTGGCGGAGCTCGTCAAGGCCTGCAC
CACCATCATCTGGATCGCGTCGGCGCTCCACGCCGCCGTCAACTTCGGGC
AGTACCCGTACGCCGGGTACATTCCCAACCGTCCGTCGGTCAGCCGGAAG
CCGATGCCGGCGCCGGGCAGCGAGGAGTACGCGGAGCTGGGGAAGAACCC
GGAGAAGGTGTTCGTGCGCACCATCACGAGCCAGTTCCAGACACTCGTCG
GCATCTCGCTGCTGGAGATCCTGTCCAGCCACTCCTCCGACGAGGTGTAC
CTCGGCCAGCGCGACACGCCGGAGTGGACGTCGGACGCCAAGGCGCAGGA
GGCGTTCCGGCGGTTCGGGGCGCGGCTGACCGAGATCGAGAGCCGCGTGA
TGACCATGAACGCCGACCCAAGTCTCAAGAACCGCAACGGGCCGGCCAAG
TTCCCCTACACGCTGCTCTACCCCAACACCTCCGACAAGAATGGCGATGC
CGCCGGCATCACCGCCAAGGGCATTCCAAACAGCATCTCCATCTGAGTTC
TGAGTTCTGA
View all "HD-043" genotypes
PI152702   bicolor, NULL Sudan   lga15 AATGTGCAATA-----ATATGCAGGGGCATGGCGGTTGCCGATGCATCGA
GCCCGTACAAGGTGAAGCTGCTGGTGGAGGACTACCCATACGCGTCGGAC
GGGCTGGCAATCTGGCACGCGATCGAGCAGTGGGTGACGGAGTACCTGGG
CATCTACTACCCCAACGACGGCGTGCTGCAGGCGGACGTGGAGCTGCAGG
CATGGTGGAAGGAGGTGCGCGAGGTCGGGCACGCCGACCTCAAGGACGAG
CCATGGTGGCCCAAGATGGAGACGGTGGCGGAGCTCGTCAAGGCCTGCAC
CACCATCATCTGGATCGCGTCGGCGCTCCACGCCGCCGTCAACTTCGGGC
AGTACCCGTACGCCGGGTACATTCCCAACCGTCCGTCGGTCAGCCGGAAG
CCGATGCCGGCGCCGGGCAGCGAGGAGTACGCGGAGCTGGGGAAGAACCC
GGAGAAGGTGTTCGTGCGCACCATCACGAGCCAGTTCCAGACACTCGTCG
GCATCTCGCTGCTGGAGATCCTGTCCAGCCACTCCTCCGACGAGGTGTAC
CTCGGCCAGCGCGACACGCCGGAGTGGACGTCGGACGCCAAGGCGCAGGA
GGCGTTCCGGCGGTTCGGGGCGCGGCTGACCGAGATCGAGAGCCGCGTGA
TGACCATGAACGCCGACCCAAGTCTCAAGAACCGCAACGGGCCGGCCAAG
TTCCCCTACACGCTGCTCTACCCCAACACCTCCGACAAGAATGGCGATGC
CGCCGGCATCACCGCCAAGGGCATTCCAAACAGCATCTCCATCTGAGTTC
TGAGTTCTGA
View all "PI152702" genotypes
PI221607   bicolor, NULL Nigeria   lga15 AATGTGCAATA-----ATATGCAGGGGCATGGCGGTTGCCGATGCATCGA
GCCCGTACAAGGTGAAGCTGCTGGTGGAGGACTACCCATACGCGTCGGAC
GGGCTGGCAATCTGGCACGCGATCGAGCAGTGGGTGACGGAGTACCTGGG
CATCTACTACCCCAACGACGGCGTGCTGCAGGCGGACGTGGAGCTGCAGG
CATGGTGGAAGGAGGTGCGCGAGGTCGGGCACGCCGACCTCAAGGACGAG
CCATGGTGGCCCAAGATGGAGACGGTGGCGGAGCTCGTCAAGGCCTGCAC
CACCATCATCTGGATCGCGTCGGCGCTCCACGCCGCCGTCAACTTCGGGC
AGTACCCGTACGCCGGGTACATTCCCAACCGTCCGTCGGTCAGCCGGAAG
CCGATGCCGGCGCCGGGCAGCGAGGAGTACGCGGAGCTGGGGAAGAACCC
GGAGAAGGTGTTCGTGCGCACCATCACGAGCCAGTTCCAGACACTCGTCG
GCATCTCGCTGCTGGAGATCCTGTCCAGCCACTCCTCCGACGAGGTGTAC
CTCGGCCAGCGCGACACGCCGGAGTGGACGTCGGACGCCAAGGCGCAGGA
GGCGTTCCGGCGGTTCGGGGCGCGGCTGACCGAGATCGAGAGCCGCGTGA
TGACCATGAACGCCGACCCAAGTCTCAAGAACCGCAACGGGCCGGCCAAG
TTCCCCTACACGCTGCTCTACCCCAACACCTCCGACAAGAATGGCGATGC
CGCCGGCATCACCGCCAAGGGCATTCCAAACAGCATCTCCATCTGAGTTC
TGAGTTCTGA
View all "PI221607" genotypes
PI267408   bicolor, NULL Uganda   lga15 AATGTGCAATA-----ATATGCAGGGGCATGGCGGTTGCCGATGCATCGA
GCCCGTACAAGGTGAAGCTGCTGGTGGAGGACTACCCATACGCGTCGGAC
GGGCTGGCAATCTGGCACGCGATCGAGCAGTGGGTGACGGAGTACCTGGG
CATCTACTACCCCAACGACGGCGTGCTGCAGGCGGACGTGGAGCTGCAGG
CATGGTGGAAGGAGGTGCGCGAGGTCGGGCACGCCGACCTCAAGGACGAG
CCATGGTGGCCCAAGATGGAGACGGTGGCGGAGCTCGTCAAGGCCTGCAC
CACCATCATCTGGATCGCGTCGGCGCTCCACGCCGCCGTCAACTTCGGGC
AGTACCCGTACGCCGGGTACATTCCCAACCGTCCGTCGGTCAGCCGGAAG
CCGATGCCGGCGCCGGGCAGCGAGGAGTACGCGGAGCTGGGGAAGAACCC
GGAGAAGGTGTTCGTGCGCACCATCACGAGCCAGTTCCAGACACTCGTCG
GCATCTCGCTGCTGGAGATCCTGTCCAGCCACTCCTCCGACGAGGTGTAC
CTCGGCCAGCGCGACACGCCGGAGTGGACGTCGGACGCCAAGGCGCAGGA
GGCGTTCCGGCGGTTCGGGGCGCGGCTGACCGAGATCGAGAGCCGCGTGA
TGACCATGAACGCCGACCCAAGTCTCAAGAACCGCAACGGGCCGGCCAAG
TTCCCCTACACGCTGCTCTACCCCAACACCTCCGACAAGAATGGCGATGC
CGCCGGCATCACCGCCAAGGGCATTCCAAACAGCATCTCCATCTGAGTTC
TGAGTTCTGA
View all "PI267408" genotypes
PI267539   bicolor, NULL India   lga15 AATGTGCAATA-----ATATGCAGGGGCATGGCGGTTGCCGATGCATCGA
GCCCGTACAAGGTGAAGCTGCTGGTGGAGGACTACCCATACGCGTCGGAC
GGGCTGGCAATCTGGCACGCGATCGAGCAGTGGGTGACGGAGTACCTGGG
CATCTACTACCCCAACGACGGCGTGCTGCAGGCGGACGTGGAGCTGCAGG
CATGGTGGAAGGAGGTGCGCGAGGTCGGGCACGCCGACCTCAAGGACGAG
CCATGGTGGCCCAAGATGGAGACGGTGGCGGAGCTCGTCAAGGCCTGCAC
CACCATCATCTGGATCGCGTCGGCGCTCCACGCCGCCGTCAACTTCGGGC
AGTACCCGTACGCCGGGTACATTCCCAACCGTCCGTCGGTCAGCCGGAAG
CCGATGCCGGCGCCGGGCAGCGAGGAGTACGCGGAGCTGGGGAAGAACCC
GGAGAAGGTGTTCGTGCGCACCATCACGAGCCAGTTCCAGACACTCGTCG
GCATCTCGCTGCTGGAGATCCTGTCCAGCCACTCCTCCGACGAGGTGTAC
CTCGGCCAGCGCGACACGCCGGAGTGGACGTCGGACGCCAAGGCGCAGGA
GGCGTTCCGGCGGTTCGGGGCGCGGCTGACCGAGATCGAGAGCCGCGTGA
TGACCATGAACGCCGACCCAAGTCTCAAGAACCGCAACGGGCCGGCCAAG
TTCCCCTACACGCTGCTCTACCCCAACACCTCCGACAAGAATGGCGATGC
CGCCGGCATCACCGCCAAGGGCATTCCAAACAGCATCTCCATCTGAGTTC
TGAGTTCTGA
View all "PI267539" genotypes
PI585454   bicolor, NULL Ghana   lga15 AATGTGCAATA-----ATATGCAGGGGCATGGCGGTTGCCGATGCATCGA
GCCCGTACAAGGTGAAGCTGCTGGTGGAGGACTACCCATACGCGTCGGAC
GGGCTGGCAATCTGGCACGCGATCGAGCAGTGGGTGACGGAGTACCTGGG
CATCTACTACCCCAACGACGGCGTGCTGCAGGCGGACGTGGAGCTGCAGG
CATGGTGGAAGGAGGTGCGCGAGGTCGGGCACGCCGACCTCAAGGACGAG
CCATGGTGGCCCAAGATGGAGACGGTGCCGGAGCTCGTCAAGGCCTGCAC
CACCATCATCTGGATCGCGTCGGCGCTCCACGCCGCCGTCAACTTCGGGC
AGTACCCGTACGCCGGGTACATCCCGAACCGTCCGTCGGTCAGCCGGAAG
CCGATGCCGGCGCCGGGCAGCGAGGAGTACGCGGAGCTGGGGAAGAACCC
GGAGAAGGTGTTCGTGCGCACCATCACGAGCCAGTTCCAGACACTCGTCG
GCATCTCGCTGCTGGAGATCCTGTCCAGCCACTCCTCCGACGAGGTGTAC
CTCGGCCAGCGCGACACGCCGGAGTGGACGTCGGACGCCAAGGCGCAGGA
GGCGTTCCGGCGGTTCGGGGCGCGGCTGACCGAGATCGAGAGCCGCGTGA
TGACCATGAACGCCGACCCAAGTCTCAAGAACCGCAACGGGCCGGCCAAG
TTCCCCTACACGCTGCTCTACCCCAACACCTCCGACAAGAATGGCGATGC
CGCCGGCATCACCGCCAAGGGCATTCCAAACAGCATCTCCATCTGAGTTC
TGAGTTCTGA
View all "PI585454" genotypes
BTx623   bicolor, NULL     lga15 AATGTGCAATA-----ATATGCAGGGGCATGGCGGTTGCCGATGCATCGA
GCCCGTACAAGGTGAAGCTGCTGGTGGAGGACTACCCATACGCGTCGGAC
GGGCTGGCAATCTGGCACGCGATCGAGCAGTGGGTGACGGAGTACCTGGG
CATCTACTACCCCAACGACGGCGTGCTGCAGGCGGACGTGGAGCTGCAGG
CATGGTGGAAGGAGGTGCGCGAGGTCGGGCACGCCGACCTCAAGGACGAG
CCATGGTGGCCCAAGATGGAGACGGTGGCGGAGCTCGTCAAGGCCTGCAC
CACCATCATCTGGATCGCGTCGGCGCTCCACGCCGCCGTCAACTTCGGGC
AGTACCCGTACGCCGGGTACATTCCCAACCGTCCGTCGGTCAGCCGGAAG
CCGATGCCGGCGCCGGGCAGCGAGGAGTACGCGGAGCTGGGGAAGAACCC
GGAGAAGGTGTTCGTGCGCACCATCACGAGCCAGTTCCAGACACTCGTCG
GCATCTCGCTGCTGGAGATCCTGTCCAGCCACTCCTCCGACGAGGTGTAC
CTCGGCCAGCGCGACACGCCGGAGTGGACGTCGGACGCCAAGGCGCAGGA
GGCGTTCCGGCGGTTCGGGGCGCGGCTGACCGAGATCGAGAGCCGCGTGA
TGACCATGAACGCCGACCCAAGTCTCAAGAACCGCAACGGGCCGGCCAAG
TTCCCCTACACGCTGCTCTACCCCAACACCTCCGACAAGAATGGCGATGC
CGCCGGCATCACCGCCAAGGGCATTCCAAACAGCATCTCCATCTGAGTTC
TGAGTTCTGA
View all "BTx623" genotypes
KFS1   NULL South Africa   lga15 AATGTGCAATATGTATATATGCAGAGGCATGGCGGTTGCCGATGCATCGA
GCCCGTACAAGGTGAAGCTGCTGGTGGAGGACTACCCATACGCGTCGGAC
GGGCTGGCAATCTGGCACGCGATCGAGCAGTGGGTGACGGAGTACCTGGG
CATCTACTACCCCAACGACGGCGTGCTGCAGGCGGACGTGGAGCTGCAGG
CATGGTGGAAGGAGGTGCGCGAGGTCGGGCACGCCGACCTCAAGGACGAG
CCATGGTGGCCCAAGATGGAGACGGTGCCGGAGCTCGTCAAGGCCTGCAC
CACCATCATCTGGATCGCGTCGGCGCTCCACGCCGCCGTCAACTTCGGGC
AGTACCCGTACGCCGGGTACATCCCGAACCGTCCGTCGGTCAGCCGGAAG
CCGATGCCGGCGCCGGGCAGCGAGGAGTACGCGGAGCTGGGGAAGAACCC
GGAGAAGGTGTTCGTGCGCACCATCACGAGCCAGTTCCAGACACTCGTCG
GCATCTCGCTGCTGGAGATCCTGTCCAGCCATTCCTCCGACGAGGTGTAC
CTCGGCCAGCGCGACACGCCGGAGTGGACGTCGGACGCCAAGGCGCAGGA
GGCGTTCCGGCGGTTCGGGGCGCGGCTGACCGAGATCGAGAGCCGCGTGA
TGACCATGAACGCCGACCCAAGTCTCAAGAACCGCAACGGGCCGGCCAAG
TTCCCCTACACGCTGCTCTACCCCAACACCTCCGACAAGAATGGCGATGC
CGCCGGCATCACCGCCAAGGGCATTCCAAACAGCATCTCCATCTGAGTTC
TGAGTTCTGA
View all "KFS1" genotypes
[ Download ]