grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for marker "STS006" from the experiment "Genome-wide patterns of nucleotide polymorphism in domesticated rice".

E.g., Germplasm "IRGC9542", RA4969, Basmati 1, Marker/locus RM22.

Items 26 to 50 of 96.       Previous | of 4 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Germplasm
Shoemed PI392539 japonica   RA5123 STS006 CCCCACCTGCCCCGGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAATGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTATACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTACCAGCTCAGTGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATCGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "Shoemed" genotypes
Suweon 362 PI597021 japonica   RA5338 STS006 CCCCACCTGCCCCGGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAATGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTATACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTACCAGCTCAGTGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATCGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "Suweon 362" genotypes
Ta Hung Ku IRGC1107 japonica   RA5029 STS006 CCCCACCTGCCCCGGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAATGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTATACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTACCAGCTCAGTGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATCGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "Ta Hung Ku" genotypes
Tainan Iku 487 PI215936 japonica   PI215936 STS006 CCCCACCTGCCCCGGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAATGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTATACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTACCAGCTCAGTGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATCGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "Tainan Iku 487" genotypes
Taducan PI280681 indica   RA5374 STS006 CCCCACCTGCCCCGGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAATGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTATACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTACCAGCTCAGTGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATCGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "Taducan" genotypes
WC6 CIor5309 japonica   RA5288 STS006 CCCCACCTGCCCCGGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAATGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTATACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTACCAGCTCAGTGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATCGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "WC6" genotypes
Yelaik Meedon IRGC33888 japonica   RA4940 STS006 CCCCACCTGCCCCGGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAATGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTATACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTACCAGCTCAGTGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATCGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "Yelaik Meedon" genotypes
Jefferson x Oryza rufipogon NULL     Jefferson x Oryza rufipogon BC2F1 Line 113 STS006 CCCCACCTGCCCCGGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAATGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTATACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTACCAGCTCAGTGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATCGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "Jefferson x Oryza rufipogon" genotypes
Davao IRGC8244 japonica   RA4901 STS006 CCCCACCTGCCCCGGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAATGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTATACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTACCAGCTCAGTGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATCGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "Davao" genotypes
Fortuna CIor1344 japonica   RA5045 STS006 CCCCACCTGCCCCGGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAATGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTATACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTACCAGCTCAGTGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATCGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "Fortuna" genotypes
Gyehwa 3 PI584598 japonica   RA4997 STS006 CCCCACCTGCCCCGGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAATGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTATACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTACCAGCTCAGTGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATCGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "Gyehwa 3" genotypes
Khao Hawm IRGC24225 japonica   RA5030 STS006 CCCCACCTGCCCCGGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAATGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTATACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTACCAGCTCAGTGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATCGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "Khao Hawm" genotypes
Kotobuki Mochi IRGC2545 japonica   RA4882 STS006 CCCCACCTGCCCCGGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAATGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTATACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTACCAGCTCAGTGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATCGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "Kotobuki Mochi" genotypes
KU115 IRGC15046 japonica   RA5294 STS006 CCCCACCTGCCCCGGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAATGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTATACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTACCAGCTCAGTGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATCGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "KU115" genotypes
Lemont IRGC66756 japonica   RA4998 STS006 CCCCACCTGCCCCGGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAATGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTATACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTACCAGCTCAGTGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATCGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "Lemont" genotypes
Miriti IRGC25901 japonica   RA4970 STS006 CCCCACCTGCCCCGGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAATGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTATACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTACCAGCTCAGTGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATCGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "Miriti" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS006 CCCCACCTGCCCCGGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAATGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTATACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTACCAGCTCAGTGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATCGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "NPE 844" genotypes
Hsia-Chioh-Keh-Tu IRGC8240 indica   RA4898 STS006 CCCCACCTGCCCCGGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAATGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTATACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTACCAGCTCAGTGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATCGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "Hsia-Chioh-Keh-Tu" genotypes
Sinampaga Selection IRGC3967 japonica   RA5396 STS006 CCCCACCTGCCCCGGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAATGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTATACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTACCAGCTCAGTGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATCGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "Sinampaga Selection" genotypes
Trembese IRGC43675 japonica   RA4988 STS006 CCCCACCTGCCCCGGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAATGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTATACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTACCAGCTCAGTGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATCGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "Trembese" genotypes
Oryza nivara-RA154 IRGC105706     RA154 STS006 CCCCACCTGCCCCGGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAATGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTATACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTACCAGCTCAGTGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATCGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "Oryza nivara-RA154" genotypes
Oryza rufipogon-RA162 IRGC105404     RA162 STS006 CCCCACCTGCCCCGGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAATGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTATACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTACCAGCTCAGTGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATCGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "Oryza rufipogon-RA162" genotypes
Oryza rufipogon-RA4823 R10(a)     RA4823 STS006 CCCCACCTGCCCCGGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAATGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTATACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTACCAGCTCAGTGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATCGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "Oryza rufipogon-RA4823" genotypes
Arias IRGC43325 japonica   RA4951 STS006 CCCCACCTGCCCCGGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAATGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTATACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTACCAGCTCAGTGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATNTAAATTTTAATTTCATTTT
GTTGTTGATATCGTTCTGCATNNNNNNNTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACANACGTT
GTTNNNAGCTTT
View all "Arias" genotypes
Oryza rufipogon-RA171 IRGC106163     RA171 STS006 CCCCACCTGCCCCGGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTYGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAATGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTRTACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGMTAATGACTACAGTTTTACCAGCTCAGTGTAA
AATGTGCTATTTAATTTTGTWATCCTTTATCTAAATTTTAATTTCATTTT
GTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNN
View all "Oryza rufipogon-RA171" genotypes
[ Download ]