grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "A-7171" from the experiment "Hamblin, Casa, et al. (2006) Challenges of Detecting Directional Selection After a Bottleneck: Lessons From Sorghum bicolor. Genetics 173: 953-964.".

E.g., Germplasm L-WA58, Marker/locus pSB0080.

Items 1 to 2 of 2.

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
A-7171   arundinaceum, NULL South Africa   lga16 GCGCCGGCCCGTCGCGCCGGTCGAGTACCCCATGCACCCCTCACACCTCG
TCTACGAGAAGATTGTGCTCGTCGGGGTCAAGGACGACGTCGCGGTTGCC
GATTCCGCCGGGAACAAGTAGATGCTACCACCACCACCA---CCGAAACC
ACGCCTTCTGTTCTGCTGGTAACATCATCCAAGCAAGTAGATGCTATGCT
GCCTTTCAAC-TTTTTTTCTTGCTGTA-TTTTTTTTCCACTTCACTAGTT
CACTTCTGCTGCATTTGAAATCGTGTTGTAATTACTAGTACTAGTAAAGT
AGTAAGTACCATCAGCCCACCGTGGTGGAAACTGCAGATTTTGCCTCCCA
AACACAATCGGGCAAACTCTGCACTTTCCACCCAAATTACCTCCAATTAG
CTAGCCAGAAGAGTGCTTCTTTTTGTTTTTGTGATCTTTGTCCCTATTCA
AATTGTATCACCGTTGGTACTGATGTATTTCCTTTCTTGCACTGATGCTG
CTTAGTAATTTGCTTCTGTACTTGCTAGTTGTGTTTCACTTATCTGCTCT
AACAGACAAAACTGATCTTTCTTTTGCTTGCATATAAATGCATACTAATC
TTCACCATATATTGGTTCAATCGCCAATTCACCA
View all "lga16" genotypes
A-7171   arundinaceum, NULL South Africa   lgb4 AGATATGATGACTGGAGGTGTGGTTTTTGCCAGTATACACTGCATATAAC
CATACAAGCGATCATCGGATCATGGGAGTTCTCAAAAGGAAGATACAAAT
AGGATATTTCAATCTTAGGACAAGATGTTTCTTGAGGATAGCGAAGCATA
TTGGTGTGTGCATCTGATAGCAGCAAAGATCTATCAAGTGCACTGGATCT
TTGCTTTTGAATCCTAGTATTCGCTAGCTGGGAGCATCCAACACTCAATT
CTCTCTCTCTCTCTCCCAATCCCAACTTCCCAAGTGCTCTTGGAGCCGGT
GAGCCAAAAATTGCGTAAAGGTATGTCTTATTGTTTCAACTG---ATCAG
TAACATCAAAAGTTTACCCAATCACACAATACAGTGAAATGCGGGCGAAA
ACCATTTGAGCTCCCCTAA--CGCTTTCTTTTGTTTCATACTACTGC-TA
ATTGTGGTCGGGCCTAGCTGCGCGCCGCTAGGAGCTACTGCTTCATTATT
ATCCTCGCCTTTCTTCTTACAACAAACGCATGTCCACAACTCGCAGTGTC
CGTGATTGTAGCCCTTTCCATCGGCGCCCTGGCACTTGTTCACACATCTC
TTGTTCTTCACGCAGTAGTTGTCCCAGAGCCGGAAGCACTTCCATTTCGT
CTTGGTGTCGCCGGGATCGTCATCTCCCTCGCGTAGTGGTGATAGCTCTC
TTGCTGAATAGATCAGGATCACAAAAATCAATCAGCTCAGTCATTTCACA
TACCAGTTATTTGATT
View all "lgb4" genotypes
[ Download ]