grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "KFS1" from the experiment "Hamblin, Casa, et al. (2006) Challenges of Detecting Directional Selection After a Bottleneck: Lessons From Sorghum bicolor. Genetics 173: 953-964.".

E.g., Germplasm L-WA58, Marker/locus pSB0080.

Items 1 to 25 of 204.       of 9 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
KFS1   NULL South Africa   CSU784 GCCCTCTCCAATGCGCATGCGTGGGTCTTACGGTGTGTTGCATCGTTTCT
CGCTGTGGCGCAGGTGCGTACAAGTACGTCTCGGAGCTATGGAGGAGGAA
GCAGTCCGACGTGATGCGGTTCGTGCAGCGCGTGCGCTGCTGGGAGTACA
GGCAGCAGCCGGCCATCGTCCGCCTCACAAGGCCCACCCGCCCCGACAAG
GCCCGCCGCCTCGGCTACAAGGCCAAGCAGGTAGATCTCCCCTCTTGACC
CCATTGGCGCGTGCGACCTTGGCTATGGATTTGTGGGTAGGCGGAAGGTC
AGGGTGGTGCAGGGATTACCGTTTTCATTTAGGATTGTGATTTTTAAAAG
TGCTACAGTCGTATGCCTGTCTGCCTTAAAGTTTCCAGCCTTCCTGCAAG
CCAGGCCTGTGTAGTATTTCTGGTGATTATAGTGACAATCTTCCTGGACG
AAATGAAGGGCTGTTTAGGTTCCGGAGAGCTCGACCCTTATTCGATTTAC
CTTTTCCGAACGTTGTAGTATA-TTTGTTTCTGCTAATATAAGATGTTCA
AGTTTAGACTATGATTTTGGTATTACGAGGCCTGCTAATTCTGTAGGTTT
T--CCTCCTGTTGAGTCAGAATATATGCAGGTGCTGGATCTATTTGTTAT
ATTGTACT
View all "CSU784" genotypes
KFS1   NULL South Africa   lga1 TATCCATAGTAAGTAGGCAGCCCCTGATTCACAAGTCAGGACCAACGACA
TTCAGTTCTCTTGTTGCTTTCCCCTTTACCATCAAGTTGTAGTTTATGAT
GGAATACCATACCACTTGTTGCAGCTTTGTGTCCTTGATCCATCTAGTAG
TGGGTGTCGCATACTGCCTCGTCGGCTGGAGTGTCGGTCTCCCCAAGCGA
GCGGTAATTTGTACTGCAAACCTGCACATCCCCTCCCTCTTTAATTAAGG
ACTAGTACTTCCTGCAACTTGACCTCTTTGCCTAGTGAACAAAAGGGTTT
CTTTTATTATGTAATAAAAATATGTAGTGCCATCCAGTTATTTCCTTATG
GGAACAGATGAATGTATTTGTGCCATTACTTGAGCACAGCCCCTTCACGG
TTTCACCTAAGGGAATACATCTTTTTGTGCCATCTTGTTTTGTAGCCTAT
CAATGCCAATCTCCTGAAGCTGCTCTTTCCAGTGGCATTGTGCCATGGTA
TTGGTCACGTCACTAGCAATGTGTCCTTCGCTGCTGTTGCAGTCTCATTT
GCCCACACTATCAAAGGTACTTCTTTTCCTCCCATTTATATTTCAATGTG
GATTCTTCTTGCCCCTGTCCTGTTCACTCATGTTTCTATGCTACATACTT
GCAATGCAGCTCTGGAGCCCTTCTTCAGCGCAGCTGCTACTCAGTTTATC
CTTGGGCAGCAAGTTCCCCTCTCTCTGTGGATGTCTCTTG
View all "lga1" genotypes
KFS1   NULL South Africa   lga10 CTATGATGAGTGTCAGAGGAAGTATGGCAACGCCAATGCATGGCGGTACT
GCACTGATGTATTTGATTACCTTACGCTATCAGCAATCATTAATGGCCAA
GTAAGTTCCACTAGGGAAAAAATTACAGGTTCTCATTTCATGTTATTTCG
GCAAGTCATACTTAAATTATATGCTGAATTCAGGTCCTCTGTGTTCATGG
TGGTCTTTCTCCCGATGTACGTACTATTGATCAGGTCTGTGACTTCTCTT
CTGTAACTTTCTTATAACCATCTGTGAACACATCTGTTTATGAACCCTTA
AGTATGACCCTTCCCATTTTATGGGATTCTGAGTTTCATGTCTTTTAGGT
TTGCCA--TACTTGGTGAATACATAAGTAGAAATATTTTTCACATGGACT
ATAAAGGATATGCATAGCCTTAAGAATTACATCTATTTGAAAACTTCACC
ATTATCAGTGATATAAACAAAATGCTTCAGTGGATATATGCTGGAAGTTT
GGAAATTTTGAATATTAAACAGCAGAAATGTTGTTTTCAGTTATTTTGTT
TTTTCTGTTCTTATTTTCAGCTGGTTGTGCTAACTGTACTTTTTT-GGAC
ATGTTTCTGATAGAATTTCCTTTGGTAATAAGAATGCTTATCATCAATGA
ACTAGCATTGCTGACTCATTTTGTGAAGAATATTGAGCACGTGATTCTGG
GGTTGATTTGGTCCTTAGAATTTCTTACTCATTTCTTGAAGAATAGTAGT
GCATGATTATGTGGTTGATTTTTATTTTGACTAAATATTTCAATGAGATT
GAAGCTTTGATTACCTTTTCACCAGATACGAACGATTGATCGCAAT
View all "lga10" genotypes
KFS1   NULL South Africa   lga101 CCTCTGGAGCTTTTGTTCCCAGGCCTATGCTTGAGGTCATCTCTCTCCAC
TAACACTTGTGTTTGGAATCACTATCCAATATTTCCTAATATTGCATTGT
CATTCCAGAGAATTTCAGATCTGTGCAAAAATGCTGGTGCATGGCTTGTG
GTTGACAATACCTATGAGTAAGTCAATACTGTAAAGTGATAATTTTCACA
AGCAATTATATAATCTTTTGTGGTATCTGTTAGAGAGAACTTAGAAGAGC
CGGGGAGTTATGGTTGTAGTCAAAGGGACAGATCATATAAGCCATTAGAG
CTATGCTGCCTCCTCTTGAATCTGTGTCCAGATGAAAGACACTCTGATGG
CATATAGGATTTCTAGTATATCTTTGCAGTTTCCACAAGGAAGGGAAAAT
CAGAATATTGTGCCCATAGGAGATTCAGAAAGTAGTCGTCCTGCACAGAT
ATGTTGTGTCAGAATATGTCGAATACAGTTAACCTGTGTTTGGTTTTTTG
GTTTAGGATAAGTTCTCTTATTCAAACTCATTCCAGCTGCCAAGCCTTTA
GAAATACGTTTTAGGCTCTAAACTTGGTGATGTTAAAAATAAGCCCTCCA
ATCAC----ACTGCTTTATACTTTATACAGGCCAGGGTTTATGTTTGCCT
GAAAGAGTCAGGTGTTCAGGTCCATGTTGAGGAACTAATAGTAATTAATA
AAGGACCTTTTTCCCTCTAAGCTTAAAGAAACATACAAGTTTTTGTCATG
GAGCTGCCATTAGCCAACCATATTTGAAGTG
View all "lga101" genotypes
KFS1   NULL South Africa   lga102 GATGCATGGCAATGCAGTACTACTAGCATGTAATGTGAAGCTGC------
-AGCAGCTAGCAAGGTGACGCCAAAGGCCCAAATCAAAAACTCAAAATAA
AACTAGTATCAATCATAATTCAGAAATGACGCTTATGTGCAAGGAAAGTA
AACACACTTTCCCCCCTTTTTTACAAATAGAGCTTATATTTGGGAATATA
AAAGGAATGGAGGGAGGGAGGGATGTTTTCCTTTTTCAGAAGTATTGTCA
GTATTTGCAAGTCTCAAGTCTGTAATCTGTACCAGCAGCTAGCAGAGTTG
AATGTTTGGTAGTTTTGGTACCGTTGCTGAGGCTGTTATTTATTCTGCAT
AGTACTCGTAGCACACTAGTACCAGTGTCTTTCTTCAGTAAATTCCAGCT
GGTATATGTGTATCCTATACTGTAAATACAGTCAAAAGTCAGCTCTTGTT
TCCTGGGATCTGATCAGAGATTAGCAGATATAATGAGCCGTTAAACAACC
TAGCAAATGCCGTTATAATAACAGAACTACAGTAATAT----CCCCGTGG
TCTCTCTCTGGAGGTGCATAAAAGCGCTGGCAGACTTGCTGCACACCCTG
ACTGACCTGCCGTGC-----CCTGACCTCGCCGTTTTCTTCTCTGCCGAT
CCTTTCCTTGCTTGCTGCATCTCTGTCTCTCTGTCTCTCCATGGCAGCCA
TCACCAGCAAGGACAAGGAGGAGGGTCTCCAGCTGAAGCAAGGGGAGAGC
AAGGTGTTCTCGAAGCTGTTCACCAGGGAGAGCTCCGCCGCGGCGCCGTC
CTTCCGGGTGTA
View all "lga102" genotypes
KFS1   NULL South Africa   lga103 AGCGGGTGCTGCTGCTCCTGGCTTCCAAGGCTACACAGGCTTCAACCACC
CGTCCTATGCTGCTGCCGGCTATGGAGGTCTTCAGCAACAGCATCTCCAG
CAGCAGCAGAGCAACAACCTCATGGCGAGCATGCAGGGGTACCATCATCA
TCCTGCAGCGACGGCCGCGATGATGAACAATTTGAGGGGTCTGAACAGCA
ACATGATGCTGATGCATCAGCCCCAGCAGCAGCCGCAGATGATGTACCAC
TCCTCTCCCCAGATCAGCCCTTACACTGGCTACTACAACCCTTACAATTA
CTACTACCATCCCCATCCTGGCAGTGCTGGTTACCCAGCCAGCAATGGGG
ATGTGGAGACCATGTTCAGTGATGAGAACACCAAGGGCTGTGTTGTCATG
TAGGGATGCAGCTACAATCCTATAATCTAGAGGTTGGTGATGGACCATGG
TAATGGTGATGCAGTCCTGCTACCCTTTTTTTTGTTTCTTTTTTGTTTCC
TTTAATTATTTTACTGCTCTTATGGTTTCGCCTGTATCAAGAGTGGATCA
TGGTGTTGACTTAGATGTGTTGTTGAAAGTAGGGGCAACTTGAGAGGGTT
ATCAAACAGTGTAATGTAATACCTTTTAGGCTTTTACTGCCTAGTGCTTT
GCCCTGACTGGCTTGTTATAATTTGTATATTGTATATCTGGGTGTTTGTG
GCTTTGGACTTGTATGCTGTGCCATGTTAATATGTTATTAGTGCTGCTCA
TGACCTAGAATAACAGTGGAGGGGGTGAACAACTGTTAGCAGTCAACATT
GGGGGTGATGCATT
View all "lga103" genotypes
KFS1   NULL South Africa   lga104 TAGCATGTGCATCAGATGTGCAAGGTTTCCTTTTTGGATGCATTAATTTC
ACTTCAGTTTGTGATATCCAACAATATTTTAGTCTTAATTCATGTGCCAC
GTTGCTTGTGGGAATGCACAACCAAGAGATTTCAACTGTACTTGCCAATT
AACCAACATAATGATATCATGCATCATGAAGTTTCTTAGGGTAACAAGTA
TGGTGGGAATTTCGCATTTTGTGCTATGGACTTCGAATGGTACTCCCTTC
ATTCTAAATTATAAGTCATTCTAACTTTATTATGTATCTAGACATGATGA
GGATCTTAGATCAGCCTTTTGTTTCTGGCTAGACGCTTAGAGTTAATGTC
TGTTGTAAGTTTGTACTGTCTTTTTCTATAAAATTATAAATTGAAGTGCT
GTGGGGATCTCCGCCA
View all "lga104" genotypes
KFS1   NULL South Africa   lga105 TTGAACACGCACGCAACAATCTTTATACC--AGTCAATCATTCATCAGTC
ATCATCAAACGCGAACAGCGGCCCATACAG---TTTTCCGTTTATGCTTG
AGCGGCGGTTTAAGGCAAATCACGTGGCACTGCATGCCGTTTTAC--AGC
TGAATTTTGTTACTCCGTAGAA--------TATAGTATATG-TAGTTGAA
---TTGTAAGTTGAGACCGAACCGTCCAGCCATCCAAACTCCCTACAATA
TTAATTAGTGCCCTCGATCGATCGAGCCCTTGAAATAAAGGTAGCACACT
TCCATCTTCACTCTCACTCACTCACTCCCTCTCACA--TGCACCAAACCT
GACTTAGCCACCATGCATAGACGCAAGACAATGGCCAAGCTCCTCAGCCT
CAAGACTTGGTACCAGCTCTTTGTAGACAACTTCCTCGCCATGGTCGCGG
TGGCATTTGTCGCCGCCGCGCTCCGGAGGGCATGGCCAGTCAGCGTCAAC
GATCTCGCCGGCAGCCTCCAGGCCGTGCCGCCGGTCCGCATCCTCACGGC
GGTCATCCTGACTGCTGGCGTTGCACAGCTGAGGCGCCTGCGCCGGCCGC
GGGACGTGTACCTCGTGGAGTACGGCTGCTTCCGGCCCAAGCCCTGCTTC
CGGGCGCCGTTTGCCACGTGCCTGGAGCACGCCTTCTACCTGCCGTACCA
GGTCGACCCGGAGAGCGTCACCTTCTCGATCCGGCTGCTCGAGCGCTCGG
GGCTCGGCGAGGAGACGTCGCTGCCCATCTCGTACCACTACATTCCACCG
GA
View all "lga105" genotypes
KFS1   NULL South Africa   lga106 GGAAAGGTGTTTTTT-ATATTTATATAAATGATAGGACTTTTAAAAGTAT
TCACTTTTTTATGTGACAACTTCCGCTTGAATGATCGGCTGTCAAACATC
AAATT-TTGGCATGATCTTGCCATAGAGTTTAGTCTCTGTTTTTTAGAAT
GATCATTCTGGACTTACTTATATGATATATGGTATTACATGGTTCCTTAA
TTGACGAGATGATCTACTCCCTCCGTCCCTGAAAGCTGCAATTTCTAGAG
TTGTCTTAAGTCAATTTTTTAAAATTTTGACCAAATTTATAGAAAAAAAC
ACTAAGATTTATAGTACCAAATTAATACCATTAGATTTATCATTGAATAT
ATTTTCATAAGATACTCATTTTTTGTTATACATATTGATGCTCTTTTCTA
TAAAATTGGTCAAAGTTAAACAAGTTTGACTAGCACGGACTGTAGAAATT
GAAGCTTTCAGGGACGGAGGGAGTATTTAGGTACCATGAGTATCTAGATG
CACCACTGATTTGGTGATTTGCATAAAACAGCCATACAGAGTCATACAGA
ATCATAGACATTGCCACACATTTAAAGATAGCCAAAGATCGTGGTCTTGA
TGATTAGCTAAAAAATAACTTATTTTTCACCCTGATATCTGAAAACTTTG
CCCTAACCTTTATTTAGTAGC--------------CAACGAATACCAATT
TTAAGTTTTTGTGGTCACTGGTTGTGAATGTATTATAATCACATCACACA
AGTGATAACAGTGCTTCAACTATTTGCATATTTCAATTCCGTAGAATAAA
AATCATTTACCTATCAGAAGGATATTAACTAACACCAGGAATGATCAACC
ATGCTCCTAGAGTTAGC
View all "lga106" genotypes
KFS1   NULL South Africa   lga107 CGTTACGAGACGCAATGTCCGCGTGACCGCAGAGGTGCCGACGCGTCGTC
GACCGAGGTGGCGGGGTGCCGTGTAGCAGAGCAGGACTGCCCGCCGGGCG
TCTTGGGCAGAAGATAGAGATCTGAGAAGCCGTCGGCCCGTCGCCCTCCC
TCTCAACTCCGCTCCTCTCTCTGTTCCCAACTTCCCATCGCCGCATTCTT
CGCCTCCCACCACAGCAGCTTGAGCTCCTCACCGCCGCCCCTCCCTCCAC
TTCCACCGCTGTCCTTGCCCTCCTCGTTACCGTCAGGGTGGACGCATCCT
GGATCTGGCGAGCGCGTCTTCCTTGCGCACTTGATGACCGGCGTCGGCGC
CCTCCAAGCAGCTCCGATTTGACGAGACCGTCGACGCCGGTCGAACCAAG
ACGGAGACAGGCCATCAATACCCAGTAGAATAGCAAGGCTGGGCGGCTGG
CGGCGT----------------CCAGCTGAGGGGGAGATAGACCGGCGCG
GCAGCCGAGTCGGACGGAGCTCGGCTGTCCGGAGAAGCGCACGCACGACG
GGGCACGCCAGGGATCTGCAGCCGCGGTCTCTCATACCAGTGATCAGGCT
TAATCTGGGTGGGGAAAGTTTGGAAAGATCAATTCGGTGAAGAAGCACGA
TTCAACAGGGAGGAGCTTCAATCTGGTGGGCAGAATTTCGAAAT
View all "lga107" genotypes
KFS1   NULL South Africa   lga109 GA-GGACCTAATGACGTCCCTTGCCAACTCCCGCCCATGAATTTTTTTT-
CTCTTCGCATAAATACATGTCGCCTGATTCCCGATCTAATTTTTGCTGGG
CAAATAGTTCTCGATCGTTCCTGCTACCATGCAGATGCAGAGCACTAGAT
TCCGTGCACAATCGACCAAAAAATCGACAAAGGCGTGTATGCATTGCAGG
CTAGGCGCGACTGAAATGGGGCCGCGGTTTCGGCATCTTTTAGCTCGTTT
TTTTCTTGGCACGCGCGCTCGAGTGTGTCCGTATCCTTTCCTCGGTATAT
CCAGCACGACTCTCCCACTACCATATCGTCGCTCTCGACGAGACCGAGAC
AGCGACGGAAGAGGGGAGCGGCGGGCGAGACGAGAGAACAGGAGGAAGAA
GATGGCCACCTATTTCACGCTCAACACCGGGGCTCGCATCCCCTCGGTAG
GGCTCGGCACCTACAAGGCCGGCCCCGGCGTCGTCGCCGACGCAATCACC
GCCGCCGTCAAGGTCTTCCCCGTTTGCCCCTCCCTCGAGCACTTCTTGTT
CTGAGTTTTACATCCGTATATGTTCTGTCCCCGTGTACTACCTACACATG
CGTGCTGCTTAATCCTGCTTTCTTGCTTGCTTGTCATGGCAGGCCGGGTA
CCGGCACATCGACTGCGCGCCGCTATACAAGAACGAGAAGGAGGTAGCCT
TAATCCA--CCCTGCAATTAGTATCTTCGTTTCACATTTGAGATGGCAGT
TTGGTTATAGTTGCCCTTAACGTGT-TCCCAGATTGGTGTTGCCCTGAAC
AAGCTCTTTGATGACGGCGTCGTCAAGCGAGAAGACCTTTTCATCACCTC
AAAGA
View all "lga109" genotypes
KFS1   NULL South Africa   lga110 ACCATTTCTCAATCCGTCTTCAAGGGTCAGCCGCGTGGCTGCTCGCGTGT
TGGTGATCGTGACACGCGAACCGATGCCCCGGCTGTTGTACGCAGCCGAT
CATACTACGCGGCGCCATCGAAGTCCTTCACAACTTGGTAGATCCGGGTG
CCTTGTTGCGTTCTTTCTAAATACATGTCGATGGTTGTTCGACTAGCTGA
TGAACTCCCACGTCCTTGTGTCCTCGAGCTGCTAATTTCTCTTCTGTTTT
AAAATAATGGAAATTACATCTGTGTTGTGGTTTTTGCAGATGGAGGAGGC
TATGCTGTCGATCTTACTGTTGTTGAGCCTGCCTTGAATGTTGGTCCTGT
TAATCCGGTTGTACAGGTAGAGCATGGAGAGAATTTGGCAGTGCCAGGCG
ATACCCGTGTTAATTCTGTCGAAAATGCTGTGCTTTCAGAGGACACACTG
GTGCAAGCAGATCAGTTGTGCTCCAATGATGAGGTGCTGAGTGAGAGCAC
AGAAGCTCTAACCAAACACAGTCAGGTTGAGCTTTCAGGAGATCAGGGTG
GGTATCTTCCTCAGACGGATGTTGATTCTGGAGTTCAACCAGGGGAGAAG
GTGGAGAGTGAAGATTTGCCAAGACCACCAAGACTATCACGGGTTGCTCC
TCCTGATCTTGATGAATTCAAGACAAGAGCAATTGCTGAAAGGGGACCTG
GTGTTTCTAGTCAACCTGGTCATGTCATCCACCGAAGGGAGCCTAGTGGG
AAGTTGTATAATTATGCAGCAGCATCTAAA
View all "lga110" genotypes
KFS1   NULL South Africa   lga111 ACTTGCTCTTTAATGGATATATCAAAGTA----TACGGATGAAGTGAACT
A-----AGTGTTGTTGTGTTGGAAACTGTGTCAGTTTATAGTGGTATGTT
GTTCTGCCTTCATTGGTATAATGCCTTTCTATGTCTGTACTAGATGACAT
GTTCTATGACTGAAGATGGCCTTTCCGAAAGTCTTCAAGAGATGGATTTT
TCAGGTATACCTTCCATCATTACTGCTAGACTTTTGGTGTTAGGATGGGT
GTGTTCTTTTCCATTCCTAATTATAGTGGTAATTCAGGTACCGACTGTTT
GCTGAACTCGGATGGGATTGATGAACTGCCAGAAGAATGGCTAGTTGATT
GCTCACAAGATATCGAACCTTGTTTACCTGCAGAAGAAATGTATGTGTTT
CATTCCAATATTCATAAGCGCTTGGATTTTTTAGTTGTTGAGTTCACTGT
CATTGAAGATGAAGTATTACTACTTATGGTATCTAAAACCTTCTTAGTAG
GAATAGCCCTGCTGCTGCCACGGAAAAAGCTGTCGATATCTCTGGTTGGT
ACAAACCTCTCATGAGATTTCATCCTTGCCGTTTATAGCAG-ATTCTAAG
TTGCTGATAGATGAACGCTATGCTTATTTTTCAGTGCATACAAATTCTTC
GCCTCGTCAACAGTCCATCGTAGTCCAGAACAATCTTGCACAAGCTAGAC
CTACACCGCTGAAAGGTGTGCCCAACTCTTGTCCATGTTTGCTTAAAGAA
TCATGATTTTTATTCTCCTTCTCAAGAACAG
View all "lga111" genotypes
KFS1   NULL South Africa   lga12 GCATTAGTGGACAAGAAAGGATGCTTGTTTATGAGTACATGGCAAACAAG
AGCCTGGACTATTTCCTATTTGGTACCTATCTTTTCTCACCAGTCACCAT
GAATATTTGATTATATTTCTACAACAACAAAAAACTAACCTCCTTCTGTA
TGTGAACAGAAAAAGACAATGTTGTACTTGATTGGCAAGTGCGGTATCGC
ATAATAGAAGGCATTACTCGAGGTTTACTCTATCTCCACCAGGACTCGAG
ATACAGAATCATCCATAGAGATCTAAAGGCAGCTAACGTTCTTCTAGACA
CGGAGATGACTCCCAAAATTTCAGACTTTGGAATGGCAAGAATATTTGGC
AATGAAGAGACAGAAATTAATACCCGAAAAGTGGTTGGCACATAGTAAGT
TGTGATAAAGGAATGCAATGCTCATCATACAAATACACTTTGCAGTACTA
ATCCAATTCATGTGTC-----TTTTTTT-GCAGTGGTTACATGTCTCCGG
AGTATGCAATGGATGGAATCTTCTCTGTCAAGTCAGATGTATTCAGTTAT
GGAGTATTATTGCTGGAAATTGTCAGTGGTAGAAGAAACAGAGGAGTATA
TTCCTGTTCAAACAACCAAAGCCTTCTAGGCCATGTAAGTGACAACTTAC
CTCATCTATCGACTACAAGTAGTATTTCTCAACAAAACTTCTGAAACCTG
GCAATATATATTTTTTTCTGCAGGCATGGAGCTTATGGAACGAGGAGAAG
AGCATAGAGTTAGCAGATGAAAGAATGAATGGATCATTCAACTCAGACGA
AGTACAGAAGTGCATCAGAGTTGGACTCTTGTGTGTGCAGGAGAATCCAG
ACGACCGTCCACTGATGTCTCAGGTGCTTCTGATGTTAGCTAGTCCTGAT
GCCACCTCACTGCCAACTCCTAAGCAGCCTGGCTTTGCAGCTAGGAGAGT
TCTAATGGAAACAGACACATCATCAACCAAGCCAG
View all "lga12" genotypes
KFS1   NULL South Africa   lga13 ATCTCTTCTTGTGAGCATCTGTTTTCTGGTCATAGCGATTATGAGTGTGG
TTTGGTGTGACTGCATAAGTGCATCTGGTTGCGTGATGCGCAGTTTTGTT
TGCGCTGGTGTGAAGTACACTACGTGATTTATTCGGATTTCGTCTCAGTA
TCCGCGTGAAGCTTATTGACGGTCCAGTGCTGATCAGATTCTACAACGTC
AGCGCTAAACATATTCATAAGCGACATTAATCCGTTGCTGCTGTGTAGCG
ATATCTTTCTTGATCCAGTTACTTGGATGTGGGAAGTTATGCGTAGTAGC
ATACACACCTTCATTCTTCTTTACGTTTCAAAGAGTCGCCTTTGTTTTTG
TCAAACTTCATTCGAAGTTCTGCGAAACTCCTGATTTGAAGCCTTGAAGC
GACTAACATTTTAATCAATTTAAGAGTCAGCAATTAAGCTATTCAATTAC
TGCAGGTGTAGTGGTCGTTATTGTTTTGTTTTCTCAAGCATTTTAGATGA
TTATTCTAATATACAGTGAGGTGACGAAAAATTTATTAGAACTAGGTAGA
CTGTATATAAGCGTATCAGTTGTTTGGACTTCAATCTAGATGCAATTATC
TGTTTTGTTCATGTAATGTCCAACTGTCACTTGGTTCACATTGTATACTA
GATAAATTTCTGATAGAGATTTCATTGATT--ATCTAGCTGCTCTTTTCT
AACTGTTGTGGTATTGATGCTTTCTTTATAACACTTTGTTAAAAAGGCTT
TGGGTTCAATGCATCTGTCAAGTGTAATGTGGTAGTCTATCACATTTT
View all "lga13" genotypes
KFS1   NULL South Africa   lga14 GGTGACATGCTATACGCCACTACAGCACTACTATATATAGATATCTTATC
CAATTTCTGCTATTATTTTC-TTTTTTCAACATCACGTTACCCTCATTCC
AGTCACTCTTTGCCTGCAGCAAATAATGCAAGTGCAATACAAGATACCAG
ATTATGTCCACATATCTACGGAATGCCAGCAACTTCTTGCCCGTATCTTT
GTTGCCAATCCAATGAGGGTAATGATTTCAACCTGTAAATTACAGTCATG
ACTTGTCGTGATACACGTGGGATAGTGTAAAACTTGGTAATTTGAAACAT
TGATGCAGTATTTTTATGAATATTCTCCAGAGAATCACAATGAAGGAAAT
AAAGAGCCATCCATGGTTTTTGAAGAACCTACCACGGGAACTCACGGAGA
CTGCACAAGGCATGTACTACAGGAGGGATAACAGGGTGCCTTCTTATTCA
GACCAATCGTCGGAAGAAATCATGAAGATAGTTCAAGATGCAAGGACCAT
GCCGAAATCATCCAGATCAGGCTATGGGTGGAGCACTGAGTATTCGGATG
AAGAAGAAGAGAAGGAAGAGGAACACAGGCCAGAGGAGCATGAGGAAGAG
GAAGATGAATACGATAGGAGGGTGAAGGAGGTCCATGCAAGCGGAGAACT
CCGTTTGGACGCTCTTCACATATGAAAGCAAGTGGAAGAAAGCTACGTGT
ACATAACTGGGTTGCGGATCTGGAGGATCCAGTGGGATGTATGCAATTTT
GGCTTCA
View all "lga14" genotypes
KFS1   NULL South Africa   lga15 AATGTGCAATATGTATATATGCAGAGGCATGGCGGTTGCCGATGCATCGA
GCCCGTACAAGGTGAAGCTGCTGGTGGAGGACTACCCATACGCGTCGGAC
GGGCTGGCAATCTGGCACGCGATCGAGCAGTGGGTGACGGAGTACCTGGG
CATCTACTACCCCAACGACGGCGTGCTGCAGGCGGACGTGGAGCTGCAGG
CATGGTGGAAGGAGGTGCGCGAGGTCGGGCACGCCGACCTCAAGGACGAG
CCATGGTGGCCCAAGATGGAGACGGTGCCGGAGCTCGTCAAGGCCTGCAC
CACCATCATCTGGATCGCGTCGGCGCTCCACGCCGCCGTCAACTTCGGGC
AGTACCCGTACGCCGGGTACATCCCGAACCGTCCGTCGGTCAGCCGGAAG
CCGATGCCGGCGCCGGGCAGCGAGGAGTACGCGGAGCTGGGGAAGAACCC
GGAGAAGGTGTTCGTGCGCACCATCACGAGCCAGTTCCAGACACTCGTCG
GCATCTCGCTGCTGGAGATCCTGTCCAGCCATTCCTCCGACGAGGTGTAC
CTCGGCCAGCGCGACACGCCGGAGTGGACGTCGGACGCCAAGGCGCAGGA
GGCGTTCCGGCGGTTCGGGGCGCGGCTGACCGAGATCGAGAGCCGCGTGA
TGACCATGAACGCCGACCCAAGTCTCAAGAACCGCAACGGGCCGGCCAAG
TTCCCCTACACGCTGCTCTACCCCAACACCTCCGACAAGAATGGCGATGC
CGCCGGCATCACCGCCAAGGGCATTCCAAACAGCATCTCCATCTGAGTTC
TGAGTTCTGA
View all "lga15" genotypes
KFS1   NULL South Africa   lga16 GCGCCGGCCCGTCGCGCCGGTCGAGTACCCCATGCACCCCTCACACCTCG
TCTACGAGAAGATTGTGCTCGTCGGGGTCAAGGACGACGCCGCGGTTGCC
GATTCCGCCGGGAACAAGTAGATGCTACCACCACCA------CCGACACC
ACGCCTTCTGTTCTGCTGGTAACATCATCCAAGCAAGTAGATGCT-----
GCCTTTCAACTTTTTTTTCTTGCTGTATTTTTTTTTCCACTTCACTAGTT
CACTTCTGCTGCATTTGCAATCGTGTTGTAATTACTAGTACTAGTAAAGT
AGTAAGTACCATCAGCCCACCGTGGTGGAAACTGCAGATTTTGCCTCCCA
AACACAATCGGGCAAACTCTGCACTTTCCACCCAAATTACCTCCAATTAG
CTAGCCAGAAGAGTGCTTCTTTTTGTTTTTGTGATCTTTGTCCCTATTCA
AATTGTATCACCGTTGGTACTGATGTATTTCCTTTCTTGCACTGATGCTG
CTTAGTAATTTGCTTCTGTACTTGCTAGTTGTGTTTCACTTATCTGCTCT
AACAGACAAAACTGATCTTTCTTTTGCTTGCATATAAATGCATACTAATC
TTCACCATATATTGGTTCAATCGCCAATTCACCA
View all "lga16" genotypes
KFS1   NULL South Africa   lga17 GCGCTTCCCTGCACAGGT-----ACACCTATCTGCTACAATCCAGACTCT
C--TAGTCATGGCGGATGATCGATCAGCTCAAACCGCACCAGTAGCGTCA
ATTTTAATACACTTGTTTGAATTGTTCAAC-----------ATCACCGAC
AGACAAAA-GGCTAGCG---------------------------------
-TTGCGAGCTGCGACGACGTGTGGAATCGCGTTAGACTTTTAGGCCCCGG
GATCACACCTCAAGAAACTTA-----------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
---------TTTAAAATTTGTCTACAAAGAAGCAATTGGTTAGTTTAGGT
GGAGCGATCGGCCTGTCTGGGGATTAGTCAGCAGAGAGAGGTTAGTTAGG
TCAGCTTTGCTTGGTTCCTAAATTTTCGTCCTAGGGGGTTGCTTGGTCAG
TCGGCAGAGGATCTGGTCGCAGGCTGGAAAGTGCATGCGTCAGAGCATCT
AGACGCTGCAACTGCAAGCGGTGTCACCTGTAGAGCTGTATAGCCTGATC
TCACAT--------CTGATCATCTCATCTACTAGAGGAGTGAAGTTTGTT
TGTTGTTGCCCCAGTGGTTTTCCGAGGTGACTCATGGTTGTGATGTGCAG
GTGCGGGTAGCAACGCGGAAGATCTACGACCCCCTGGAGGAGGACGCCTT
CCGCCCCATCCTCCACCACTACGACGGGCCCAAGTTCCGGCTCGAGCTCT
CCGTCAC
View all "lga17" genotypes
KFS1   NULL South Africa   lga2 TTTTTTGGCAGTGTAATGTTTTGTAAGGGCAACTACGTGTGTGCTCAAAA
GAACCCAAGATGTACACGCAAAGGAGATGTAGTCTGCTGATGCAGCATTG
TAAAGTCCACACTCTGCAGGTTAACCCTTTTTTGGGGCCGTCAAGTGTTA
GCGCCCTATGTATGTTATCAACCCTGCAGAGAGGTTGCAAATACTGAACC
ACTCTCACAAACTTGCACCTGTCGAGATCATTTTGTAATCTACTACATCT
TTGTTCAGAATTGTTTTTTTTT-GTTTTTCACCCGTTGTGTAGTTTACCC
TGAAGGGACTTTCGTTTCTCTTGAAGTACGTGCTTCGGCACGATCGTGAA
TATAACTGTTAGCATCAGTCAGCTGCCTGTTGAGCAGTAAAAGAAAATAC
AAAGAGGTCTGCAAGCCTAGGC--ACATGAGCGCAACACCATTTTACATT
CAATGTGCTTCGTCTTAAACAGATGGTTGGTCTGAAAATCCTTGCATTTC
GCTCTTTCATGGTATCCAACTGATGCTAACTGTCGGTCTGAATCGGGCCT
CTGCTCTGATTTCTCAACTGGGGCAGCTCAGGTCAGGGAAACCGGAGATG
GCGTCAGGTGCTCAAAAGCGAAATGTGTCACGCGCGTCTCTGAAGAAGCA
CATTGGATCAAAGAGCTATTTATTTATGCCAAGCAAGCGAGATGATTCAG
ATGTATCCAAATGGCCGGTCCGAAATGCAGAAGATGATGAGTAAATATGG
TTTGGGAAACCACTTCTATGCCAAGCAT
View all "lga2" genotypes
KFS1   NULL South Africa   lga20 TATTTCTGAATGCTTGTCAGGCCAAACAGATTTATAGATCCATCAGATAA
CATGTGGAGATTGCAATTCAATGGACTCCAATTGGACGTATTGCTTCTAC
ACTTGCAATGTCACTCCATTCACAGCTGTACCTTCTACATTTTCCATGAC
CCTCCAGTCAGCTCTACGTCGTGGGTCAAATTTCTGATTGTCATTTTAGG
TCCATACTTTTTCAGAGCATCAGGACGACACCAAAATGGCAATGGCACGA
ACCAACTGTCATTAATAATATGGCCACAATACAAAGTCATACACAAATTT
ATACGAAACATTGAACTTATAATAACTGATGCACCAAATTACCGATTAAT
CTTGACACTGTGATCTCCATCTATAGTCCAGTCAAGCTTATTAGATGCAT
AATCATCATGGCCAGCTTCATCAACAGTCCTATTAAACACGCCAAAGAAT
ACAGTAAATTGTTTTTTTAAGGATATAGTAAATTGCTTATTATGCTTTAC
TGACGCCGCTTCTCGCACAACTCCTGTACGTCATTGAAACCTGAATACAC
CGCATGACAAGCACCTGAATACCCGAACATACC--TTTTTTTCTCAAAAT
GACCCAGGAC
View all "lga20" genotypes
KFS1   NULL South Africa   lga5 TTTTGTTGGCACT------GATACGACGATAGCACAGGAGTACTGAAAAG
TCTTGACACGGCATACGTAGTATAGGTGCTGCCTTTCTGGTAGGGAACAT
GACAAAGATCGATCTCTGGTCACTCGTCTGCTCCCCCTACC---ACGTTG
TATCATGTAA-TCCACATTATATATGCTGCTGTGTATTGTTATACATGTA
TATATGTATATGTAGTACTCCTGTGAGAGCAG------GCACGTACTGAC
TGTGTTTGCCTGGTACGTGACGATGGAT--GCAGGCACGCCGAGGGCGGG
TTCGAGGCGGCGGCCGGCGCCGGAGCTGAGAACGACGGGTGCAAGTGCGG
CCCCAACTGCAGCTGCAACCCCTGCACCTGCAAGTGAG
View all "lga5" genotypes
KFS1   NULL South Africa   lga6 ATGTCTCTCTTGACGCTCGAAATTTCATCTAGCTACTAGCTAGGACGCTG
TTCGTG--TATATATATAGTTCAATCTTCGTGTATGTATATATGCGTGGG
TGTGTG---ACGACGAACTGACCGATTCTGAATGCAACAACAAAATACGC
AT-GCTGTGCCGCACGCAGGGCCGAAGAAGCCGTGCTGCAAAGAGTGCAC
CAGCTGGTCGGGTGTCTACACCTGCGACGACCTCCTGACCAAGTGCGCCG
CCACCTGCAAGCAGTGCGTCCCCGTGTCCACGGACAAGGGCACCCGCTAC
AGGTGCCGCGACTTCCTCCCCGAAGGCTGCCCCTGCAAGACCAACTGATC
CATCCATCCATCCACACCACGCATGCATGGCCACAGCCGATGGAT
View all "lga6" genotypes
KFS1   NULL South Africa   lga7 CCGGAGTGATTCGTTGGAAGCGCGATCTGGATTGGGTGTGGAGAGTATGT
TTTGCTTTACGAATTGGGATCAGTTGTTAATCATTAGTAGCCAATCTGGC
CCTGAAATCGTTCCTAGGTACTCCGAGCTACGTACTGTGGGCTGTTTTCT
TATTTCAGCTATCAAATCTGTCTCTGAGATGGCGATAAATCAGAATTATC
GACCTTCCTGTTGTGACTACCTGAATACCTTAGGCAGTGGTGAACTGGTG
ATTACTCACCAGTCACCAGTGTTGCTTCATGAA----AGTCTTCCGCTTA
CTGCACCGCTGCCGGCTCATTTGACTTACACATGAGTCATGTGCACAATT
AGATCTTGTTGCCCCTGAGAATCACTTAGGATCAGTTTAATGGCATTGGC
ATTGGTTGCAGTTTATTATTAGAACAAACAAAATGAATATGAAACTTTAG
ATGTTTTTTT
View all "lga7" genotypes
KFS1   NULL South Africa   lga8 GATAATGGAGGTCCATACCCTGGTGGCTACCCAGCAAGTAATGTTCCTCT
AAATTATATATGTAGCTTAGCATTTCCTAAAACTATTATCCATATTCATA
TTATCAGCCTCATAACCAAACCATTATCACAGTAGCTGACTGTAAAATTT
ACCTGAATTATTATCAACCTTCAGGGGATGATGCTTATCGCACTGCTGAT
CCAACTCCCAGGGGTGCTCAACCTTTGAAAGTGCAGCCAATTGCTGTCCC
CACTATTCCTGTAGAAGAAATTAGAGAGGTCACAAAGGCTTTTGGCGATG
AAGCTTTGATTGGTGAGGGGTCTTTTGGCAGAGTATATTTTGGTGTACTA
GAAAATGGTAGGAGTGCTGCGATCAAAAAGTTAGATTCAAGCAAGCAGCC
AGAGCAAGAGTTTTTAGCACAGGTGTGCATTGATTTTATCAATGAATTGT
GCATCTTTGCTAGTCTTTCTTCTTATAAAATATATCTCTACACCTGCAGG
TCTCCATGGTGTCAAGGCTTAAGCATGACAATGTCGTAGAGTTGCTTGGT
TACTGTGTTGATGGGAACACCCGCATCCTTGCTTATGAATTTGCTACTAT
GGGTTCTCTTCACGATATGCTTCATGGTATTACTCTGTTTACTTCGAAAA
TCTAGTGTTCTAATAACTTTGAAATATATTATTCTCTTTAACTTCTTTCT
GGATAGCTGATGAGTTTGAATTTGAACTCCACAGGACGCAAAGGTGTGAA
AGGAGCTCAGCCTGGTCCAGTC
View all "lga8" genotypes
[ Download ]