grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "65I 2133" from the experiment "Hamblin, Casa, et al. (2006) Challenges of Detecting Directional Selection After a Bottleneck: Lessons From Sorghum bicolor. Genetics 173: 953-964.".

E.g., Germplasm L-WA58, Marker/locus pSB0080.

Items 1 to 25 of 200.       of 8 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
65I 2133   bicolor, NULL India   CSU784 GCCCTCTCCAATGCGCATGCGTGGGTCTTACGGTGTCTTGCATCGTTTCT
CGCTGTGGCGCAGGTGCGTACAAGTACGTATCGGAGCTATGGAGGAGGAA
GCAGTCCGACGTGATGCGGTTCGTGCAGCGCGTGCGCTGCTGGGAGTACA
GGCAGCAGCCGGCCATCGTCCGCCTCACAAGGCCCACCCGCCCCGACAAG
GCCCGCCGCCTCGGCTACAAGGCCAAGCAGGTAGATCTCCCCTCTTGACC
CCATTGGCGCGTGCGACCTTGGCTATGGATTTGTGGGTAGGCGGAAGGTC
AGGGTGGTGCAGGGATTACCGTTTTCATTTAGGATTGTGATTTCCCAAAG
TGCTACAGTCGTATGCCTGTCTGCCTTAAAATTTTCAGCCTTCCTGCAAG
CCAGGCCTGTGTAGTATTTCTGGTGATTATAGTGACAATCTTCCTGGACG
AAATGAAGGGTTGTTGAGGTTCCGGAGAGCTCGACCCTTATTCGATTTAC
CTTTTCCGAACGTTGTAGTATATTTTGTTTCTGCTAATATAAGATGTTCA
AGTTTGGACTATGATTTTGGTATTACGAGTCCTGCTAATTCTGTAGGTTT
TAACCTCCTGTTGAGTCAGAATATATGCAGGTGTTGGATCTATTTGTTAT
ATTGTACT
View all "CSU784" genotypes
65I 2133   bicolor, NULL India   lga1 TATCCATAGTAAGTAGGCAGCCCCTGATTCACAAGTCAGGACCAACGACA
TTCAGTTCTCTTGTTGCTTTCCCCTTTACCATCAAGTTGTAGTTTATGAT
GGAATACCATACCACTTGTTGCAGCTTTGTGTCCTTGATCCATCTAGTAG
TGGGTGTCGCATACTGCCTCGTCGGCTGGAGTGTCGGTCTCCCCAAGCGA
GCGGTAATTTGTACTGCAAACCTGCACATCCCCTCCCTCTTTAATTAAGG
ACTAGTACTTCCTGCAACTTGACCTCTTTGCCTAGTGAACAAAAGGGTTT
CTTTTATTATGTAATAAAAATATGTAGTGCCATCCAGTTATTTCCTTATG
GGAACAGATGAATGTATTTGTGCCATTACTTGAGCACAGCCCCTTCACGG
TTTCACCTAAGGGAATACATCTTTTTGTGCCATCTTGTTTTGTAGCCTAT
CAATGCCAATCTCCTGAAGCTGCTCTTTCCAGTGGCATTGTGCCATGGTA
TTGGTCACGTCACTAGCAATGTGTCCTTCGCTGCTGTTGCAGTCTCATTT
GCCCACACTATCAAAGGTACTTCTTTTCCTCCCATTTATATTTCAATGTG
GATTCTTCTTGCCCCTGTCCTGTTCACTCATGTTTCTATGCTACATACTT
GCAATGCAGCTCTGGAGCCCTTCTTCAGCGCAGCTGCTACTCAGTTTATC
CTTGGGCAGCAAGTTCCCCTCTCTCTGTGGATGTCTCTTG
View all "lga1" genotypes
65I 2133   bicolor, NULL India   lga10 CTACGATGAGTGTCAGAGGAAGTATGGCAACGCCAATGCATGGCGGTACT
GCACTGATGTATTTGATTACCTTACACTATCAGCAATCATTAATGGCCAA
GTAAGTTCCACTAGGGAAAAAATTACAGGTTCTCATTTCATGTTATTTCG
GCAAGTCATACTTAAATTATATGCTGAATTCAGGTCCTCTGTGTTCATGG
TGGTCTTTCTCCCGATGTACGTACTATTGATCAGGTCTGTGA-----CTT
CTGTAACTTTCTTATAACCATCTGTGAACACATCTGTTTATGAACCCTTA
AGTATGACCCTTCCCATTTTATGGGATTCTGAGTTTCATGTCTTTTAGGT
TTGCCA--TACTTGGTGAATACATAAGTAGAAATATTTTTCACATGGACT
ATAAAGGATATGCATAGCCTTAAGAATTACATCTATTTGAAAACTTCACC
ATTATCAGTGATATAAATAAAATGCTTCAGTGGATATATGCTGGAAGTTT
GGAAATTTTGAATATTAAACAGCAGAAATGTTGTTTTCAGTTATTTTGTT
TTTTCTGTTCTTATTTTCAGCTGGTTGTGCTAACTGTACTTTTTT-GGAC
GTGTTTCTGATAGAATTTCCTTTGGTAATAAGAATGCTTATCATCAATGA
ACTAGCATTGCTGACTCATTTTGTGAAGAATATTGAGCACGTGATTCTGG
GGTTGATTTGGTCCTTAGAATTTCTTACTCATTTCTTGAAGAATAGTAGT
GCATGATTATGTGGTTGATTTTTATTTTGACTACATATTTCAATGAGATT
GAAGCTTTGATTACCTTTTCACCAGATACGAACGATTGATCGCAAT
View all "lga10" genotypes
65I 2133   bicolor, NULL India   lga101 CCTCTGGAGCTTTTGTTCCCAGGCCTATGCTTGAGGTCATCTCTCTCCAC
TAACACTTGTGTTTGGAATCACTATCCAATATTTCCTAATATTGCATTGT
CATTCCAGAGAATTTCAGATCTGTGCAAAAATGCTGGTGCATGGCTTGTG
GTTGACAATACCTATGAGTAAGTCAATACTGTAAAGTGATCATTTTCACA
AGCAATTATATAATCTTTTGTGGTATCTGTTAGAGAGAACTTAGAAGAGC
CGGGGAATTATGGTTGTAGTCAAAGGGACAGATCATATAAGCCATTAGAG
CTCTTCTGCCTCCTCTTGAATCTGTGTCCAGATGAAAGACACTCTGATGG
CATATAGGATTTCTAG--TATCTTTGCAGTTTCCACAAGGAAGGGAAAAT
CAGAATATTGTGCCCATAGGAGATTCAGAAAGTAGTCGTCCTGCACAGAT
ATGTTGTGTGAGAATATGTCGAATACAGTTATCCTGTGTTTGTTTTTTTG
GTTTAGGATAAGTTCTCTTATTCAAATTCATTCCAGCTGCCAAGCCTTTA
TAAATACGTTTTAGGCTCTAAACTTGGTGATGTTAAAAATAAGCCCTCCA
ATCACACTTACTGCTTTATACTTTATACAGGCCAGGGTTTATGTTTGCCT
GAAAGAGTCAGGTGTTCAGGTCCATGTTGAGGAACTAATAGTAATTAATA
AAGGACC-TTTTCCCTCTAAGCTTAAAGAAACATACAAGTTTTTGTCGTG
GAGCTGCGATTAGCCAACCATATTTGAAGTG
View all "lga101" genotypes
65I 2133   bicolor, NULL India   lga102 GATGCATGGCAATGCAGTACTACTAGCATGTAATGTGAAGCTGC------
-AGCAGCTAGCAAGGTGACGCCAAAGGCCCAAATCAAAAACTCAAAATAA
AACTAGTATCAATCATAATTCAGAAATGACGCTTATGTGCAAGGAAAGTA
AACACACTTTCCCCCCTTTTTTACAAATAGAGCTTATATTTGGGAATATA
AAAGGAATGGAGGGAGGGAGGGATGTTTTCCTTTTTCAGAAGTATTGTCA
GTATTTGCAAGTCTCAAGTCTGTAATCTGTACCAGCAGCTAGCAGAGTTG
AATGTTTGGTAGTTTTGGTACCGTTGCTGAGGCTGCTATTTATTCTGCAT
AGTACTCGTAGCACACTAGTACCAGTGTTTTTCTTCAGTAAATTCCAGCT
GGTATATGTATATCCTATACTGTAAATACAGTCAAAAGTCAGCTCTTGTT
TCCTGGGATCTGATCAGAGATTAGCAGATATAATGAGCCGTTAAACAACC
GAGCAA--------------------------------CCCGGCCCGTGG
TCTCTCTCTGGAGGTGCATAAAAGCACTGGCAGACTTGCTGCACACCCTG
ACTGACCTGCCGTGTCCTGACCTGACCTCGCCGTTTTCTTCTCTGCCGAT
CC-TTCCTTGCTTGCTGCA--------TCTCTGTCTCTCCATGGCAGCCA
TCACCAGCAAGGACAAGGAGGAGGGTCTCCAGCTGAAGCAAGGGGAGAGC
AAGCTGTTCTCGAAGCTGTTCACCAGGGAGAGCTCCGCTGCGGCGCCGTC
CTTCCGGGTGTA
View all "lga102" genotypes
65I 2133   bicolor, NULL India   lga103 AGCGGGTGCTGCTGCTCCTGGCTTCCAAGGCTACACAGGCTTCAACCACC
CGTCCTATGCTGCTGCCGGCTATGGAGGTCTTCAGCAACAGCATCTCCAG
CAGCAGCAGAGCAACAACCTCATGGCGAGCATGCAGGGGTACCATCATCA
TCCTGCAGCGACGGCCGCGATGATGAACAATTTGAGGGGTCTGAATAGCA
ACATGATGATGATGCATCAGCCCCAGCAGCAGCCGCAGATGATGTACCAC
TCCTCTCCCCAGATCAGCCCTTACACTGGCTACTACAACCCTTACAATTA
CTACTACCATCCCCATCCTGGCAGTGCTGGTTACCCAGCCAGCAATGGGG
ATGTGGAGACCATGTTCAGTGATGAGAACACCAAGGGCTGTGTTGTCATG
TAGGGATGCAGCTACAATCCTATAATCTAGAGGTTGGTGATGGACCATGG
TAATGGTGATGCAGTCCTGCTACCC-TTTTTTTGTTTCTTTTTTGTTTCC
TTTAATTATTTTACTGCTCTTATGGTTTCGCCTGTATCAAGAGTGAATCA
TGGTGTTGACTTAGATGTGTTGTTGAAAGTAGGGGCAACTTGAGAGGGTT
ATCAAACAGTGTAATGTAATACCTTTTAGGCTTTTACTGCCTAGTGCTTT
GCCCTGACTGGCTTGTTATAATTTGTATATTGTATATCTGGGTGTTTGTG
GCTTTGGACTTGTATGCTGTGCCATG--------TTATTAGTGCTGCTCA
TGACCTAGACTAACAGTGGAGGGGGTGAACAACTGTTAGCAGTCAACATT
GGGGGTGATGCATT
View all "lga103" genotypes
65I 2133   bicolor, NULL India   lga104 TAGCATGTGCATCAGATGTGCAAGGTTCCCTTTTTGGATGCATTGATTTC
ACTTCAGTTTGTGATATCCAACAATATTTTAGTCTTAATTCATGTGCCAC
GTTGCTTGTGGGAATGCACAATCAAGAGATTTCAACTGTACTTGCCAATT
AACCAACATAATGATATCATGCATCATGAAGTTTCTTAGGGTAACAAGTA
TGGTGGGAATTTCGCATTTTGTGCTATGGACTTTGAATGGTACTCCCT--
-----AAATTATAAGTCATTCTAACTTTATTATGTATCTAGACATGATGA
GGATCTTAGATCAGCCTTTTGTTTCTGGCTAGACGCTTAGAGTTAATGTC
TGTTGTAAGTTTGTACTGTCTTTTTCTATAAAATTATAAATTGAAGTGCT
GTGGGGATCTCCGCCA
View all "lga104" genotypes
65I 2133   bicolor, NULL India   lga105 TTCCACACGCACGC---AATCTTTATACCCCAGTCAATCATTCATCAGTC
ATCATCAAACGAGAACAGCGGCCCATACAGAG-TTTTCTGTTTATGCTTG
AGCGGCGGTTTAAGGCAAATCACGTGGCAC----TGCCGTTTTACACAGT
TGAATTTTGTTACTCCGTAGTATATACTCCTATAGTATACGTTAGTTGAA
TTGTTGTAATTTGAGACCGAACCGTCCAGCCATCCAAACTCCCTACAATA
TTAATTAGTGCCCTCGATCGATCGAGCCCTTGAAATAAAGGTAGCACACT
TCCATCTTCACTCTCACTCACTCACTC----TCACA--TGCACCATACCT
GACTTAGCCACCATGCATACACGCAAGACAATGGCCAAGCTCCTCAGCCT
CAAGACTTGGTACCAGCTCTTTGTGGACAACTTCCTCGCCATAGTCGCGG
TGGCATTTGTCGCCGCCGCGCTCCGGAGGGCATGGCCAGTCAGCGTCGAC
GATCTCGCCGGCAGCCTCCGCGCCGTGCCGCCAGTCCGCATCCTCACGGC
GGTCATCCTGACTGCTGGCGTTGCACAGCTGAGGCGATTGCGCCGGCCGC
GGGACGTGTACCTCGTGGAGTACGGCTGCTTCCGGCCCAAGCCCTGCTTC
CGGGCGCCGTTCGCCACGTGCCTGGAGCACGCCTTCTACCTGCCGTACCA
GGTCGACCCGGAGAGCGTCACCTTCTCGATCCGGCTGCTGGAGCGCTCGG
GGCTCGGCGAGGAGACGTCCCTGCCCATCTCGTACCACTACATTCCACCG
GA
View all "lga105" genotypes
65I 2133   bicolor, NULL India   lga106 GGAAAGGTGTTTTTT-ATATTTATATAAATGATAGGACTTTTAAAAGTAT
TCACTTTTTTATGTGACAACATCCGCTTGAATGATTGGCTGTCAAACATC
AAATTATTGGCATGATCTTGCCATAGAGTTTGGTCTCTGTTTTTTAGAAT
GATCTTTTTGCACTTA----GATGATATATGGTATTACATGGTTCCTTAA
TTGACGAGATGAACTA----------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
-------------------------TTTAGGTACCATGAGTATCTAGATG
CACCACTGATTTGGTGATTTGCATAAAACAGCCATACA----------GA
ATCATAGACATTGCCACACATTTAAAGATAGCCAAAGATTTTGGTCTTGA
TGATTAGCTAAAAAATAACTTATTTTTCACCCTGATATCTGAAAACTTTG
CCCTAACCATTATTTAGTAGCCATTAGGCTTAGGCCAACGAATACCGATT
TTAAGTTTTTGTGGTCACTGGTTGTGAATATAACAT--------------
-----------TGCTTCAACTATTTGCATATTTCAATTCCATAGAATAAA
AATCATTTACCTATCAGAAGGATATTAACTAACACCAGGAATGATCAACC
ATGCTCCTAGAGTTAGC
View all "lga106" genotypes
65I 2133   bicolor, NULL India   lga107 CGTTACGAGACGCAATGTCCGCGTGACCGCAGAGGTGCCGACGCGTCGTC
GACCGAGGTGGCGGGGTGCCGTGTAGCAGAGCAGGACTGCCCGCCGGGCG
TCTTGGGCAGAAGACAGAGATCTGAGAAGCCGTCGGCCCGTCGCCCTCCC
TCTCAACTCCGCTCCTCTCTCTGTTCCCAACTTCCCATCGCCGCATTCTT
CGCCTCCCACCACAGCAGCTTGAGCTCCTCACCGCCGCCCCTCCCTCCAC
TTCCACCGCTGTCCTTGCCCTCCTCGTTACCGTCAGGGTGGACGCATCCT
GGATCTGGCGAGCGCGTCTTCCTTGCGCACTTGATGACCGGCGTCGGCGC
CCTCCAAGCAGCTCCGATTTGACGAGACCGTCGACGCCGGTCGAACCAAG
ACGGAGACAGGCCATCAATACCCAGTAGAATAGCAAGGCTGGGCGGCTGG
CGGCGTCCAGGTTTCCAGAGTTCCAGCTGAGGGGGAGATAGACCGGCGCG
GCAGCCGAGTCGGACGGAGCTCGGCTGTCCGGAGAAGCGCACGCACGACG
GGGCACGCCAGGGATCTGCAGCCGCGGTCTCTCATACCAGTGATCAGGCT
TAATCTGGGTGGGGAAAGTTTGGAAAGATCAATTCGGTGAAGAAGCACGA
TTCAACAGGGAGGAGCTTCAATCTGGTGGGCAGAATTTCGAAAT
View all "lga107" genotypes
65I 2133   bicolor, NULL India   lga109 GAGGGACCTAATGACATCCCTTGCCAACTCCCGCCCATGAATTTTTTTTC
CTCTTCGCATAAATACATGTCGCCTGATTCCCGATCTAATTTTTGCTGGG
CAAACAGT-ATCGATCGTTCC--------------TGCAGAGCACTAGAT
TCCGTGCACA------------ATCGACAAAGGCGTGTATGCATTGCAGG
CTAGGCGCGACTGAAATGGGGCCGCGGTTTCGCCATCTTTTAGCTCGTTT
TTTTCTTGGCACGCGCGCTCGAGTGTGTCCGTATCCTTTCCTCGG-ATAT
CCAGCACGACTCTCCCACTACCATATCGTCGCTCTCGACGAGACCGAGAC
AGCGACGGAAGAGGAGAGCGGCGGGCGAGACGAGAGACCAGGAGGAAGAA
GATGGCCACCTATTTCACGCTCAACACCGGGGCTCGCATCCCCTCGGTAG
GGCTCGGCACCTACAAGGCCGGCCCCGGCGTCGTCGCCGACGCAGTCACC
GCCGCCGTCAAGGTCTTCGCCGTTTGCCCCTCCCTCGAGCACTTCTTGTT
CTGAGTTTTACATCCGTATATGTTCTGTGCCCGTGTACTACCTGTACATG
CGTGCTGCTTAATCCTGCTTTCTTGCTTGCTTGTCATGGCAGGCCGGGTA
CCGGCACATCGACTGCGCGCCGCTATACAAGAACGAGAAGGAGGTAGCCT
TAACCCAGTCCCTGCAATTAGTATCTTCGATTCACATTTGCGATGGCACT
TTGGTTATAGTTGCCCTTAACGCGTATCCTAGATTGGCGTTGCTCTGAAC
AAGCTCTTCGATGACGGCGTCGTCAAGCGAGAAGACCTTTTCATCACCTC
AAAGA
View all "lga109" genotypes
65I 2133   bicolor, NULL India   lga110 ACCATTTCTCAATCCGTCTTGAAGGGTCAGCCGCGTGGCTGCTCTCGTGT
TGGTGATCGCGACACGCGAACCGATGCCCCGGCTGTTCTACGCAGCCGAT
CATACTGCGCGGCGCCATCCAAGTCCGTCACAACTTGGTAGATCCGGGTG
CCTTGTTGCGTTCTTTCTTAATACATGTCGATGGTTGTTCGACTAGCTGA
TGAACTCCCACGTCCTTGTGTCCTCGAGCTGCTAATTTCTCTTGTGTTTT
AAAATAATGGAAATTACATCTGTGTTGTGGTTTCTGCAGATGGAGGAGGC
TATGCTGTCGATCTTACTGTTGTTGAGCCTGCCTTGAATGTTGGTCCTGT
TAATCCGGCTGTACAGGTAGAGCATGGAGAGAATTTGGCAGTGCCAGGCG
ATACCCGTGTTAATTCTGTCGAAAATGCTGTGCTTTCAGAGGACACACTG
GTGCAAGCAGATCAGTTGTGCTCCAATGATGAGGTGCTGAGTGAGAACAC
AGAAGCTCTTACCAAAGACAGTCAGGTTGAGCTTTCAGGAGATCAGGGTG
GGTATCTTCCTCAGTCGGATGTTGATTCTGGAGTTCAGCCAGGGGAGAAG
GTGGAGAGTGAAGATTTGCCAAGACCACCAAGACTATCACGGGTTGCTCC
TCCTGATCTTGATGAATTCAAGACAAGAGCAATTGCTGAAAGGGGACCTG
GTGTTTCTAGTCAACCTGGTCATGTCATCCACCGAAGGGAGCCTAGTGGG
AAGTTGTATAATTATGCAGCAGCATCTAAA
View all "lga110" genotypes
65I 2133   bicolor, NULL India   lga111 ACTTGCTCTTTAATGGATATATCAAAGTATCTTTACAGATGAAGTGAACT
ATGCCTAGTGTTGTTGTGTTGGAAACTGTGTCAGTTTATAGTGGTATGTT
GTCCTGCCTTCATTGGTATAATGCCTTTCTATGTCTGTACTAGATGACAT
GTTCTATGACTGAAGATGGCCTTTCCGAAAGTCTTCAAGAGATGGATTTT
TCAGGTATACCTTCCATCATTACTGCTAGACTTTTGGTGTTAGGATGGGT
GTGTTCTTTTCCATTCCTAATTATAGTGGTAATTCAGGTACCGACTGTTT
GCTGAACTCGGATGGGATTGATGAACTGCCAGAAGAATGGCTAGTTGATT
GCTCACAAGATATCGAACCTTGTTTACCTGCAGAAGAAATGTATGTGTTT
CATTCCAATATTCATAAGCGCTTGGATTTTTTAGTTGTTGAGTTCACTGT
CATTGAAGATGAAGTATTACTACTTATGGTATCT-AAACCTTCTTAGTAG
GAATAGCCCTGCTGCTGCCACGGAAAAAGCTGTCGATATCTCTGGTTGGT
ACAAACCTCTCATGAGATTTCATCCTTGCC--TTATAGCAGAATTCTAAG
TTGCTGATAGATGAATGCTATGCTTATTTTTCAGTGCATTCGAATTCTTC
GCCTCGCCAACAGTCCATCGTAGTCCAGAACAATCTTGCACAAGCTAGAC
CTACACCACTGAAAGGTGTGCCCAACTCTTGTCCATGTTTGCTTAAAGAA
TCATGATTTTTATTCTCCTTCTCAAGAACAG
View all "lga111" genotypes
65I 2133   bicolor, NULL India   lga12 GCATTAGTGGACAAGAAAGGATGCTTGTTTATGAGTACATGGCAAACAAG
AGCCTGGACTATTTCCTATTTGGTACCTATCTTTTCTCACCAGTCACCAT
GAATATTTGATTATATTTCCACAACAACAAAAAACTAACCTCCTTCTGTA
TGTCAGCAGAAAAAGACAATGTTGTACTTGATTGGCAAGTGCGGTATCGC
ATAATAGAAGGCATTACTCGAGGTTTACTCTATCTCCACCAGGACTCGAG
ATACAGAATCATCCATAGAGATCTAAAGGCAGCTAACGTTCTTCTAGACA
CGGAGATGACTCCCAAAATTTCAGACTTTGGAATGGCAAGAATATTTGGC
AATGAAGAGACAGAAATTAATACCCGAAAAGTGGTTGGCACATAGTAAGT
TGTGAGAAAGGAATGCAATGCTCATCATACAAATACACTTTGCAGTACTA
ATCCAATTCATGTGTCCTTTTTTTTTTTGGCAGTGGTTACATGTCTCCGG
AGTATGCAATGGATGGAATCTTCTCTGTCAAGTCAGATGTATTCAGTTAT
GGAGTATTATTGCTGGAAATTGTTAGTGGTAGAAGAAACAGAGGAGTATA
TTCCTGTTCAAACAACCAAAGCCTTCTAGGCCATGTAAGTGACAACTTAC
C--ATCTATCGACTTCAAGTAGTATTTCTCAATAAAACTTCTGAAACCTG
GCAATATAT-TTTTTTTCTGCAGGCATGGAGCTTATGGAACGAGGAGAAG
AGCATAGAGTTAGCAGATGAAAGAATGAATGGATCATTCAACTCAGACGA
AGTACAGAAGTGCATCAGAGTTGGACTCTTGTGTGTGCAGGAGAATCCAG
ACGACCGTCCACTGATGTCTCAGGTGCTTCTGATGTTAGCTAGTCCTGAT
GCCACCTCACTGCCAACTCCTAAGCAGCCTGGCTTTGCAGCTAGGAGAGT
TCTAATGGAAACAGACACATCATCAACCAAGCCAG
View all "lga12" genotypes
65I 2133   bicolor, NULL India   lga13 ATCTCTTCTTGTGAGCATCTGTTTTCTGGTCATAGCGATTATGAGTGTGG
TTTGGTGTGACTACATAAGTGCATTTGGTTGCGTGATGCGCAGTTTTGTT
TGCGCTGGTGTGAAGTACACTACGTGATTTATTCGGATTTCGTCTCAGTA
TCCGCGTGAAGCTTATTGACGGTCCAGTGCTGATCAGATTCTACAACGTC
AGCGCTAAACATATTCATAAGCGACATTAATCCGTTGCTGCTGTGTAGCG
ATATCTTTCTTGATCCAGTTACTTGGATGTGGGAAGTTATGCGTGGTAGC
ATACACACCTTCATTCTTCTTTACGTTTCAAAGAGTCGCCTTTGTTTTTG
TAAAATTTTATTTGAAGTTCTGCGAAAGTCCTGATTTGAAGCCTTGAAGC
GACTGACATTTTAATCCATTTAAGAGTCAGCAATTAAGCTATTCAATTAC
TGCAGGTGTAGTGGTCGTTATT-TTTTGTTTTCTCAAGCATTTTAGATGA
ATATTCTAGTATACATTAAGGTGACGAAAAATTTATTAGAACTAGGTAGA
CTGTATTTAAGTGTGTCAGTAGTTTCGACTTCAATCTAGACGCAATTATC
TGTTTTGTTTATGTAATGTCCAACTGTCACTTGGTTCACATTGTATACTA
GATAAATTTCTGATAGAGATTTCATTGATTATATCTAGCTGCTCTTTTCT
AACTGTTGTGGTATTGATGCTTTCTTTCTAACACTTTGTTAAAAAGGCTT
TGGGTTCAATGCATTTGTCAAGTTTAATGTGGTAGTCTATCACATTTT
View all "lga13" genotypes
65I 2133   bicolor, NULL India   lga14 GGTGACATGCTATACGCCACTAC------------TATAGACATCTTGTC
CAATTTCTGCTATTATTTTCTTTTTTTCAACATCACGTTACCCTCATTCC
AGTCACTCTTTGCCTGCAGCAAATAATGCAAGTGCAATACAAGATACCAG
ATTATGTCCACATATCTACGGAATGCCAGCAACTTCTTGCCCGTATCTTT
GTTGCCAATCCAATGAGGGTAATGATTTCAACCTGTAAATTACAGTCATG
ACTTGTCGTGATACACGTGGGATAGTGTAAAACTTGGTAATTTGAAACAT
TGATGCAGTATTTTTATGAATATTCTCCAGAGAATCACAATGAAGGAAAT
AAAGAGCCATCCATGGTTTTTGAAGAACCTACCACGGGAACTCACGGAGA
CTGCACAAGGCATGTACTACAGGAGGGATAACAGGGTGCCTTCTTACTCA
GACCAATCGTCGGAAGAAATCATGAAGATAGTTCAAGATGCAAGGACCAT
GCCGAAATCATCCAGATCAGGCTATGGGTGGAGCACTGAGTATTCGGATG
AAGAAGAAGAGAAGGAAGAGGAACACAGGCCAGAGGAGCATGAGGAACAG
GAAGATGAATACGATAGGAGGGTGAAGGAAGTCCATGCAAGCGGAGAACT
CCGTTTGGACGCTCTTCACATATGAAAGCAAGTGGAAGAAAGTTACGTGT
ACATAACTGGGTTGCGGATCTGAAGGATCCAGTGGGATGTATGCAATTTT
GGCTTCA
View all "lga14" genotypes
65I 2133   bicolor, NULL India   lga15 AATGTGCAATA-----ATATGCAGGGGCATGGCGGTTGCCGATGCATCGA
GCCCGTACAAGGTGAAGCTGCTGGTGGAGGACTACCCATACGCGTCGGAC
GGGCTGGCAATCTGGCACGCGATCGAGCAGTGGGTGACGGAGTACCTGGG
CATCTACTACCCCAACGACGGCGTGCTGCAGGCGGACGTGGAGCTGCAGG
CATGGTGGAAGGAGGTGCGCGAGGTCGGGCACGCCGACCTCAAGGACGAG
CCATGGTGGCCCAAGATGGAGACGGTGGCGGAGCTCGTCAAGGCCTGCAC
CACCATCATCTGGATCGCGTCGGCGCTCCACGCCGCCGTCAACTTCGGGC
AGTACCCGTACGCCGGGTACATTCCCAACCGTCCGTCGGTCAGCCGGAAG
CCGATGCCGGCGCCGGGCAGCGAGGAGTACGCGGAGCTGGGGAAGAACCC
GGAGAAGGTGTTCGTGCGCACCATCACGAGCCAGTTCCAGACACTCGTCG
GCATCTCGCTGCTGGAGATCCTGTCCAGCCACTCCTCCGACGAGGTGTAC
CTCGGCCAGCGCGACACGCCGGAGTGGACGTCGGACGCCAAGGCGCAGGA
GGCGTTCCGGCGGTTCGGGGCGCGGCTGACCGAGATCGAGAGCCGCGTGA
TGACCATGAACGCCGACCCAAGTCTCAAGAACCGCAACGGGCCGGCCAAG
TTCCCCTACACGCTGCTCTACCCCAACACCTCCGACAAGAATGGCGATGC
CGCCGGCATCACCGCCAAGGGCATTCCAAACAGCATCTCCATCTGAGTTC
TGAGTTCTGA
View all "lga15" genotypes
65I 2133   bicolor, NULL India   lga16 GCGCCGGCCCGTCGCGCCGGTCGAGTACCCCATGCACCCCTCACACCTCG
TCTACGAGAAGATTGTGCTCGTCGGGGTCAAGGACGACGTCACGGTTGCC
GATTCCGCCGGGAACAAGTAGATGCTACCACCACCACCA---CCGAAACC
ACGCCTTCTGTTCTGCTGGTAACATCATCCAAGCAAGTAGATGCTATGCT
GCCTTTCAAC-TTTTTTTCTTGCTGTA-TTTTTTTTCCACTTCACTAGTT
CACTTCTGCTGCATTTGAAATCGTGTTGTAATTACTAGTACTAGTAAAGT
AGTAAGTACCATCAGCCCACCGTGGTGGAAACTGCAGATTTTGCCTCCCA
AACACAATCGGGCAAACTCTGCACTTTCCACCCAAATTACCTCCAATTAG
CTAGCCAGAAGAGTGCTTCTTTTTGTTTTTGTGATCTTTGTCCCTATTCA
AATTGTATCACCGTTGGTACTGATGTATTTCCTTTCTTGCACTGATGCTG
CTTAGTAATTTGCTTCTGTACTTGCTAGTTGTGTTTCACTTATCTGCTCT
AACAGACAAAACTGATCTTTCTTTTGCTTGCATATAAATGCATACTAATC
TTCACCATATATTGGTTCAATCGCCAATTCACCA
View all "lga16" genotypes
65I 2133   bicolor, NULL India   lga17 GCGCTTCCCTGCACAGGTACACCACACCTATCTGCTTCAATCCAGTCCCT
C--TAGTCAAGGCAGATGATCGATCAGCTCAAACCGCACCAGTAGCGTGA
ATTTTACTACACTTGTTTGAATTGTTCAAC-----------ATCACCGAC
AGACAAAA-GGCTAGCG---------------------------------
-TTGCGAGCTGCGACGACGTGTGGAATCGCGTTAGATTTTTAGGCCCCGG
GATCACACCTCAAGAAACTTT-----------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
---------TTTAAAATTTGTCTACAAACAAGCAATTGGTTAGTTTAGGT
GGAGCGATCGGCCTGTCTGGGGATTAGTCAGCAGAGAGAGGTTAGTTAGG
TCAGCTTTGCTTGGTTCCTAA-TTTTCGTC-TAGTAGGTTGCTTGGTCAG
TCGGCAGAGGATCTGGTCGCAGGCTGGAAAGTGCATGCGTCAGAGCATCT
AGACGCTGCAACTGCAAGCGGTGTCACCTGTAGAGCTGCATAGCCTGATC
TCACAT--------CTGATCATCTCATC---TAGAGGAGTGAAGTTTGTT
TGTTGTTGCCGCAGTGGTTTTCCGAGGTGACTCATGGTTGTGATGTGCAG
GTGCGGGTGGCAACGCGGAAGATCTACGACCCCCTGGAGGAGGACGCCTT
CCGCCCCATCCTCCACCACTACGACGGGCCCAAGTTCCGGCTCGAGCTCT
CCGTCAC
View all "lga17" genotypes
65I 2133   bicolor, NULL India   lga2 TTTTTTGGCAGTGTCATGTTTTGTAAGGGCAACTACGTGTGTGCTCAAAA
GAACCCAAGATGTACACGCAAAGGAGATGTAGTCTGCTGATGCAGCATTG
TAAAGTCCACACTCTGCAGGTTAACCCTTTTTTGGGGCCGTCAAGTGTTA
GCGCCCTATGTATGTTATCAACCCTGCAGAGAGGTTGCAAATACGGAACC
ACTCTCACAAACTTGCACCTGTCGAGATCATTTTGTAATCTACTACATCT
TTGTTCAGAATTGTTTTTTTTTT------CACCCGTTGTGTAGTTTACCC
TGAAGGGACTTTCGTTTCTCTTGAAGTACGTGCTTCGGCACGATCGTGAA
TAAAACTGTTAGCATCAGTCAGCTGCCTGTTGAGCAGTAAGAGAAAATAC
AAAGAGGTATGCAAGCCTAGGCTTACATGAGCGCAACACCATTTTACATT
CAATGTGCTTCGTCTTCAACAGATGGTTGGTCTGAAAATCCTTGCATTTC
GCTCTTTCATGGTATCCAACTGATGCTAACTGTCGGTCTGAATCGGGCCT
CTGCTCTGATT-CTCAACTGGGGCAGCTCAGGTCAGGGAAACTGGAGATG
GCGTCAGGTGCTCAAAAGCGAAATGTGTCACGCGCGTCTATGAAGAAGCA
CATTGGATCAAAGAGCTATTTATTTATGCCAAGCAAGCGAGATGATTCAG
ATGTATCCAAATGGCCGGTCCGAAATGCAGAAGATGATGAGTAAATATGG
TTTGGGAAACCACTTCTATGCCAAGCAT
View all "lga2" genotypes
65I 2133   bicolor, NULL India   lga20 TATTTCTGAATGCTTGTCAGGCCAAACAGATTTATAGATCCATCAGATAA
CATGTGGAGATTGCAATTCAATGGACTCCAATTGGACGTATTGCTTCTAC
ACTTGCAATGTCACTCCATTCACAGCTGTACCTTCTACATTTTCCATGAC
CCTCCAGTCAGCTCTACGTCGTGGGTCAAATTTCTGATTGTCATTTTAGG
TCCATACTTTTTCAGAGCATCAGGACGACACCAAAATGGCAATGGCACGA
ACCAACTGTCATTAATAATATAGCCACAATACAACGTCATACACAAATTT
ATACGAAACATTGAACTTATAATAACTGATGCACCAAATTACCGATTAAT
CTTGACACTGTGATCTCCATCTATAGTCCAGTCAAGCTTATTAGATGCAT
AATCATCATGGCCAGCTTCATCAACAGTCCTATTAAACACGCCAAAGAAT
ACAGTAAATTGTTTTTTTAAGGATATAGTAAATTGCTTATTATGCTTTAC
TGACGCCGCTTCTCGCACAACTCCTGTACGTCATTGAAACCTGAATACAC
CGCATGACAAGCACCTGAATACCCGAACATACC-TTTTTTTTCTCAAAAT
GACCCAGGAC
View all "lga20" genotypes
65I 2133   bicolor, NULL India   lga5 TTTTGTTGGCACTTGTCAT--------------------GTACTGAAAAG
TCTTGACACGGCATACG-----------------TTCTGGTAGGGAACAT
GACAAAGATCGATCTCTGGTCACTCGTCTGCTCCCCCTACCTGCACGTTG
TATCATGTAAATCCACAGTATATATGCTGCTGTGTATTGTTATACATGTA
TATATGTATATGTAGTACTCCTGTGAGAGCAG------GCACGTACTGAC
TGTGTTTGCCTGGTACGTGACGATGGATACGCAGGCACGCCGAGGGCGGG
TTCGAGGCGGCGGCCGGCGCCGGAGCTGAGAACGAAGGGTGCAAGTGCGG
CCCCAACTGCAGCTGCAACCCCTGCACCTGCAAGTGAG
View all "lga5" genotypes
65I 2133   bicolor, NULL India   lga6 ATGTCTCTCTTGACGCTCGAAATTTCATCTAGCTACTAGCTAGGACGCTG
TTCGTGTATATATATATAGTTCAATCTTCGTGTATGTATATATGCGTGGG
TGTCTGATCACGACGAACTGACCGATTCTGAATGCAACA---AAATACGC
ATTGCTG--CCGCACGCAGGGCCGAAGAAGGCGTGCTGCAAAGAGTGCAC
CAGCTGGTCGGGTGTCTACACCTGCGACGACCTCCTGACCAAGTGCGCCG
CCACCTGCAAGCAATGCGTCCCCGTGTCCACGGACAAGGGCACCCGCTAC
AGGTGCCGCGACTTCCTCCCCGAAGGCTGCCCCTGCAAGACCAACTGATC
CATCCATCCATCCACACCACGCATGCATGGCCACAGCCGATGGAT
View all "lga6" genotypes
65I 2133   bicolor, NULL India   lga7 CCGGAGTGATTCGTTGGAAGCGCGATCTGGATTGGGTGTGGAGAGTATGT
TTTGCTTTACGAATTGGGATCAGTTTTTAATCACTAGTAGCCAATCTGGC
CCTGAAATTGTTCCTAGGTACTCCGAGCTACGTACTGTGGGCTGTTTTCT
TATTTCAGCTATCAAATCTGTCTCTGAGATGGCGATAAATCAGAATTATT
GACCTTCCTGTTGTGACTACCTGAATACCTTAGGCAGTGGTGAACTGGTG
ATTACTCAGCAGTCACCAGTGTTGCTTCATGAACTCAAGTCTTCCGCATA
CTGCGCCGCTGCCGCCTCATTTGACTTACACATGAGTCATGTGCACAATT
AGATCTTGTTGCCCCTGAGAATCACTTAGGATCAGTTTAATGGCATTGGC
ATTGGTTGCAGTTTACTATTAGAACAAACAAAATGAATATGAAAGTTTAG
ATTTTTTTTT
View all "lga7" genotypes
65I 2133   bicolor, NULL India   lga8 GATAATGGAGGTCCATACCCTGGTGGCTACCCAGCAAGTAATGTTCCTCT
AAATTATATATGTAGCTTAGCATTTCCTAAAACTATTATCCATATTCATA
TTATCAGCCTCATAACCAAACTATTATCGCAGTAGCTGACTGTAAAATTT
ACCTGAATTATTATCAACCTTCAGGGGATGATGCTTATCGCACTGCTGAT
CCAACTCCCAGGGGTGCTCAACCTTTGAAAGTGCAGCCAATTGCTGTCCC
CACTATTCCTGTAGAAGAAATTAGAGAGGTCACAAAGGCTTTTGGCGATG
AAGCTTTGATTGGCGAGGGGTCTTTTGGCAGAGTATATTTTGGTGTACTA
GAAAATGGTAGGAGTGCTGCGATAAAAAAGTTAGATTCAAGCAAGCAGCC
AGAGCAAGAGTTTTTAGCACAGGTGTGCATTGATTTTATCAATGAATTGT
GCATCTTTGCTAGTCTTTCTTCTTATAAAATATATCTCTACACCTGCAGG
TCTCCATGGTGTCAAGGCTTAAGCATGACAATGTCGTAGAGTTGCTTGGT
TACTGTGTTGATGGGAACACCCGCATCCTTGCTTATGAATTTGCTACTAT
GGGTTCTCTTCACGATATGCTTCATGGTATTACTCTGTTTACTTCTAAAA
TCTAGTGTTCTAATAACTTTGAAATATATTATTCTCTTTAACTTCTTTCC
GGATAGCTGATGAGTTTGAATTTGAACTCCACAGGACGCAAAGGTGTGAA
AGGAGCTCAGCCTGGTCCAGTC
View all "lga8" genotypes
[ Download ]