grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "66I 4156" from the experiment "Hamblin, Casa, et al. (2006) Challenges of Detecting Directional Selection After a Bottleneck: Lessons From Sorghum bicolor. Genetics 173: 953-964.".

E.g., Germplasm L-WA58, Marker/locus pSB0080.

Items 1 to 25 of 199.       of 8 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
66I 4156   bicolor, NULL Algeria   lga1 TATCCATAGTAAGTAGGCAGCCCCTGATTCACAAGTCAGGACCAACGACA
TTCAGTTCTCTTGTTGCTTTCCCCTTTACCATCAAGTTGTAGTTTATGAT
GGAATACCATACCACTTGTTGCAGCTTTGTGTCCTTGATCCATCTAGTAG
TGGGTGTCGCATACTGCCTCGTCGGCTGGAGTGTCGGTCTCCCCAAGCGA
GCGGTAATTTGTACTGCAAACCTGCACATCCCCTCCCTCTTTAATTAAGG
ACTAGTACTTCCTGCAACTTGACCTCTTTGCCTAGTGAACAAAAGGGTTT
CTTTTATTATGTAATAAAAATATGTAGTGCCATCCAGTTATTTCCTTATG
GGAACAGATGAATGTATTTGTGCCATTACTTGAGCACAGCCCCTTCACGG
TTTCACCTAAGGGAATACATCTTTTTGTGCCATCTTGTTTTGTAGCCTAT
CAATGCCAATCTCCTGAAGCTGCTCTTTCCAGTGGCATTGTGCCATGGTA
TTGGTCACGTCACTAGCAATGTGTCCTTCGCTGCTGTTGCAGTCTCATTT
GCCCACACTATCAAAGGTACTTCTTTTCCTCCCATTTATATTTCAATGTG
GATTCTTCTTGCCCCTGTCCTGTTCACTCATGTTTCTATGCTACATACTT
GCAATGCAGCTCTGGAGCCCTTCTTCAGCGCAGCTGCTACTCAGTTTATC
CTTGGGCAGCAAGTTCCCCTCTCTCTGTGGATGTCTCTTG
View all "lga1" genotypes
66I 4156   bicolor, NULL Algeria   lga10 CTATGATGAGTGTCAGAGGAAGTATGGCAACGCCAATGCATGGCGGTACT
GCACTGATGTATTTGATTACCTTACGCTATCAGCAATCATTAATGGCCAA
GTAAGTTCCACTAGGGAAAAAATTACAGGTTCTCATTTCATGTTATTTCG
GCAAGTCATACTTAAATTATATGCTGAATTCAGGTCCTCTGTGTTCATGG
TGGTCTTTCTCCCGATGTACGTACTATTGATCAGGTCTGTGACTTCTCTT
CTGTAACTTTCTTATAACCATCTGTGAACACATCTGTTTATGAACCCTTA
AGTATGACCCTTCCCATTTTATGGGATTCTGAGTTTCATGTCTTTTAGGT
TTGCCA--TACTTGGTGAATACATAAGTAGAAATATTTTTCACATGGACT
ATAAAGGATATGCATAGCCTTAAGAATTACATCTATTTGAAAACTTCACC
ATTATCAGTGATATAAATAAAATGCTTCAGTGGATATATGCTGGAAGTTT
GGAAATTTTGAATATTAAACAGCAGAAATGTTGTTTTCAGTTATTTTGTT
TTTTCTGTTCTTATTTTCAGCTGGTTGTGCTAACTGTACTTTTTTTGGAC
ATGTTTCTGATAGAATTTCCTTTGGTAATAAGAATGCTTATCATCAATGA
ACTAGCATTGCTGACTCATTTTGTGAAGAATATTGAGCACGTGATTCTGG
GGTTGATTTGGTCCTTAGAATTTCTTACTCATTTCTTGAAGAATAGTAGT
GCATGATTATGTGGTTGATTTTTAGTTTGACTAAATATTTCAATGAGATT
GAAGCTTTGATTACCTTTTCACCAGATACGAACGATTGATCGCAAT
View all "lga10" genotypes
66I 4156   bicolor, NULL Algeria   lga101 CCTCTGGAGCTTTTGTTCCCAGGCCTATGCTTGAGGTCATCTCTCTCCAC
TAACACTTGTGTTTGGAATCACTATCCAATATTTCCTAATATTGCATTGT
CATTCCAGAGAATTTCAGATCTGTGCAAAAATGCTGGTGCATGGCTTGTG
GTTGACAATACCTATGAGTAAGTCAATACTGTAAAGTGATCATTTTCACA
AGCAATTATATAATCTTTTGTGGTATCTGTTAGAGAGAACTTAGAAGAGC
CGGGGAATTATGGTTGTAGTCAAAGGGACAGATCATATAAGCCATTAGAG
CTCTTCTGCCTCCTCTTGAATCTGTGTCCAGATGAAAGACACTCTGATGG
CATATAGGATTTCTAG--TATCTTTGCAGTTTCCACAAGGAAGGGAAAAT
CAGAATATTGTGCCCATAGGAGATTCAGAAAGTAGTCGTCCTGCACAGAT
ATGTTGTGTGAGAATATGTCGAATACAGTTATCCTGTGTTTGTTTTTTTG
GTTTAGGATAAGTTCTCTTATTCAAATTCATTCCAGCTGCCAAGCCTTTA
TAAATACGTTTTAGGCTCTAAACTTGGTGATGTTAAAAATAAGCCCTCCA
ATCACACTTACTGCTTTATACTTTATACAGGCCAGGGTTTATGTTTGCCT
GAAAGAGTCAGGTGTTCAGGTCCATGTTGAGGAACTAATAGTAATTAATA
AAGGACC-TTTTCCCTCTAAGCTTAAAGAAACATACAAGTTTTTGTCGTG
GAGCTGCGATTAGCCAACCATATTTGAAGTG
View all "lga101" genotypes
66I 4156   bicolor, NULL Algeria   lga102 GATGCATGGCAATGCAGTACTACTAGCATGTAATGTGAAGCTGCTGCAGC
TAGCATCTAGCAAGCTGACGCCAAAGGCCCAAATCAAAAACTCAAAATAA
AACTAGCATCAATCATAATTCAGAAATGAAGCTTATGTGCAAGGAAAGTA
AACACACTTTTCCCCTTTTTTTACAAATAGAGCTTATATTTGGGAATATA
AAAGGAATGGAGGGAGGGAGGGATGTTTTCCTTTTTCAGAAGTATTGTCA
GTATTTGCAAATCTCAAGTCTGTAATCTGTACCAGCA----GCAGAGTTG
AATGTTTGGTAGTTTTGGTACCGTTGCTGAGGCTGTTATTTGTTCTGCAT
AGTACTCGTAGCACACTAGTACCAGTGTCTTTCTTCAGTAAATTCCAGCT
GGTATATGTGTATCCTATACTGTAAATACAGTCAAAAGTCAGCTCTTGTT
TCCTGGGATCTGATCAGAGATTAGCAGATATAATGAGCCGTTAAACAACC
TAGCAAATGCCGTTATAATAACAGAACTACAGTAATAT----CCCCGTGG
TCTCTCTCTGGAGGTGCATAAAAGCGCTAGCAGACTTGCTGCACACCCTG
ACTGACCTGCCGTGC-----CCTGACCTCGCCGTTTTCTTCTCTGCCGAT
CCTTTCCTTGCTTGCTGCATCTCTGTCTCTCTGTCTCTCAATGGCAGCCA
TCACCAGCAAGGACAAGGAGGAGGGTCTCCAGCTGAAGCAAGGGGAGAGC
AAGGTGTTCTCGAAGCTGTTCACCAGGGAGAGCTCCGCCGCGGCGCCGTC
CTTCCGGGTGTA
View all "lga102" genotypes
66I 4156   bicolor, NULL Algeria   lga103 AGCGGGTGCTGCTGCTCCTGGCTTCCAAGGCTACACAGGCTTCAACCACC
CGTCCTATGCTGCTGCCGGCTATGGAGGTCTTCAGCAACAGCATCTCCAG
CAGCAGCAGAGCAACAACCTCATGGCGAGCATGCAGGGGTACCATCATCA
TCCTGCAGCGACGGCCGCGATGATGAACAATTTGAGGGGTCTGAATAGCA
ACATGATGATGATGCATCAGCCCCAGCAGCAGCCGCAGATGATGTACCAC
TCCTCTCCCCAGATCAGCCCTTACACTGGCTACTACAACCCTTACAATTA
CTACTACCATCCCCATCCTGGCAGTGCTGGTTACCCAGCCAGCAATGGGG
ATGTGGAGACCATGTTCAGTGATGAGAACACCAAGGGCTGTGTTGTCATG
TAGGGATGCAGCTACAATCCTATAATCTAGAGGTTGGTGATGGACCATGG
TAATGGTGATGCAGTCCTGCTACCC-TTTTTTTGTTTCTTTTTTGTTTCC
TTTAATTATTTTACTGCTCTTATGGTTTCGCCTGTATCAAGAGTGAATCA
TGGTGTTGACTTAGATGTGTTGTTGAAAGTAGGGGCAACTTGAGAGGGTT
ATCAAACAGTGTAATGTAATACCTTTTAGGCTTTTACTGCCTAGTGCTTT
GCCCTGACTGGCTTGTTATAATTTGTATATTGTATATCTGGGTGTTTGTG
GCTTTGGACTTGTATGCTGTGCCATG--------TTATTAGTGCTGCTCA
TGACCGAGACTAACAGTGGAGGGGGTGAACAACTGTTAGCAGTCAACATT
GGGGGTGATGCATT
View all "lga103" genotypes
66I 4156   bicolor, NULL Algeria   lga104 TAGCATGTGCATCAGATGTGCAAGGTTCCCTTTTTGGATGCATTGATTTC
ACTTCAGTTTGTGATATCCAACAATATTTTAGTCTTAATTCATGTGCCAC
GTTGCTTGTGGGAATGCACAACCAAGAGATTTCAACTGTACTTGCCAATT
AACCAACATAATGATATCATGCATCATGAAGTTTCTTAGGGTAACAAGTA
TGGTGGGAATTTCGCATTTTGTGCTATGGACTTTGAATGGTACTCCCT--
-----AAATTATAAGTCATTCTAACTTTATTATGTATCTAGACATGATGA
GGATCTTAGATCAGCCTTTTGTTTCTGGCTAGACGCTTAGAGTTAATGTC
TGTTGTAAGTTTGTACTGTCTTTTTCTATAAAATTATAAATTGAAGTGCT
GTGGGGATCTCCGCCA
View all "lga104" genotypes
66I 4156   bicolor, NULL Algeria   lga105 TTCCACACGCACGC---AATCTTTATACCCCAGTCAATCATTCATCAGTC
ATCATCAAACGAGAACAGCGGCCCATACAGAG-TTTTCTGTTTATGCTTG
AGCGGCGGTTTAAGGCAAATCACGTGGCAC----TGCCGTTTTACACAGT
TGAATTTTGTTACTCCGTAGTATATACTCCTATAGTATACGTTAGTTGAA
TTGTTGTAATTTGAGACCGAACCGTCCAGCCATCCAAACTCCCTACAATA
TTAATTAGTGCCCTCGATCGATCGAGCCCTTGAAATAAAGGTAGCACACT
TCCATCTTCACTCTCACTCACTCACTC----TCACACATGCACCATACCT
GACTTAGCCACCATGCATACACGCAAGACAATGGCCAAGCTCCTCAGCCT
CAAGACTTGGTACCAGCTCTTTGTGGACAACTTCCTCGCCATAGTCGCGG
TGGCATTTGTCGCCGCCGCGCTCCGGAGGGCATGGCCAGTCAGCGTCGAC
GATCTCGCCGGCAGCCTCCGCGCCGTGCCGCCAGTCCGCATCCTCACGGC
GGTCATCCTGACTGCTGGCGTTGCACAGCTGAGGCGATTGCGCCGGCCGC
GGGACGTGTACCTCGTGGAGTACGGCTGCTTCCGGCCCAAGCCCTGCTTC
CGGGCGCCGTTCGCCACGTGCCTGGAGCACGCCTTCTACCTGCCGTACCA
GGTCGACCCGGAGAGCGTCACCTTCTCGATCCGGCTGCTGGAGCGCTCGG
GGCTCGGCGAGGAGACGTCCCTGCCCATCTCGTACCACTACATTCCACCG
GA
View all "lga105" genotypes
66I 4156   bicolor, NULL Algeria   lga106 GGAAAGGTGTTTTTTTATATTTATATAAATGATAGGACTTTTAAAAGTAT
TCACTTTTTTATGTGACAACATCCGCTTGAATGATTGGCTGTCAAACATC
AAATTATTGGCATGATCTTGCCATAGAGTTTGGTCTCTGTTTTTTAGAAT
GATCTTTTTGCACTTACTTAGATGATATATGGTATTACATGGTTCCTTAA
TTGACGAGATGAACTA----------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
-------------------------TTTAGGTACCATGAGTATCTAGATG
CACCACTGATTTGGTGATTTGCATAAAACAGCCATACA----------GA
ATCATAGACATTGCCACACATTTAAAGATAGCCAAAGATTTTGGTCTTGA
TGATTAGCTAAAAAATAACTTATTTTTCACCCTGATATCTGAAAACTTTG
CCCTAACCATTATTTAGTAGCCATTAGGCTTAGGCCAACGAATACCGATT
TTAAGTTTTTGTGGTCACTGGTTGTGAATATAACAT--------------
-----------TGCTTCAACTATTTGCATATTTCAATTCCATAGAATAAA
AATCATTTACCTATCAGAAGGATATTAACTAACACCAGGAATGATCAACC
ATGCTCCTAGAGTTAGC
View all "lga106" genotypes
66I 4156   bicolor, NULL Algeria   lga107 CGTTACGAGACGCAATGTCCGCGTGACCGCAGAGGTGCCGACGCGTCGTC
GACCGAGGTGGCGGGGTGCCGTGTAGCAGAGCAGGACTGCCCGCCGGGCG
TCTTGGGCAGAAGACAGAGATCTGAGAAGCCGTCGGCCCGTCGCCCTCCC
TCTCAACTCCGCTCCTCTCTCTGTTCCCAACTTCCCATCGCCGCATTCTT
CGCCTCCCACCACAGCAGCTTGAGCTCCTCACCGCCGCCCCTCCCTCCAC
TTCCACCGCTGTCCTTGCCCTCCTCGTTACCGTCAGGGTGGACGCATCCT
GGATCTGGCGAGCGCGTCTTCCTTGCGCACTTGATGACCGGCGTCGGCGC
CCTCCAAGCAGCTCCGATTTGACGAGACCGTCGACGCCGGTCGAACCAAG
ACGGAGACAGGCCATCAATACCCAGTAGAATAGCAAGGCTGGGCGGCTGG
CGGCGTCCAGGTTTCCAGAGTTCCAGCTGAGGGGGAGATAGACCGGCGCG
GCAGCCGAGTCGGACGGAGCTCGGCTGTCCGGAGAAGCGCACGCACGACG
GGGCACGCCAGGGATCTGCAGCCGCGGTCTCTCATACCAGTGATCAGGCT
TAATCTGGGTGGGGAAAGTTTGGAAAGATCAATTCGGTGAAGAAGCACGA
TTCAACAGGGAGGAGCTTCAATCTGGTGGGCAGAATTTCGAAAT
View all "lga107" genotypes
66I 4156   bicolor, NULL Algeria   lga109 GAGGGACCTAATGACATCCCTTGCCAACTCCCGCCCATGAATTTTTTTTC
CTCTTCGCATAAATACATGTCGCCTGATTCCCGATCTAATTTTTGCTGGG
CAAACAGT-ATCGATCGTTCC--------------TGCAGAGCACTAGAT
TCCGTGCACA------------ATCGACAAAGGCGTGTATGCATTGCAGG
CTAGGCGCGACTGAAATGGGGCCGCGGTTTCGCCATCTTTTAGCTCGTTT
TTTTCTTGGCACGCGCGCTCGAGTGTGTCCGTATCCTTTCCTCGG-ATAT
CCAGCACGACTCTCCCACTACCATATCGTCGCTCTCGACGAGACCGAGAC
AGCGACGGAAGAGGAGAGCGGCGGGCGAGACGAGAGACCAGGAGGAAGAA
GATGGCCACCTATTTCACGCTCAACACCGGGGCTCGCATCCCCTCGGTAG
GGCTCGGCACCTACAAGGCCGGCCCCGGCGTCGTCGCCGACGCAGTCACC
GCCGCCGTCAAGGTCTTCGCCGTTTGCCCCTCCCTCGAGCACTTCTTGTT
CTGAGTTTTACATCCGTATATGTTCTGTGCCCGTGTACTACCTGTACATG
CGTGCTGCTTAATCCTGCTTTCTTGCTTGCTTGTCATGGCAGGCCGGGTA
CCGGCACATCGACTGCGCGCCGCTATACAAGAACGAGAAGGAGGTAGCCT
TAACCCAGTCCCTGCAATTAGTATCTTCGATTCACATTTGCGATGGCACT
TTGGTTATAGTTGCCCTTAACGCGTATCCTAGATTGGCGTTGCTCTGAAC
AAGCTCTTCGATGACGGCGTCGTCAAGCGAGAAGACCTTTTCATCACCTC
AAAGA
View all "lga109" genotypes
66I 4156   bicolor, NULL Algeria   lga111 ACTTGCTCTTTAATGGATATATCAAAGTATCTTTACAGATGAAGTGAACT
ATGCCTAGTGTTGTTGTGTTGGAAACTGTGTCAGTTTATAGTGGTATGTT
GTCCTGCCTTCATTGGTATAATGCCTTTCTATGTCTGTACTAGATGACAT
GTTCTATGACTGAAGATGGCCTTTCCGAAAGTCTTCAAGAGATGGATTTT
TCAGGTATACCTTCCATCATTACTGCTAGACTTTTGGTGTTAGGATGGGT
GTGTTCTTTTCCATTCCTAATTATAGTGGTAATTCAGGTACCGACTGTTT
GCTGAACTCGGATGGGATTGATGAACTGCCAGAAGAATGGCTAGTTGATT
GCTCACAAGATATCGAACCTTGTTTACCTGCAGAAGAAATGTATGTGTTT
CATTCCAATATTCATAAGCGCTTGGATTTTTTAGTTGTTGAGTTCACTGT
CATTGAAGATGAAGTATTACTACTTATGGTATCT-AAACCTTCTTAGTAG
GAATAGCCCTGCTGCTGCCACGGAAAAAGCTGTCGATATCTCTGGTTGGT
ACAAACCTCTCATGAGATTTCATCCTTGCC--TTATAGCAGAATTCTAAG
TTGCTGATAGATGAATGCTATGCTTATTTTTCAGTGCATTCGAATTCTTC
GCCTCGCCAACAGTCCATCGTAGTCCAGAACAATCTTGCACAAGCTAGAC
CTACACCACTGAAAGGTGTGCCCAACTCTTGTCCATGTTTGCTTAAAGAA
TCATGATTTTTATTCTCCTTCTCAAGAACAG
View all "lga111" genotypes
66I 4156   bicolor, NULL Algeria   lga12 GCATTAGTGGACAAGAAAGGATGCTTGTTTATGAGTACATGGCAAACAAG
AGCCTGGACTATTTCCTATTTGGTACCTATCTTTTCTCACCAGTCACCAT
GAATATTTGATTATATTTCCACAACAACAAAAAACTAACCTCCTTCTGTA
TGTCAGCAGAAAAAGACAATGTTGTACTTGATTGGCAAGTGCGGTATCGC
ATAATAGAAGGCATTACTCGAGGTTTACTCTATCTCCACCAGGACTCGAG
ATACAGAATCATCCATAGAGATCTAAAGGCAGCTAACGTTCTTCTAGACA
CGGAGATGACTCCCAAAATTTCAGACTTTGGAATGGCAAGAATATTTGGC
AATGAAGAGACAGAAATTAATACCCGAAAAGTGGTTGGCACATAGTAAGT
TGTGAGAAAGGAATGCAATGCTCATCATACAAATACACTTTGCAGTACTA
ATCCAATTCATGTGTCCTTTTTTTTTTGGGCAGTGGTTACATGTCTCCGG
AGTATGCAATGGATGGAATCTTCTCTGTCAAGTCAGATGTATTCAGTTAT
GGAGTATTATTGCTGGAAATTGTTAGTGGTAGAAGAAACAGAGGAGTATA
TTCCTGTTCAAACAACCAAAGCCTTCTAGGCCATGTAAGTGACAACTTAC
C--ATCTATCGACTTCAAGTAGTATTTCTCAATAAAACTTCTGAAACCTG
GCAATATAT-TTTTTTTCTGCAGGCATGGAGCTTATGGAACGAGGAGAAG
AGCATAGAGTTAGCAGATGAAAGAATGAATGGATCATTCAACTCAGACGA
AGTACAGAAGTGCATCAGAGTTGGACTCTTGTGTGTGCAGGAGAATCCAG
ACGACCGTCCACTGATGTCTCAGGTGCTTCTGATGTTAGCTAGTCCTGAT
GCCACCTCACTGCCAACTCCTAAGCAGCCTGGCTTTGCAGCTAGGAGAGT
TCTAATGGAAACAGACACATCATCAACCAAGCCAG
View all "lga12" genotypes
66I 4156   bicolor, NULL Algeria   lga13 ATCTCTTCTTGTGAGCATCTGTTTTCTGGTCATAGCGATTATGAGTGTGG
TTTGGTGTGACTACATAAGTGCATTTGGTTGCGTGATGCGCAGTTTTGTT
TGCGCTGGTGTGAAGTACACTACGTGATTTATTCGGATTTCGTCTCAGTA
TCCGCGTGAAGCTTATTGACGGTCCAGTGCTGATCAGATTCTACAACGTC
AGCGCTAAACATATTCATAAGCGACATTAATCCGTTGCTGCTGTGTAGCG
ATATCTTTCTTGATCCAGTTACTTGGATGTGGGAAGTTATGCGTGGTAGC
ATACACACCTTCATTCTTCTTTACGTTTCAAAGAGTCGCCTTTGTTTTTG
TAAAATTTTATTTGAAGTTCTGCGAAAGTCCTGATTTGAAGCCTTGAAGC
GACTGACATTTTAATCCATTTAAGAGTCAGCAATTAAGCTATTCAATTAC
TGCAGGTGTAGTGGTCGTTATT-TTTTGTTTTCTCAAGCATTTTAGATGA
ATATTCTAGTATACATTAAGGTGACGAAAAATTTATTAGAACTAGGTAGA
CTGTATTTAAGTGTGTCAGTAGTTTCGACTTCAATCTAGACGCAATTATC
TGTTTTGTTTATGTAATGTCCAACTGTCACTTGGTTCACATTGTATACTA
GATAAATTTCTGATAGAGATTTCATTGATTATATCTAGCTGCTCTTTTCT
AACTGTTGTGGTATTGATGCTTTCTTTCTAACACTTTGTTAAAAAGGCTT
TGGGTTCAATGCATTTGTCAAGTTTAATGTGGTAGTCTATCACATTTT
View all "lga13" genotypes
66I 4156   bicolor, NULL Algeria   lga14 GGTGACATGCTATACGCCACTAC------------TATAGACATCTTGTC
CAATTTCTGCTATTATTTTCTTTTTTTCAACATCACGTTACCCTCATTCC
AGTCACTCTTTGCCTGCAGCAAATAATGCAAGTGCAATACAAGATACCAG
ATTATGTCCACATATCTACGGAATGCCAGCAACTTCTTGCCCGTATCTTT
GTTGCCAATCCAATGAGGGTAATGATTTCAACCTGTAAATTACAGTCATG
ACTTGTCGTGATACACGTGGGATAGTGTAAAACTTGGTAATTTGAAACAT
TGATGCAGTATTTTTATGAATATTCTCCAGAGAATCACAATGAAGGAAAT
AAAGAGCCATCCATGGTTTTTGAAGAACCTACCACGGGAACTCACGGAGA
CTGCACAAGGCATGTACTACAGGAGGGATAACAGGGTGCCTTCTTACTCA
GACCAATCGTCGGAAGAAATCATGAAGATAGTTCAAGATGCAAGGACCAT
GCCGAAATCATCCAGATCAGGCTATGGGTGGAGCACTGAGTATTCGGATG
AAGAAGAAGAGAAGGAAGAGGAACACAGGCCAGAGGAGCATGAGGAACAG
GAAGATGAATACGATAGGAGGGTGAAGGAAGTCCATGCAAGCGGAGAACT
CCGTTTGGACGCTCTTCACATATGAAAGCAAGTGGAAGAAAGTTACGTGT
ACATAACTGGGTTGCGGATCTGAAGGATCCAGTGGGATGTATGCAATTTT
GGCTTCA
View all "lga14" genotypes
66I 4156   bicolor, NULL Algeria   lga15 AATGTGCAATA-----ATATGCAGGGGCATGGCGGTTGCCGATGCATCGA
GCCCGTACAAGGTGAAGCTGCTGGTGGAGGACTACCCATACGCGTCGGAC
GGGCTGGCAATCTGGCACGCGATCGAGCAGTGGGTGACGGAGTACCTGGG
CATCTACTACCCCAACGACGGCGTGCTGCAGGCGGACGTGGAGCTGCAGG
CATGGTGGAAGGAGGTGCGCGAGGTCGGGCACGCCGACCTCAAGGACGAG
CCATGGTGGCCCAAGATGGAGACGGTGCCGGAGCTCGTCAAGGCCTGCAC
CACCATCATCTGGATCGCGTCGGCGCTCCACGCCGCCGTCAACTTCGGGC
AGTACCCGTACGCCGGGTACATTCCCAACCGTCCGTCGGTCAGCCGGAAG
CCGATGCCGGCGCCGGGCAGCGAGGAGTACGCGGAGCTGGGGAAGAACCC
GGAGAAGGTGTTCGTGCGCACCATCACGAGCCAGTTCCAGACACTCGTCG
GCATCTCGCTGCTGGAGATCCTGTCCAGCCACTCCTCCGACGAGGTGTAC
CTCGGCCAGCGCGACACGCCGGAGTGGACGTCGGACGCCAAGGCGCAGGA
GGCGTTCCGGCGGTTCGGGGCGCGGCTGACCGAGATCGAGAGCCGCGTGA
TGACCATGAACGCCGACCCAAGTCTCAAGAACCGCAACGGGCCGGCCAAG
TTCCCCTACACGCTGCTCTACCCCAACACCTCCGACAAGAATGGCGATGC
CGCCGGCATCACCGCCAAGGGCATTCCAAACAGCATCTCCATCTGAGTTC
TGAGTTCTGA
View all "lga15" genotypes
66I 4156   bicolor, NULL Algeria   lga17 GCGCTTCCCTGCACAGGTACACCACACCTATCTGCTTCAATCCAGTCCCT
C--TAGTCAAGGCAGATGATCGATCAGCTCAAACCGCACCAGTAGCGTGA
ATTTTACTACACTTGTTTGAATTGTTCAAC-----------ATCACCGAC
AGACAAAA-GGCTAGCG---------------------------------
-TTGCGAGATGCGACGACGTGTGGAATCGCGTTAGA-TTTTAGACCCCGG
GATCACACCTCACGAAACTTAGGCCTTGTTTACTTCCCAAAAAATATTAC
AAAAAGTTTCAGATTCAGATCACATTGAATTGTTCAACATCACTACTACA
TCACCCACAGAAGGCTAGCCTTGTTTCATGCATGAAGTATTAAATATAAA
TAAAAATAATAACTAATTATATAGTTTATTTATAATTTAGTTAGTGTATG
ATTGGACGAAAGTACTACTATTTCTATTTTGTAAAATTTTTTTGAAGTAA
ACAAGGCTATTTAAAATTTGTCTACAAACAAGCAATTGGTTAGTTTAAGT
GGAGCGATC---------GGGATTTAGTCAGCAGAGAG------GTTAGG
------TTGCTTGGTTCCTAA-TTTTCGTCCTAGGGGGTTGCTTGGTCAG
TGGGCAGAGGATCTGGTCGCAGGCTGGAAAGTGCATGCGTCAGAGCATCT
AGACGCTGCAACTGCAAGCGGTGTCACCTGTAGAGCTGTATAGCCTGATC
TCACATAGTCACATCTGATCATCTCATC---TAGAGGAGTGATCATTGTT
TGTTGTTGCCCC--TGGTGGT--GAGGTGACTCATGGTTGTGATATGCAG
GTGCGGGTGGCAACGCGAAAGATCTACGACCCCCTGGAGGAGGACGCCTT
CCGCCCCATCCTCCACCACTACGACGGGCCCAAGTTCCGGCTCGAGCTCT
CCGTCAC
View all "lga17" genotypes
66I 4156   bicolor, NULL Algeria   lga2 TTTTTTGGCAGTGTCATGTTTTGTAAGGGCAACTACGTGTGTGCTCAAAA
GAACCCAAGATGTACACGCAAAGGAGATGTAGTCTGCTGATGCAGCATTG
TAAAGTCCACACTCTGCAGGTTAACCCTTTTTTGGGGCCGTCAAGTGTTA
GCGCCCTATGTATGTTATCAACCCTGCAGAGAGGTTGCAAATACGGAACC
ACTCTCACAAACTTGCACCTGTCGAGATCATTTTGTAATCTACTACATCT
TTGTTCAGAATTGTTTTTTTTTT------CACCCGTTGTGTAGTTTACCC
TGAAGGGACTTTCGTTTCTCTTGAAGTACGTGCTTCGGCACGATCGTGAA
TAAAACTGTTAGCATCAGTCAGCTGCCTGTTGAGCAGTAAGAGAAAATAC
AAAGAGGTATGCAAGCCTAGGCTTACATGAGCGCAACACCATTTTACATT
CAATGTGCTTCGTCTTCAACAGATGGTTGGTCTGAAAATCCTTGCATTTC
GCTCTTTCATGGTATCCAACTGATGCTAACTGTCGGTCTGAATCGGGCCT
CTGCTCTGATT-CTCAACTGGGGCAGCTCAGGTCAGGGAAACTGGAGATG
GCGTCAGGTGCTCAAAAGCGAAATGTGTCACGCGCGTCTATGAAGAAGCA
CATTGGATCAAAGAGCTATTTATTTATGCCAAGCAAGCGAGATGATTCAG
ATGTATCCAAATGGCCGGTCCGAAATGCAGAAGATGATGAGTAAATATGG
TTTGGGAAACCACTTCTATGCCAAGCAT
View all "lga2" genotypes
66I 4156   bicolor, NULL Algeria   lga20 TATTTCTGAATGCTTGTCAGGCCAAACAGATTTATAGATCCATCAGATAA
CATGTGGAGATTGCAATTCAATGGACTCCAATTGGACGTATTGCTTCTAC
ACTTGCAATGTCACTCCATTCACAGCTGTACCTTCTACATTTTCCATGAC
CCTCCAGTCAGCTCTACGTCGTGGGTCAAATTTCTGATTGTCATTTTAGG
TCCATACTTTTTCAGAGCATCAGGACGACACCAAAATGGCAATGGCACGA
ACCAACTGTCATTAATAATATAGCCACAATACAACGTCATACACAAATTT
ATACGAAACATTGAACTTATAATAACTGATGCACCAAATTACCGATTAAT
CTTGACACTGTGATCTCCATCTATAGTCCAGTCAAGCTTATTAGATGCAT
AATCATCATGGCCAGCTTCATCAACAGTCCTATTAAACACGCCAAAGAAT
ACAGTAAATTGTTTTTTTAAGGATATAGTAAATTGCTTATTATGCTTTAC
TGACGCCGCTTCTCGCACAACTCCTGTACGTCATTGAAACCTGAATACAC
CGCATGACAAGCACCTGAATACCCGAACATACC-TTTTTTTTCTCAAAAT
GACCCAGGAC
View all "lga20" genotypes
66I 4156   bicolor, NULL Algeria   lga5 TTTTGTTGGCACTTGTCAT--------------------GTACTGAAAAG
TCTTGACACGGCATACG-----------------TTCTGGTAGGGAACAT
GACAAAGATCGATCTCTGGTCACTCGTCTGCTCCCCCTACCTGCACGTTG
TATCATGTAAATCCACAGTATATATGCTGCTGTGTATTGTTATACATGTA
TGTATGTAGC--TAGTACTCCTGTGAGAGCACGCATGCGCACGTACTGAC
TGTGTTTGCCTGGTACGTGACGATGGAT--GCAGGCACGCCGAGGGCGGG
TTCGAGGCGGCGGCCGGCGCCGGAGCTGAGAACGACGGGTGCAAGTGCGG
CCCCAACTGCAGCTGCAACCCCTGCACCTGCAAGTGAG
View all "lga5" genotypes
66I 4156   bicolor, NULL Algeria   lga6 ATGTCTCTCTTGACGCTCGAAATTTCATCTAGCTACTAGCTAGGACGCTG
TTCGTG--TATATATATAGTTCAATCTTCGTGTATGTATATATGCGTGGG
TGTCTG---ACGACGAACTGACCGATTCTGAATGCAACA---AAATACGC
ATTGCTG--CCGCACGCAGGGCCGAAGAAGGCGTGCTGCAAAGAGTGCAC
CAGCTGGTCGGGTGTCTACACCTGCGACGACCTCCTGACCAAGTGCGCCG
CCACCTGCAAGCAATGCGTCCCCGTGTCCACGGACAAGGGCACCCGCTAC
AGGTGCCGCGACTTCCTCCCCGAAGGCTGCCCCTGCAAGACCAACTGATC
CATCCATCCATCCACACCACGCATGCATGGCCACAGCCGATGGAT
View all "lga6" genotypes
66I 4156   bicolor, NULL Algeria   lga7 CCGGAGTGATTCGTTGCAAGCGCGATCTGGATTGGGTGTGGAGAGTATGT
TTTGCTTTACGAATTGGGATCAGTTTTTAATCACTAGTAGCCAATCTGGC
CCTGAAATTGTTCCTAGGTACTCCGAGCTACGTACTGTGGGCTGTTTTCT
TATTTCAGCTATCAAATCTGTCTCTGAGATGGCGATAAATCAGAATTATT
GACCTTCCTGTTGTGACTACCTGAATACCTTAGGCAGTGGTGAACTGGTG
ATTACTCAGCAGTCACCAGTGTTGCTTCATGAACTCAAGTCTTCCGCATA
CTGCGCCGCTGCCGCCTCATTTGACTTACACATGAGTCATGTGCACAATT
AGATCTTGTTGCCCCTGAGAATCACTTAGGATCAGTTTAATGGCATTGGC
ATTGGTTGCAGTTTACTATTAGAACAAACAAAATGAATATGAAAGTTTAG
ATTTTTTTTT
View all "lga7" genotypes
66I 4156   bicolor, NULL Algeria   lga8 GATAATGGAGGTCCATACCCTGGTGGCTACCCAGCAAGTAATGTTCCTCT
AAATTATATATGTAGCTTAGCATTTCCTAAAACTATTATCCATATTCATA
TTATCAGCCTCATAACCAAACTATTATCGCAGTAGCTGACTGTAAAATTT
ACCTGAATTATTATCAACCTTCAGGGGATGATGCTTATCGCACTGCTGAT
CCAACTCCCAGGGGTGCTCAACCTTTGAAAGTGCAGCCAATTGCTGTCCC
CACTATTCCTGTAGAAGAAATTAGAGAGGTCACAAAGGCTTTTGGCGATG
AAGCTTTGATTGGCGAGGGGTCTTTTGGCAGAGTATATTTTGGTGTACTA
GAAAATGGTAGGAGTGCTGCGATAAAAAAGTTAGATTCAAGCAAGCAGCC
AGAGCAAGAGTTTTTAGCACAGGTGTGCATTGATTTTATCAATGAATTGT
GCATCTTTGCTAGTCTTTCTTCTTATAAAATATATCTCTACACCTGCAGG
TCTCCATGGTGTCAAGGCTTAAGCATGACAATGTCGTAGAGTTGCTTGGT
TACTGTGTTGATGGGAACACCCGCATCCTTGCTTATGAATTTGCTACTAT
GGGTTCTCTTCACGATATGCTTCATGGTATTACTCTGTTTACTTCTAAAA
TCTAGTGTTCTAATAACTTTGAAATATATTATTCTCTTTAACTTCTTTCC
GGATAGCTGATGAGTTTGAATTTGAACTCCACAGGACGCAAAGGTGTGAA
AGGAGCTCAGCCTGGTCCAGTC
View all "lga8" genotypes
66I 4156   bicolor, NULL Algeria   lga9 TGAGCACAAATGGGAGATTCCCAACAAATGGCGGGAACAAATTTCTAATG
CGACAAAAATTGTGGAAGGAATTTAGGAATTTCGTCCGCTGCCCAATTTG
GTTTGTCAGTAGCATTATAGCCTTTGAATTTGCAGATGGCACATCACATC
AATTTTGCTTGCACCAAAATCTTGAATAGTTGGAGTAACTTCTTATCTTA
GACCAAGTTTATCAGTGATCCACCTCAGATGCATTTCCTTTATGGAAGGC
TAACTTAACTGTTTGTAAAGTCCTTTCTGATTCTGTTTTCTGACCGCGTG
GTTCTGCAAAAAGAATAAACAGTGAATCATGCGGTTACAGAGGGAACCAA
GCCACTGCAAAATCAAGAAAACCAAGTGAAATGATTACTAAACTTTGCTG
GATCTCGATAGTATAAGGATTGGTAGGAAAGATACAGCTACAAACATGCA
GGGCGCGGCCTTTGAAATATACTCTGTAATAATGGCTGACTATGAACTAA
AGAAAATAAATTTCTGAACTGGTGTTACTTATCTACAGCGTGTTTGAGGT
TACTCCTAACTGAACAAAGCTAAAATTTCCAAAAGCAT--GACGGTGGCA
TCCCCATTCAAAAATTAGTGGCACACAAGAAACTTGTCTCCGATTTGGAC
CAGTCGTCATCCTGGATTCCTGGTTGGTTAAAGAGCAAAGGAAACTAGAA
ACAAGAAATTGTCGTGTACCTTGAGAATAGGATGAATGCTTAACTTGCAG
AAATAAACTAGGCACGCTTGTTCAATATTCAGATGTTTGCTCCAGCTTCA
CTTCCACCCTTCTCAGAGGATGCAG
View all "lga9" genotypes
66I 4156   bicolor, NULL Algeria   lgb1 CAGGTCGTAGCCCGAGCCCCCATCCTCAGTTCCTCACCCTCTGCTTCATC
CTCAGTTCATGCTGTAGCTGTAGCTGTAGACGGCACTCTTATACATTCTT
TCTGTGGTATATACGGGCGAAAGACAGTCTTTCCGTGGTCTGACCCAATG
GTTTATGTGCAGTTTG-------AATGGTCATATATGTGTGCAAATTGTT
GTGCCAGGTCATATAGGTCAACCAAAAGCAGTTGTATAGCAATCTGCAGT
GCCAATTTTTCTAGTTCAGCATTCTGTTTTCCTTTCAGATCTCTTAGCGA
CAAGTCGACAACAACACATTCACATCCTTGTTTCCTAAAACAAAACATTT
TTTTTACATAAAATGGATGAAAATAGAGAGAAGGATCCATGTAACATTGT
GCCAATTTTGGGACCATGGGCCATACACCAAGATTAACGTTCTACGTTCC
CACCTCCCGCTATTGCATCTCTAGCCTCTAGGTTTTTTTTTTTTTTTTGA
CGAAATCTCTAGGTATTTTTTTGCCGCTTCATCTAATGCAGCAACAAAAA
TCACATTCGTCCGCAGGCTTGACACAGTGAGGCATAACGACTCAGCTGAA
TTGATTCCCGAAAGGTAATTCTATTTACTTCTACAGCCATGCTGTTCTTT
CGTGAATGAACATGGATGCTAATATTTGGTCAGTACGCCAGACTCGCGGT
GGTCACAGGAGGAAACAAAGGAGTTGGCCTCGAAGTATGCCGCCAGCTTG
CTCACAAGGGTGTGACAGTTATCCTTACAGCAAGGGATGAGAAACGAGGA
AAATATGCTGCTGAGACCCTTCGCCGTGAATCCGAACTCCCAAACATAAT
CTTCCATCAGCTTGATGTCAGAGATGATGATAGTGTCACCACATTGGCCC
GGTATGTCGAAAGAAGATATGGGAAGCTCGACATCTTGGTAAATCGTAGT
CTACTCCTATTTTTGAAGTAAATGACATCACTTTGTGTTTTTTAGTACAC
ACATAATTGATGATGTGATGGGTGATACAGGTGAACAATGCAGCTATTTC
AGGAATTGTAGCAGATGAGGAAGGCCTGAAAGCTCTCAACATTGATGCAG
AGACATGGGTACTTAGATTGTTCTTTAGCTTT
View all "lgb1" genotypes
66I 4156   bicolor, NULL Algeria   lgb101 AGTGAAATCGGCGTCAAAGAGGTTAGCTATTCTCGTGCCAGCCTCATATT
GAGTAATCCATAAGTTGTGTTTACTTGTTGCTTATTGTAGCGACTGCCAG
GCCCGTTAGAATTTAGATTAATATATTGCTTCTGTGTCTCTCCAGCTAAA
GGAAAGAGTGCATGAGCTACTGACCTCTCAGATGGCTCGGATCAAAGCTA
GCAAGGCGGAGCATGAAACACAGGAAATTAGGACTAGTGTTGTTTACTGA
AGTTTGACAATGAACACCCGAACATCCATGCTGGAAGTTTGTATAAACAT
TCCACTAATGTCGATGATGGTAACACGTTTCATCTGTTGTCATTTTACCC
ATCTGGAAAGGGTTGGTCAAATGCTAGTATGAATATGATTGCCCATTTTG
TTTCCCCCTACCATTGCCGTTATCCGTTCTTTAGTTGGGTATACCCTCCG
TCCCAAAAAGATTATCATTCTGGTTTTCTCCATGGCAGAAAGATTGTCAT
TTTTGTTTTCAAGAAGTCAATCGATCTCGAGTTTAATCAAAT-----ATG
C-AAAAAAAAAACAAATATTTATGATGAGTAGTAAGTATCTTCAGATAAA
TAATGAAATGGTTTTCAAAATAAACCTATTCGGAGTGAATTGACCGTAGC
TTAGTTGGTTAGTTTTATTCTGGTGGAATT
View all "lgb101" genotypes
[ Download ]