grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for marker "STS006" from the experiment "Genome-wide patterns of nucleotide polymorphism in domesticated rice".

E.g., Germplasm "IRGC9542", RA4969, Basmati 1, Marker/locus RM22.

Items 51 to 75 of 96.       Previous | of 4 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Germplasm
Mudgo IRGC6663 indica   RA5282 STS006 CCCCACCTGCCCCTGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAGTGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTGTACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTAGCAGCTCAATGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATTGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "Mudgo" genotypes
Mudgo IRGC6663 indica   RA5282 STS006 CCCCACCTGCCCCTGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAGTGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTGTACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTAGCAGCTCAATGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATTGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "Mudgo" genotypes
Nep Hoa Vang IRGC40748 japonica   RA4945 STS006 CCCCACCTGCCCCGGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAATGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTATACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTACCAGCTCAGTGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATCGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "Nep Hoa Vang" genotypes
Norin 20 IRGC418 japonica   RA5302 STS006 CCCCACCTGCCCCGGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAATGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTATACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTACCAGCTCAGTGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATCGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "Norin 20" genotypes
NPE 417 IRGC38692 japonica   RA4944 STS006 CCCCACCTGCCCCGGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAATGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTATACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTACCAGCTCAGTGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATCGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "NPE 417" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS006 CCCCACCTGCCCCGGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAATGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTATACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTACCAGCTCAGTGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATCGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "NPE 844" genotypes
Oryza nivara-RA154 IRGC105706     RA154 STS006 CCCCACCTGCCCCGGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAATGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTATACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTACCAGCTCAGTGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATCGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "Oryza nivara-RA154" genotypes
Oryza rufipogon-RA162 IRGC105404     RA162 STS006 CCCCACCTGCCCCGGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAATGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTATACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTACCAGCTCAGTGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATCGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "Oryza rufipogon-RA162" genotypes
Oryza rufipogon-RA171 IRGC106163     RA171 STS006 CCCCACCTGCCCCGGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTYGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAATGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTRTACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGMTAATGACTACAGTTTTACCAGCTCAGTGTAA
AATGTGCTATTTAATTTTGTWATCCTTTATCTAAATTTTAATTTCATTTT
GTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNN
View all "Oryza rufipogon-RA171" genotypes
Oryza rufipogon-RA2662 IRGC106262     RA2662 STS006 CCCCACCTGCCCCTGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAGTGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTGTACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATA
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTAGCAGCTCAATGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATTGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "Oryza rufipogon-RA2662" genotypes
Oryza rufipogon-RA2747 IRGC105491     RA2747 STS006 CCCCACCTGCCCCTGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAGTGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTGTACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTAGCAGCTCAATGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATTGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "Oryza rufipogon-RA2747" genotypes
Oryza rufipogon-RA2762 IRGC106144     RA2762 STS006 CCCCACCTGCCCCTGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTYGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACARTGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTGTACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGMTAATGACTACAGTTTTASCAGCTCARTGTAA
AATGTGCTATTTAATTTTGTWATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATTGTTCTGCAYCTCTCCTTTMTGCATATCTTCTKATTXXX
XXXXXXXXXXXXXXXXXXXXXXXXXXXXNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNN
View all "Oryza rufipogon-RA2762" genotypes
Oryza rufipogon-RA4782 W1952     RA4782 STS006 CCCCACCTGCCCCTGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAGTGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTGTACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTAGCAGCTCAATGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATTGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "Oryza rufipogon-RA4782" genotypes
Oryza rufipogon-RA4783 W1953(-3)     RA4783 STS006 CCCCACCTGCCCCTGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAGTGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTGTACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTAGCAGCTCAATGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATTGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "Oryza rufipogon-RA4783" genotypes
Oryza rufipogon-RA4784 W1955     RA4784 STS006 CCCCACCTGCCCCTGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAGTGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTGTACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTAGCAGCTCAATGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATTGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "Oryza rufipogon-RA4784" genotypes
Oryza rufipogon-RA4785 W1956(-2)     RA4785 STS006 CCCCACCTGCCCCTGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAGTGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTGTACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTAGCAGCTCAATGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATTGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "Oryza rufipogon-RA4785" genotypes
Oryza rufipogon-RA4786 W1957     RA4786 STS006 CCCCACCTGCCCCTGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAGTGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTGTACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTAGCAGCTCAATGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATTGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "Oryza rufipogon-RA4786" genotypes
Oryza rufipogon-RA4790 W1961(-1)     RA4790 STS006 CCCCACCTGCCCCTGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAGTGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTGTACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTAGCAGCTCAATGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATTGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "Oryza rufipogon-RA4790" genotypes
Oryza rufipogon-RA4792 W1963     RA4792 STS006 CCCCACCTGCCCCTGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAGTGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTGTACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTAGCAGCTCAATGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATTGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "Oryza rufipogon-RA4792" genotypes
Oryza rufipogon-RA4794 W1965(-2)     RA4794 STS006 CCCCACCTGCCCCGGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCAGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAATGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTATACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTACCAGCTCAGTGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATCGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "Oryza rufipogon-RA4794" genotypes
Oryza rufipogon-RA4814 R1     RA4814 STS006 CCCCACCTGCCCCTGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAGTGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTGTACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTAGCAGCTCAATGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATTGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "Oryza rufipogon-RA4814" genotypes
Oryza rufipogon-RA4815 R2(a)     RA4815 STS006 CCCCACCTGCCCCTGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAGTGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTGTACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTAGCAGCTCAATGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATTGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "Oryza rufipogon-RA4815" genotypes
Oryza rufipogon-RA4816 R3(a)     RA4816 STS006 NNCCACCTGCCCCGGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTYGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAATGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTRTACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGMTAATGACTACAGTTTTACCAGCTCAGTGTAA
AATGTGCTATTTAATTTTGTWATCCTTTATCTAAATTTTAATTTCATTTT
GTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNN
View all "Oryza rufipogon-RA4816" genotypes
Oryza rufipogon-RA4820 R7(b)     RA4820 STS006 NCCCACCTGCCCCGGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTCGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAATGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTGTACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGATAATGACTACAGTTTTACCAGCTCAGTGTAA
AATGTGCTATTTAATTTTGTWATCCTTTATCTAAATTTTAATTTYATTTT
GTTGTTGATATYGTTCWGCAYCTCTCCTTTMTGCATATCTTCTTAWTACA
GTTGTATGTAACTCTTGTTCATCTGATYTAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "Oryza rufipogon-RA4820" genotypes
Oryza rufipogon-RA4823 R10(a)     RA4823 STS006 CCCCACCTGCCCCGGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAATGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTATACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTACCAGCTCAGTGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATCGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "Oryza rufipogon-RA4823" genotypes
[ Download ]