grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for marker "STS006" from the experiment "Genome-wide patterns of nucleotide polymorphism in domesticated rice".

E.g., Germplasm "IRGC9542", RA4969, Basmati 1, Marker/locus RM22.

Items 26 to 50 of 96.       Previous | of 4 | Next

[ Download ]

Accession Name


& subtaxa

Country of


View All Genotypes on
View all "Guan-Yin-Tsan" genotypes
View all "Gundil Kuning" genotypes
View all "Gundil Kuning" genotypes
View all "Gyehwa 3" genotypes
View all "Heukgyeong" genotypes
View all "Hsia-Chioh-Keh-Tu" genotypes
View all "Hsia-Chioh-Keh-Tu" genotypes
View all "Jambu" genotypes
Jefferson x Oryza rufipogon NULL     Jefferson x Oryza rufipogon BC2F2 Line 252 STS006 CCCCACCTGCCCCTGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
View all "Jefferson x Oryza rufipogon" genotypes
Jefferson x Oryza rufipogon NULL     Jefferson x Oryza rufipogon BC2F1 Line 113 STS006 CCCCACCTGCCCCGGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
View all "Jefferson x Oryza rufipogon" genotypes
Jefferson x Oryza rufipogon NULL     Jefferson x Oryza rufipogon BC2F2 Line 59 STS006 CCCCACCTGCCCCGGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
View all "Jefferson x Oryza rufipogon" genotypes
Jefferson x Oryza rufipogon NULL     Jefferson x Oryza rufipogon BC2F1 Line 68 STS006 CCCCACCTGCCCCTGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
View all "Jefferson x Oryza rufipogon" genotypes
View all "Jhona 349" genotypes
View all "Kamenoo" genotypes
View all "Kasalath" genotypes
View all "Khao Dawk Mali 105" genotypes
View all "Khao Hawm" genotypes
View all "Koshihikari" genotypes
View all "Kotobuki Mochi" genotypes
View all "KU115" genotypes
View all "Lal Aman" genotypes
View all "Lemont" genotypes
View all "Luk Takhar" genotypes
View all "M-202" genotypes
View all "Miriti" genotypes
[ Download ]