grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "HD-043" from the experiment "Hamblin, Casa, et al. (2006) Challenges of Detecting Directional Selection After a Bottleneck: Lessons From Sorghum bicolor. Genetics 173: 953-964.".

E.g., Germplasm L-WA58, Marker/locus pSB0080.

Items 1 to 25 of 197.       of 8 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
HD-043   bicolor, NULL Swaziland   CSU784 GCCCTCTCCAATGCGCATGCGTGGGTCTTACGGTGTCTTGCATCGTTTCT
CGCTGTGGCGCAGGTGCGTACAAGTACGTATCGGAGCTATGGAGGAGGAA
GCAGTCCGACGTGATGCGGTTCGTGCAGCGCGTGCGCTGCTGGGAGTACA
GGCAGCAGCCGGCCATCGTCCGCCTCACAAGGCCCACCCGCCCCGACAAG
GCCCGCCGCCTCGGCTACAAGGCCAAGCAGGTAGATCTCCCCTCTTGACC
CCATTGGCGCGTGCGACCTTGGCTATGGATTTGTGGGTAGGCGGAAGGTC
AGGGTGGTGCAGGGATTACCGTTTTCATTTAGGATTGTGATTTCCCAAAG
TGCTACAGTCGTATGCCTGTCTGCCTTAAAATTTTCAGCCTTCCTGCAAG
CCAGGCCTGTGTAGTATTTCTGGTGATTATAGTGACAATCTTCCTGGACG
AAATGAAGGGTTGTTGAGGTTCCGGAGAGCTCGACCCTTATTCGATTTAC
CTTTTCCGAACGTTGTAGTATATTTTGTTTCTGCTAATATAAGATGTTCA
AGTTTGGACTATGATTTTGGTATTACGAGTCCTGCTAATTCTGTAGGTTT
TAACCTCCTGTTGAGTCAGAATATATGCAGGTGTTGGATCTATTTGTTAT
ATTGTACT
View all "CSU784" genotypes
HD-043   bicolor, NULL Swaziland   lga1 TATCCATAGTAAGTAGGCAGCCCCTGATTCACAAGTCAGGACCAACGACA
TTCAGTTCTCTTGTTGCTTTCCCCTTTACCATCAAGTTGTAGTTTATGAT
GGAATACCATACCACTTGTTGCAGCTTTGTGTCCTTGATCCATCTAGTAG
TGGGTGTCGCATACTGCCTCGTCGGCTGGAGTGTCGGTCTCCCCAAGCGA
GCGGTAATTTGTACTGCAAACCTGCACATCCCCTCCCTCTTTAATTAAGG
ACTAGTACTTCCTGCAACTTGACCTCTTTGCCTAGTGAACAAAAGGGTTT
CTTTTATTATGTAATAAAAATATGTAGTGCCATCCAGTTATTTCCTTATG
GGAACAGATGAATGTATTTGTGCCATTACTTGAGCACAGCCCCTTCACGG
TTTCACCTAAGGGAATACATCTTTTTGTGCCATCTTGTTTTGTAGCCTAT
CAATGCCAATCTCCTGAAGCTGCTCTTTCCAGTGGCATTGTGCCATGGTA
TTGGTCACGTCACTAGCAATGTGTCCTTCGCTGCTGTTGCAGTCTCATTT
GCCCACACTATCAAAGGTACTTCTTTTCCTCCCATTTATATTTCAATGTG
GATTCTTCTTGCCCCTGTCCTGTTCACTCATGTTTCTATGCTACATACTT
GCAATGCAGCTCTGGAGCCCTTCTTCAGCGCAGCTGCTACTCAGTTTATC
CTTGGGCAGCAAGTTCCCCTCTCTCTGTGGATGTCTCTTG
View all "lga1" genotypes
HD-043   bicolor, NULL Swaziland   lga10 CTACGATGAGTGTCAGAGGAAGTATGGCAACGCCAATGCATGGCGGTACT
GCACTGATGTATTTGATTACCTTACACTATCAGCAATCATTAATGGCCAA
GTAAGTTCCACTAGGGAAAAAATTACAGGTTCTCATTTCATGTTATTTCG
GCAAGTCATACTTAAATTATATGCTGAATTCAGGTCCTCTGTGTTCATGG
TGGTCTTTCTCCCGATGTACGTACTATTGATCAGGTCTGTGA-----CTT
CTGTAACTTTCTTATAACCATCTGTGAACACATCTGTTTATGAACCCTTA
AGTATGACCCTTCCCATTTTATGGGATTCTGAGTTTCATGTCTTTTAGGT
TTGCCA--TACTTGGTGAATACATAAGTAGAAATATTTTTCACATGGACT
ATAAAGGATATGCATAGCCTTAAGAATTACATCTATTTGAAAACTTCACC
ATTATCAGTGATATAAATAAAATGCTTCAGTGGATATATGCTGGAAGTTT
GGAAATTTTGAATATTAAACAGCAGAAATGTTGTTTTCAGTTATTTTGTT
TTTTCTGTTCTTATTTTCAGCTGGTTGTGCTAACTGTACTTTTTT-GGAC
GTGTTTCTGATAGAATTTCCTTTGGTAATAAGAATGCTTATCATCAATGA
ACTAGCATTGCTGACTCATTTTGTGAAGAATATTGAGCACGTGATTCTGG
GGTTGATTTGGTCCTTAGAATTTCTTACTCATTTCTTGAAGAATAGTAGT
GCATGATTATGTGGTTGATTTTTATTTTGACTACATATTTCAATGAGATT
GAAGCTTTGATTACCTTTTCACCAGATACGAACGATTGATCGCAAT
View all "lga10" genotypes
HD-043   bicolor, NULL Swaziland   lga101 CCTCTGGAGCTTTTGTTCCCAGGCCTATGCTTGAGGTCATCTCTCTCCAC
TAACACTTGTGTTTGGAATCACTATCCAATATTTCCTAATATTGCATTGT
CATTCCAGAGAATTTCAGATCTGTGCAAAAATGCTGGTGCATGGCTTGTG
GTTGACAATACCTATGAGTAAGTCAATACTGTAAAGTGATCATTTTCACA
AGCAATTATATAATCTTTTGTGGTATCTGTTAGAGAGAACTTAGAAGAGC
CGGGGAATTATGGTTGTAGTCAAAGGGACAGATCATATAAGCCATTAGAG
CTCTTCTGCCTCCTCTTGAATCTGTGTCCAGATGAAAGACACTCTGATGG
CATATAGGATTTCTAG--TATCTTTGCAGTTTCCACAAGGAAGGGAAAAT
CAGAATATTGTGCCCATAGGAGATTCAGAAAGTAGTCGTCCTGCACAGAT
ATGTTGTGTGAGAATATGTCGAATACAGTTATCCTGTGTTTGTTTTTTTG
GTTTAGGATAAGTTCTCTTATTCAAATTCATTCCAGCTGCCAAGCCTTTA
TAAATACGTTTTAGGCTCTAAACTTGGTGATGTTAAAAATAAGCCCTCCA
ATCACACTTACTGCTTTATACTTTATACAGGCCAGGGTTTATGTTTGCCT
GAAAGAGTCAGGTGTTCAGGTCCATGTTGAGGAACTAATAGTAATTAATA
AAGGACC-TTTTCCCTCTAAGCTTAAAGAAACATACAAGTTTTTGTCGTG
GAGCTGCGATTAGCCAACCATATTTGAAGTG
View all "lga101" genotypes
HD-043   bicolor, NULL Swaziland   lga102 GATGCATGGCAATGCAGTACTACTAGCATGTAATGTGAAGCTGCTGCAGC
TAGCATCTAGCAAGCTGACGCCAAAGGCCCAAATCAAAAACTCAAAATAA
AACTAGCATCAATCATAATTCAGAAATGAAGCTTATGTGCAAGGAAAGTA
AACACACTTTTCCCCTTTTTTTACAAATAGAGCTTATATTTGGGAATATA
AAAGGAATGGAGGGAGGGAGGGATGTTTTCCTTTTTCAGAAGTATTGTCA
GTATTTGCAAGTCTCAAGTCTGTAATCTGTACCAGCA----GCAGAGTTG
AATGTTTGGTAGTTTTGGTACCGTTGCTGAGGCTGTTATTTATTCTGCAT
AGTACTCGTAGCACACTAGTACCAGTGTCTTTCTTCAGTAAATTCCAGCT
GGTATATGTGTATCCTATACTGTAAATACAGTCAAAAGTCAGCTCTTGTT
TCCTGGGATCTGATCAGAGATTAGCAGATATAATGAGCCGTTAAACAACC
TAGCAAATGCCGTTATAATAACAGAACTACAGTAATAT----CCCCGTGG
TCTCTCTCTGGAGGTGCATAAAAGCGCTGGCAGACTTGCTGCACACCCTG
ACTGACCTGCCGTGC-----CCTGACCTCGCCGTTTTCTTCTCTGCCGAT
CCTTTCCTTGCTTGCTGCATCTCTGTCTCTCTGTCTCTCAATGGCAGCCA
TCACCAGCAAGGACAAGGAGGAGGGTCTCCAGCTGAAGCAAGGGGAGAGC
AAGGTGTTCTCGAAGCTGTTCACCAGGGAGAGCTCCGCCGCGGCGCCGTC
CTTCCGGGTGTA
View all "lga102" genotypes
HD-043   bicolor, NULL Swaziland   lga103 AGCGGGTGCTGCTGCTCCTGGCTTCCAAGGCTACACAGGCTTCAACCACC
CGTCCTATGCTGCTGCCGGCTATGGAGGTCTTCAGCAACAGCATCTCCAG
CAGCAGCAGAGCAACAACCTCATGGCGAGCATGCAGGGGTACCATCATCA
TCCTGCAGCGACGGCCGCGATGATGAACAATTTGAGGGGTCTGAATAGCA
ACATGATGATGATGCATCAGCCCCAGCAGCAGCCGCAGATGATGTACCAC
TCCTCTCCCCAGATCAGCCCTTACACTGGCTACTACAACCCTTACAATTA
CTACTACCATCCCCATCCTGGCAGTGCTGGTTACCCAGCCAGCAATGGGG
ATGTGGAGACCATGTTCAGTGATGAGAACACCAAGGGCTGTGTTGTCATG
TAGGGATGCAGCTACAATCCTATAATCTAGAGGTTGGTGATGGACCATGG
TAATGGTGATGCAGTCCTGCTACCC-TTTTTTTGTTTCTTTTTTGTTTCC
TTTAATTATTTTACTGCTCTTATGGTTTCGCCTGTATCAAGAGTGAATCA
TGGTGTTGACTTAGATGTGTTGTTGAAAGTAGGGGCAACTTGAGAGGGTT
ATCAAACAGTGTAATGTAATACCTTTTAGGCTTTTACTGCCTAGTGCTTT
GCCCTGACTGGCTTGTTATAATTTGTATATTGTATATCTGGGTGTTTGTG
GCTTTGGACTTGTATGCTGTGCCATG--------TTATTAGTGCTGCTCA
TGACCGAGACTAACAGTGGAGGGGGTGAACAACTGTTAGCAGTCAACATT
GGGGGTGATGCATT
View all "lga103" genotypes
HD-043   bicolor, NULL Swaziland   lga104 TAGCATGTGCATCAGATGTGCAAGGTTCCCTTTTTGGATGCATTGATTTC
ACTTCAGTTTGTGATATCCAACAATATTTTAGTCTTAATTCATGTGCCAC
GTTGCTTGTGGGAATGCACAACCAAGAGATTTCAACTGTACTTGCCAATT
AACCAACATAATGATATCATGCATCATGAAGTTTCTTAGGGTAACAAGTA
TGGTGGGAATTTCGCATTTTGTGCTATGGACTTTGAATGGTACTCCCT--
-----AAATTATAAGTCATTCTAACTTTATTATGTATCTAGACATGATGA
GGATCTTAGATCAGCCTTTTGTTTCTGGCTAGACGCTTAGAGTTAATGTC
TGTTGTAAGTTTGTACTGTCTTTTTCTATAAAATTATAAATTGAAGTGCT
GTGGGGATCTCCGCCA
View all "lga104" genotypes
HD-043   bicolor, NULL Swaziland   lga105 TTCCACACGCACGC---AATCTTTATACCCCAGTCAATCATTCATCAGTC
ATCATCAAACGAGAACAGCGGCCCATACAGAG-TTTTCTGTTTATGCTTG
AGCGGCGGTTTAAGGCAAATCACGTGGCAC----TGCCGTTTTACACAGT
TGAATTTTGTTACTCCGTAGTATATACTCCTATAGTATACGTTAGTTGAA
TTGTTGTAATTTGAGACCGAACCGTCCAGCCATCCAAACTCCCTACAATA
TTAATTAGTGCCCTCGATCGATCGAGCCCTTGAAATAAAGGTAGCACACT
TCCATCTTCACTCTCACTCACTCACTC----TCACA--TGCACCATACCT
GACTTAGCCACCATGCATACACGCAAGACAATGGCCAAGCTCCTCAGCCT
CAAGACTTGGTACCAGCTCTTTGTGGACAACTTCCTCGCCATAGTCGCGG
TGGCATTTGTCGCCGCCGCGCTCCGGAGGGCATGGCCAGTCAGCGTCGAC
GATCTCGCCGGCAGCCTCCGCGCCGTGCCGCCAGTCCGCATCCTCACGGC
GGTCATCCTGACTGCTGGCGTTGCACAGCTGAGGCGATTGCGCCGGCCGC
GGGACGTGTACCTCGTGGAGTACGGCTGCTTCCGGCCCAAGCCCTGCTTC
CGGGCGCCGTTCGCCACGTGCCTGGAGCACGCCTTCTACCTGCCGTACCA
GGTCGACCCGGAGAGCGTCACCTTCTCGATCCGGCTGCTGGAGCGCTCGG
GGCTCGGCGAGGAGACGTCCCTGCCCATCTCGTACCACTACATTCCACCG
GA
View all "lga105" genotypes
HD-043   bicolor, NULL Swaziland   lga106 GGAAAGGTGTTTTTT-ATATTTATATAAATGATAGGACTTTTAAAAGTAT
TCACTTTTTTATGTGACAACATCCGCTTGAATGATTGGCTGTCAAACATC
AAATTATTGGCATGATCTTGCCATAGAGTTTGGTCTCTGTTTTTTAGAAT
GATCTTTTTGCACTTA----GATGATATATGGTATTACATGGTTCCTTAA
TTGACGAGATGAACTA----------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
-------------------------TTTAGGTACCATGAGTATCTAGATG
CACCACTGATTTGGTGATTTGCATAAAACAGCCATACA----------GA
ATCATAGACATTGCCACACATTTAAAGATAGCCAAAGATTTTGGTCTTGA
TGATTAGCTAAAAAATAACTTATTTTTCACCCTGATATCTGAAAACTTTG
CCCTAACCATTATTTAGTAGCCATTAGGCTTAGGCCAACGAATACCGATT
TTAAGTTTTTGTGGTCACTGGTTGTGAATATAACAT--------------
-----------TGCTTCAACTATTTGCATATTTCAATTCCATAGAATAAA
AATCATTTACCTATCAGAAGGATATTAACTAACACCAGGAATGATCAACC
ATGCTCCTAGAGTTAGC
View all "lga106" genotypes
HD-043   bicolor, NULL Swaziland   lga107 CGTTACGAGACGCAATGTCCGCGTGACCGCAGAGGTGCCGACGCGTCGTC
GACCGAGGTGGCGGGGTGCCGTGTAGCAGAGCAGGACTGCCCGCCGGGCG
TCTTGGGCAGAAGATAGAGATCTGAGAAGCCGTCGGCCCGTCGCCCTCCC
TCTCAACTCCGCTCCTCTCTCTGTTCCCAACTTCCCATCGCCGCATTCTT
CGCCTCCCACCACAGCAGCTTGAGCTCCTCACCGCCGCCCCTCCCTCCAC
TTCCACCGCTGTCCTTGCCCTCCTCGTTACCGTCAGGGTGGACGCATCCT
GGATCTGGCGAGCGCGTCTTCCTTGCGCACTTGATGACCGGCGTCGGCGC
CCTCCAAGCAGCTCCGATTTGACGAGACCGTCGACGCCGGTCGAACCAAG
ACGGAGACAGGCCATCAATACCCAGTAGAATAGCAAGGCTGGGCGGCTGG
CGGCGTCCAGGTTTCCAGAGTTCCAGCTGAGGGGGAGATAGACCGGCGCG
GCAGCCAAGTCGGACGGAGCTCGGCTGTCCGGAGAAGCGCACGCACGACG
GGGCACGCCAGGGATCTGCAGCCGCGGTCTCTCATACCAGTGATCAGGCT
TAATCTGGGTGGGGAAAGTTTGGAAAGATCAATTCGGTGAAGAAGCACGA
TTCAACAGGGAGGAGCTTCAATCTGGTGGGCAGAATTTCGAAAT
View all "lga107" genotypes
HD-043   bicolor, NULL Swaziland   lga109 GAGGGACCTAATGACATCCCTTGCCAACTCCCGCCCATGAATTTTTTTTC
CTCTTCGCATAAATACATGTCGCCTGATTCCCGATCTAATTTTTGCTGGG
CAAACAGT-ATCGATCGTTCC--------------TGCAGAGCACTAGAT
TCCGTGCACA------------ATCGACAAAGGCGTGTATGCATTGCAGG
CTAGGCGCGACTGAAATGGGGCCGCGGTTTCGCCATCTTTTAGCTCGTTT
TTTTCTTGGCACGCGCGCTCGAGTGTGTCCGTATCCTTTCCTCGG-ATAT
CCAGCACGACTCTCCCACTACCATATCGTCGCTCTCGACGAGACCGAGAC
AGCGACGGAAGAGGAGAGCGGCGGGCGAGACGAGAGACCAGGAGGAAGAA
GATGGCCACCTATTTCACGCTCAACACCGGGGCTCGCATCCCCTCGGTAG
GGCTCGGCACCTACAAGGCCGGCCCCGGCGTCGTCGCCGACGCAGTCACC
GCCGCCGTCAAGGTCTTCGCCGTTTGCCCCTCCCTCGAGCACTTCTTGTT
CTGAGTTTTACATCCGTATATGTTCTGTGCCCGTGTACTACCTGTACATG
CGTGCTGCTTAATCCTGCTTTCTTGCTTGCTTGTCATGGCAGGCCGGGTA
CCGGCACATCGACTGCGCGCCGCTATACAAGAACGAGAAGGAGGTAGCCT
TAACCCAGTCCCTGCAATTAGTATCTTCGATTCACATTTGCGATGGCACT
TTGGTTATAGTTGCCCTTAACGCGTATCCTAGATTGGCGTTGCTCTGAAC
AAGCTCTTCGATGACGGCGTCGTCAAGCGAGAAGACCTTTTCATCACCTC
AAAGA
View all "lga109" genotypes
HD-043   bicolor, NULL Swaziland   lga110 ACCATTTCTCAATCCGTCTTGAAGGGTCAGCCGCGTGGCTGCTCTCGTGT
TGGTGATCGCGACACGCGAACCGATGCCCCGGCTGTTCTACGCAGCCGAT
CATACTGCGCGGCGCCATCCAAGTCCGTCACAACTTGGTAGATCCGGGTG
CCTTGTTGCGTTCTTTCTTAATACATGTCGATGGTTGTTCGACTAGCTGA
TGAACTCCCACGTCCTTGTGTCCTCGAGCTGCTAATTTCTCTTGTGTTTT
AAAATAATGGAAATTACATCTGTGTTGTGGTTTCTGCAGATGGAGGAGGC
TATGCTGTCGATCTTACTGTTGTTGAGCCTGCCTTGAATGTTGGTCCTGT
TAATCCGGCTGTACAGGTAGAGCATGGAGAGAATTTGGCAGTGCCAGGCG
ATACCCGTGTTAATTCTGTCGAAAATGCTGTGCTTTCAGAGGACACACTG
GTGCAAGCAGATCAGTTGTGCTCCAATGATGAGGTGCTGAGTGAGAACAC
AGAAGCTCTTACCAAAGACAGTCAGGTTGAGCTTTCAGGAGATCAGGGTG
GGTATCTTCCTCAGTCGGATGTTGATTCTGGAGTTCAGCCAGGGGAGAAG
GTGGAGAGTGAAGATTTGCCAAGACCACCAAGACTATCACGGGTTGCTCC
TCCTGATCTTGATGAATTCAAGACAAGAGCAATTGCTGAAAGGGGACCTG
GTGTTTCTAGTCAACCTGGTCATGTCATCCACCGAAGGGAGCCTAGTGGG
AAGTTGTATAATTATGCAGCAGCATCTAAA
View all "lga110" genotypes
HD-043   bicolor, NULL Swaziland   lga111 ACTTGCTCTTTAATGGATATATCAAAGTATCTTTACAGATGAAGTGAACT
ATGCCTAGTGTTGTTGTGTTGGAAACTGTGTCAGTTTATAGTGGTATGTT
GTCCTGCCTTCATTGGTATAATGCCTTTCTATGTCTGTACTAGATGACAT
GTTCTATGACTGAAGATGGCCTTTCCGAAAGTCTTCAAGAGATGGATTTT
TCAGGTATACCTTCCATCATTACTGCTAGACTTTTGGTGTTAGGATGGGT
GTGTTCTTTTCCATTCCTAATTATAGTGGTAATTCAGGTACCGACTGTTT
GCTGAACTCGGATGGGATTGATGAACTGCCAGAAGAATGGCTAGTTGATT
GCTCACAAGATAT---ACCTTGTTTACCTGCAGAAGAAATGTATGTGTTT
CATTCCAATATTCATAAGCGCTTGGATTTTTTAGTTGTTGAGTTCACTGT
CATTGAAGATGAAGTATTACTACTTATGGTATCT-AAACCTTCTTAGTAG
GAATAGCCCTGCTGCTGCCACGGAAAAAGCTGTCGATATCTCTGGTTGGT
ACAAACCTCTCATGAGATTTCATCCTTGCC--TTATAGCAGAATTCTAAG
TTGCTGATAGATGAATGCTATGCTTATTTTTCAGTGCATTCGAATTCTTC
GCCTCGCCAACAGTCCATCGTAGTCCAGAACAATCTTGCACAAGCTAGAT
CTACACCACTGAAAGGTGTGCCCAACTCTTGTCCATGTTTGCTTAAAGAA
TCATGATTTTTATTCTCCTTCTCAAGAACAG
View all "lga111" genotypes
HD-043   bicolor, NULL Swaziland   lga13 ATCTCTTCTTGTGAGCATCTGTTTTCTGGTCATAGCGATTATGAGTGTGG
TTTGGTGTGACTACATAAGTGCATTTGGTTGCGTGATGCGCAGTTTTGTT
TGCGCTGGTGTGAAGTACACTACGTGATTTATTCGGATTTCGTCTCAGTA
TCCGCGTGAAGCTTATTGACGGTCCAGTGCTGATCAGATTCTACAACGTC
AGCGCTAAACATATTCATAAGCGACATTAATCCGTTGCTGCTGTGTAGCG
ATATCTTTCTTGATCCAGTTACTTGGATGTGGGAAGTTATGCGTGGTAGC
ATACACACCTTCATTCTTCTTTACGTTTCAAAGAGTCGCCTTTGTTTTTG
TAAAATTTTATTTGAAGTTCTGCGAAAGTCCTGATTTGAAGCCTTGAAGC
GACTGACATTTTAATCCATTTAAGAGTCAGCAATTAAGCTATTCAATTAC
TGCAGGTGTAGTGGTCGTTATT-TTTTGTTTTCTCAAGCATTTTAGATGA
ATATTCTAGTATACATTAAGGTGACGAAAAATTTATTAGAACTAGGTAGA
CTGTATTTAAGTGTGTCAGTAGTTTCGACTTCAATCTAGACGCAATTATC
TGTTTTGTTTATGTAATGTCCAACTGTCACTTGGTTCACATTGTATACTA
GATAAATTTCTGATAGAGATTTCATTGATTATATCTAGCTGCTCTTTTCT
AACTGTTGTGGTATTGATGCTTTCTTTCTAACACTTTGTTAAAAAGGCTT
TGGGTTCAATGCATTTGTCAAGTTTAATGTGGTAGTCTATCACATTTT
View all "lga13" genotypes
HD-043   bicolor, NULL Swaziland   lga14 GGTGACATGCTATACGCCACTAC------------TATAGACATCTTGTC
CAATTTCTGCTATTATTTTCTTTTTTTCAACATCACGTTACCCTCATTCC
AGTCACTCTTTGCCTGCAGCAAATAATGCAAGTGCAATACAAGATACCAG
ATTATGTCCACATATCTACGGAATGCCAGCAACTTCTTGCCCGTATCTTT
GTTGCCAATCCAATGAGGGTAATGATTTCAACCTGTAAATTACAGTCATG
ACTTGTCGTGATACACGTGGGATAGTGTAAAACTTGGTAATTTGAAACAT
TGATGCAGTATTTTTATGAATATTCTCCAGAGAATCACAATGAAGGAAAT
AAAGAGCCATCCATGGTTTTTGAAGAACCTACCACGGGAACTCACGGAGA
CTGCACAAGGCATGTACTACAGGAGGGATAACAGGGTGCCTTCTTACTCA
GACCAATCGTCGGAAGAAATCATGAAGATAGTTCAAGATGCAAGGACCAT
GCCGAAATCATCCAGATCAGGCTATGGGTGGAGCACTGAGTATTCGGATG
AAGAAGAAGAGAAGGAAGAGGAACACAGGCCAGAGGAGCATGAGGAACAG
GAAGATGAATACGATAGGAGGGTGAAGGAAGTCCATGCAAGCGGAGAACT
CCGTTTGGACGCTCTTCACATATGAAAGCAAGTGGAAGAAAGTTACGTGT
ACATAACTGGGTTGCGGATCTGAAGGATCCAGTGGGATGTATGCAATTTT
GGCTTCA
View all "lga14" genotypes
HD-043   bicolor, NULL Swaziland   lga15 AATGTGCAATA-----ATATGCAGGGGCATGGCGGTTGCCGATGCATCGA
GCCCGTACAAGGTGAAGCTGCTGGTGGAGGACTACCCATACGCGTCGGAC
GGGCTGGCAATCTGGCACGCGATCGAGCAGTGGGTGACGGAGTACCTGGG
CATCTACTACCCCAACGACGGCGTGCTGCAGGCGGACGTGGAGCTGCAGG
CATGGTGGAAGGAGGTGCGCGAGGTCGGGCACGCCGACCTCAAGGACGAG
CCATGGTGGCCCAAGATGGAGACGGTGGCGGAGCTCGTCAAGGCCTGCAC
CACCATCATCTGGATCGCGTCGGCGCTCCACGCCGCCGTCAACTTCGGGC
AGTACCCGTACGCCGGGTACATTCCCAACCGTCCGTCGGTCAGCCGGAAG
CCGATGCCGGCGCCGGGCAGCGAGGAGTACGCGGAGCTGGGGAAGAACCC
GGAGAAGGTGTTCGTGCGCACCATCACGAGCCAGTTCCAGACACTCGTCG
GCATCTCGCTGCTGGAGATCCTGTCCAGCCACTCCTCCGACGAGGTGTAC
CTCGGCCAGCGCGACACGCCGGAGTGGACGTCGGACGCCAAGGCGCAGGA
GGCGTTCCGGCGGTTCGGGGCGCGGCTGACCGAGATCGAGAGCCGCGTGA
TGACCATGAACGCCGACCCAAGTCTCAAGAACCGCAACGGGCCGGCCAAG
TTCCCCTACACGCTGCTCTACCCCAACACCTCCGACAAGAATGGCGATGC
CGCCGGCATCACCGCCAAGGGCATTCCAAACAGCATCTCCATCTGAGTTC
TGAGTTCTGA
View all "lga15" genotypes
HD-043   bicolor, NULL Swaziland   lga16 GCGCCGGCCCGTCGCGCCGGTCGAGTACCCCATGCACCCCTCACACCTCG
TCTACGAGAAGATTGTGCTCGTCGGGGTCAAGGACGACGTCGCGGTTGCC
GATTCCGCCGGGAACAAGTAGATGCTACCACCACCACCA---CCGAAACC
ACGCCTTCTGTTCTGCTGGTAACATCATCCAAGCAAGTAGATGCTATGCT
GCCTTTCAAC-TTTTTTTCTTGCTGTA-TTTTTTTTCCACTTCACTAGTT
CACTTCTGCTGCATTTGAAATCGTGTTGTAATTACTAGTACTAGTAAAGT
AGTAAGTACCATCAGCCCACCGTGGTGGAAACTGCAGATTTTGCCTCCCA
AACACAATCGGGCAAACTCTGCACTTTCCACCCAAATTACCTCCAATTAG
CTAGCCAGAAGAGTGCTTCTTTTTGTTTTTGTGATCTTTGTCCCTATTCA
AATTGTATCACCGTTGGTACTGATGTATTTCCTTTCTTGCACTGATGCTG
CTTAGTAATTTGCTTCTGTACTTGCTAGTTGTGTTTCACTTATCTGCTCT
AACAGACAAAACTGATCTTTCTTTTGCTTGCATATAAATGCATACTAATC
TTCACCATATATTGGTTCAATCGCCAATTCACCA
View all "lga16" genotypes
HD-043   bicolor, NULL Swaziland   lga17 GCGCTTCCCTGCACAGGTACACCACACCTATCTGCTTCAATCCCGTCCCT
CTCTAGTCATGGCGGATGATCGATCAGCTCAGCCCGCACCAGTAGCGTGA
ATTTTACTGCACTTGTTTGAATTGTTCAACATCAATACTAGATCACCGAC
AGACAAAAAGGCTAGCGGTAGCAACCCATTCCCATTCATTCACACCACAT
GTTGCGAGCTGCGACGACGTGTGGAATCGCGTTAGATTTTT---------
------------AGAAACTTA-----------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
---------TTTAAAATTTGTCTACAAACAAGCAATTGGTTAGTTTAGGT
GGAGCGATGGGCCTGTCTGGGGATTAGTCAGCAGAGAG------GTTTGG
TCAGCTTTGC------------TTTTCGTC-TAGTAGGTTGCTTGGTCAG
TCGGCAGAGGATCTGGTCGCAGGCTGGAAAGTGCATGCGTCAGAGCATCT
AGACGCTGCAACTGCAAGCGGTGTCACCTGTAGAGCTGTATAGCCTGATC
TCACAT--------TTGATCATCTCATC---CAGAGGAGTGAAGTTTGTT
TGTTGTTGCCCCAGTGGTTTTCCGAGGTGACTCATGGTTGTGATGTGCAG
GTGCGGGTAGCAACGCGGAAGATCTACGACCCCCTGGAGGAGGACGCCTT
CCGCCCCATCCTCCACCACTACGACGGGCCCAAGTTCCGGCTCGAGCTCT
CCGTCAC
View all "lga17" genotypes
HD-043   bicolor, NULL Swaziland   lga2 TTTTTTGGCAGTGTCATGTTTTGTAAGGGCAACTACGTGTGTGCTCAAAA
GAACCCAAGATGTACACGCAAAGGAGATGTAGTCTGCTGATGCAGCATTG
TAAAGTCCACACTCTGCAGGTTAACCCTTTTTTGGGGCCGTCAAGTGTTA
GCGCCCTATGTATGTTATCAACCCTGCAGAGAGGTTGCAAATACGGAACC
ACTCTCACAAACTTGCACCTGTCGAGATCATTTTGTAATCTACTACATCT
TTGTTCAGAATTGTTTTTTTTTT------CACCCGTTGTGTAGTTTACCC
TGAAGGGACTTTCGTTTCTCTTGAAGTACGTGCTTCGGCACGATCGTGAA
TAAAACTGTTAGCATCAGTCAGCTGCCTGTTGAGCAGTAAGAGAAAATAC
AAAGAGGTATGCAAGCCTAGGCTTACATGAGCGCAACACCATTTTACATT
CAATGTGCTTCGTCTTCAACAGATGGTTGGTCTGAAAATCCTTGCATTTC
GCTCTTTCATGGTATCCAACTGATGCTAACTGTCGGTCTGAATCGGGCCT
CTGCTCTGATT-CTCAACTGGGGCAGCTCAGGTCAGGGAAACTGGAGATG
GCGTCAGGTGCTCAAAAGCGAAATGTGTCACGCGCGTCTATGAAGAAGCA
CATTGGATCAAAGAGCTATTTATTTATGCCAAGCAAGCGAGATGATTCAG
ATGTATCCAAATGGCCGGTCCGAAATGCAGAAGATGATGAGTAAATATGG
TTTGGGAAACCACTTCTATGCCAAGCAT
View all "lga2" genotypes
HD-043   bicolor, NULL Swaziland   lga20 TATTTCTGAATGCTTGTCAGGCCAAACAGATTTATAGATCCATCAGATAA
CATGTGGAGATTGCAATTCAATGGACTCCAATTGGACGTATTGCTTCTAC
ACTTGCAATGTCACTCCATTCACAGCTGTACCTTCTACATTTTCCATGAC
CCTCCAGTCAGCTCTACGTCGTGGGTCAAATTTCTGATTGTCATTTTAGG
TCCATACTTTTTCAGAGCATCAGGACGACACCAAAATGGCAATGGCACGA
ACCAACTGTCATTAATAATATAGCCACAATACAACGTCATACACAAATTT
ATACGAAACATTGAACTTATAATAACTGATGCACCAAATTACCGATTAAT
CTTGACACTGTGATCTCCATCTATAGTCCAGTCAAGCTTATTAGATGCAT
AATCATCATGGCCAGCTTCATCAACAGTCCTATTAAACACGCCAAAGAAT
ACAGTAAATTGTTTTTTTAAGGATATAGTAAATTGCTTATTATGCTTTAC
TGACGCCGCTTCTCGCACAACTCCTGTACGTCATTGAAACCTGAATACAC
CGCATGACAAGCACCTGAATACCCGAACATACC-TTTTTTTTCTCAAAAT
GACCCAGGAC
View all "lga20" genotypes
HD-043   bicolor, NULL Swaziland   lga5 TTTTGTTGGCACTTGTCAT--------------------GTACTGAAAAG
TCTTGACACGGCATACG-----------------TTCTGGTAGGGAACAT
GACAAAGATCGATCTCTGGTCACTCGTCTGCTCCCCCTACCTGCACGTTG
TATCATGTAAATCCACAGTATATATGCTGCTGTGTATTGTTATACATGTA
TGTATGTAGC--TAGTACTCCTGTGAGAGCACGCATGCGCACGTACTGAC
TGTGTTTGCCTGGTACGTGACGATGGAT--GCAGGCACGCCGAGGGCGGG
TTCGAGGCGGCGGCCGGCGCCGGAGCTGAGAACGACGGGTGCAAGTGCGG
CCCCAACTGCAGCTGCAACCCCTGCACCTGCAAGTGAG
View all "lga5" genotypes
HD-043   bicolor, NULL Swaziland   lga6 ATGTCTCTCTTGACGCTCGAAATTTCATCTAGCTACTAGCTAGGACGCTG
TTCGTG--TATATATATAGTTCAATCTTCGTGTATGTATATATGCGTGGG
TGTCTG---ACGACGAACTGACCGATTCTGAATGCAACA---AAATACGC
ATTGCTG--CCGCACGCAGGGCCGAAGAAGGCGTGCTGCAAAGAGTGCAC
CAGCTGGTCGGGTGTCTACACCTGCGACGACCTCCTGACCAAGTGCGCCG
CCACCTGCAAGCAATGCGTCCCCGTGTCCACGGACAAGGGCACCCGCTAC
AGGTGCCGCGACTTCCTCCCCGAAGGCTGCCCCTGCAAGACCAACTGATC
CATCCATCCATCCACACCACGCATGCATGGCCACAGCCGATGGAT
View all "lga6" genotypes
HD-043   bicolor, NULL Swaziland   lga7 CCGGAGTGATTCGTTGCAAGCGCGATCTGGATTGGGTGTGGAGAGTATGT
TTTGCTTTACGAATTGGGATCAGTTTTTAATCACTAGTAGCCAATCTGGC
CCTGAAATTGTTCCTAGGTACTCCGAGCTACGTACTGTGGGCTGTTTTCT
TATTTCAGCTATCAAATCTGTCTCTGAGATGGCGATAAATCAGAATTATT
GACCTTCCTGTTGTGACTACCTGAATACCTTAGGCAGTGGTGAACTGGTG
ATTACTCAGCAGTCACCAGTGTTGCTTCATGAACTCAAGTCTTCCGCATA
CTGCGCCGCTGCCGCCTCATTTGACTTACACATGAGTCATGTGCACAATT
AGATCTTGTTGCCCCTGAGAATCACTTAGGATCAGTTTAATGGCATTGGC
ATTGGTTGCAGTTTACTATTAGAACAAACAAAATGAATATGAAAGTTTAG
ATTTTTTTTT
View all "lga7" genotypes
HD-043   bicolor, NULL Swaziland   lga8 GATAATGGAGGTCCATACCCTGGTGGCTACCCAGCAAGTAATGTTCCTCT
AAATTATATATGTAGCTTAGCATTTCCTAAAACTATTATCCATATTCATA
TTATCAGCCTCATAACCAAACTATTATCGCAGTAGCTGACTGTAAAATTT
ACCTGAATTATTATCAACCTTCAGGGGATGATGCTTATCGCACTGCTGAT
CCAACTCCCAGGGGTGCTCAACCTTTGAAAGTGCAGCCAATTGCTGTCCC
CACTATTCCTGTAGAAGAAATTAGAGAGGTCACAAAGGCTTTTGGCGATG
AAGCTTTGATTGGCGAGGGGTCTTTTGGCAGAGTATATTTTGGTGTACTA
GAAAATGGTAGGAGTGCTGCGATAAAAAAGTTAGATTCAAGCAAGCAGCC
AGAGCAAGAGTTTTTAGCACAGGTGTGCATTGATTTTATCAATGAATTGT
GCATCTTTGCTAGTCTTTCTTCTTATAAAATATATCTCTACACCTGCAGG
TCTCCATGGTGTCAAGGCTTAAGCATGACAATGTCGTAGAGTTGCTTGGT
TACTGTGTTGATGGGAACACCCGCATCCTTGCTTATGAATTTGCTACTAT
GGGTTCTCTTCACGATATGCTTCATGGTATTACTCTGTTTACTTCTAAAA
TCTAGTGTTCTAATAACTTTGAAATATATTATTCTCTTTAACTTCTTTCC
GGATAGCTGATGAGTTTGAATTTGAACTCCACAGGACGCAAAGGTGTGAA
AGGAGCTCAGCCTGGTCCAGTC
View all "lga8" genotypes
HD-043   bicolor, NULL Swaziland   lga9 TGAGCACAAATGGGAGATTCCCAACAAATGGCGGGAACAAATTTCTAATG
CGACAAAAATTGTGGAAGGAATTTAGGAATTTCGTCCGCTGCCCAATTTG
GTTTGTCAGTAGCATTATAGCCTTTGAATTTGCAGATGGCACATCACATC
AATTTTGCTTGCACCAAAATCTTGAATAGTTGGAGTAACTTCTTATCTTA
GACCAAGTTTATCAGTGATCCACCTCAGATGCATTTCCTTTATGGAAGGC
TAGCTTAACTGTTTGTAAAGTCCTTTCTGATTCTGTTTTCTGACCGCGTG
GTTCTGCAAAAAGAATAAACAGTGAATCATGCGGTTACAGAGGGAACCAA
GCCACTGCAAAATCAAGAAAACCAAGTGAAATGATTACTAAACTTTGCTG
GATCTCGATAGTATAAGGATTGGTAGGAAAGATACAGCTACAAACATGCA
GGGCGCGGCCTTTGAAATATACTCTGTAATAATGGCTGACTATGAACTAA
AGAAAATAAATTTCTGAACTGGTGTTACTTATCTACAGCGTGTTTGAGGT
TACTCCTAACTGAACAAAGCTAAAATTTCCAAAAGCAT--GACGGTGGCA
TCCCCATTCAAAAATTAGTGGCACACAAGAAACTTGTCTCCGATTTGGAC
CAGTCGTCATCCTGGATTCCTGGTTGGTTAAAGAGCAAAGGAAACTAGAA
ACAAGAAATTGTCGTGTACCTTGAGAATAGGATGAATGCTTAACTTGCAG
AAATAAACTAGGCACGCTTGTTCAATATTCAGATGTTTGCTCCAGCTTCA
CTTCCACCCTTCTCAGAGGATGCAG
View all "lga9" genotypes
[ Download ]