grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for marker "STS021" from the experiment "Genome-wide patterns of nucleotide polymorphism in domesticated rice".

E.g., Germplasm "IRGC9542", RA4969, Basmati 1, Marker/locus RM22.

Items 1 to 25 of 90.       of 4 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Germplasm
Oryza rufipogon-RA4816 R3(a)     RA4816 STS021 NNNNNNCAGTCACTATGACATTGAGGTGGCACCCCGCCGGTTGGAAAGCT
TGATAATTTCTAGCGGTGAGGTCATCTACTCACTTGAGTTCTCATACATT
GACCACAGTGGGCAGCAGCACACATCAGGCACATGGGGCGGCTATGGCCC
AAATAAAGGGAACAAACGTACTAAGGTGACTATGAATCTTATTATTCAAT
TCTTGCATTTTTCTTTTAGATAAAATGATTGGTATACATTCATTATCTCT
GCACACAACTAGTGAAATTTATAATAGGTTTACTAGTAGTATTATGTTAT
TTTGAAACTTTTCTTGCAGATTCAGCTTGGTCTTATAGAGTATGTAACGG
AAGTTTCTGGGACAATCGGACCATTTGATAGGGCACCCGCTGGTGTTATT
ACATCGCTTACGTTTATCACTAATAAGGGAAGCTACGGACCTTTTGGAGA
AGTAAGAGGAACTCCTTTCCACATCCCAGTGCAGGACAATGGCAGCATTG
TTGGCTTTTTTGCACGTGC
View all "Oryza rufipogon-RA4816" genotypes
Chinese PI431222 japonica   RA5295 STS021 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATNCATT
GACCNCAGTGGGCAGCAGCNNACATCAGGCACATGGGGCGGCTATGGCCC
AAATAAAGGGAACAAACATACTAAGGTGACTATGAATCTTATTATTCAAT
TCNTGCATTTTTCTTTTAGATAAAATGATTGGTATACATTCATTATCTCT
GCACACAACTAGTGAAATTTATAATAGGTTTACTAGTAGTATTATGTTAT
TTTGAAACTTTTCTTGCAGATTGAGCTTGGTCTTATAGAGTATGTAACGG
AAGTTTCTGGGACAATCGGACCATTTGATAGGGCACCCGCTGGTGTTATT
ACATCGCTTATGTTTATCACTAATAAGGGAAGCTACGGACCTTTTGGAGA
AGTAAGAGGAACTCCTTTCCACATCCCAGTGCAGGACAATGGCAGCATTG
TTGGCTTTTTTGCACGTGC
View all "Chinese" genotypes
Oryza rufipogon-RA4823 R10(a)     RA4823 STS021 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNAAACGTACTAAGGTGACTATGAATCTTATTATTCAAT
TCTTGCATTTTTCTTTTAGATAAAATGATTGGTATAYATTCATTATCTCT
GCACACAACTAGTGAAATTTATAATAGGTTTACTAGTAGTATTATGTTAT
TTTGAAACTTTTCTTGCAGATTCAGCTTGGTCTTATAGAGTATGTAACGG
AAGTTTCTGGGACAATCGGACCATTTGATAGGGCACCCGCTGGTGTTATT
ACATCGCTTACGTTTATCACTAATAAGGGAAGCTACGGACCTTTTGGAGA
AGTAAGAGGAACTCCTTTCCACATCCCAGTGCAGGACAATGGCAGCATTN
NNNNNNNNNNNNNNNNNNN
View all "Oryza rufipogon-RA4823" genotypes
Oryza rufipogon-RA4790 W1961(-1)     RA4790 STS021 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNTTGCATTTTTCTTTTAGATAAAATGATTGGTATACATTCATTATCTCT
GCACACAACTAGTGAAATTTATAATAGGTTTACTAGTAGTATTATGTTAT
TTTGAAACTTTTCTTGCAGATTCAGCTTGGTCTTATAGAGTATGTAACGG
AAGTTTCTGGGACAATCGGACCATTTGATAGGGCACCCGCTGGTGTTATT
ACATCGCTTATGTTTATCACTAATAAGGGAAGCTACGGACCTTTTGGAGA
AGTAAGAGGAACTCCTTTCCACATCCCAGTGCAGGACAATGGCAGCATTG
TTGGCTTTTTTGCACGTNN
View all "Oryza rufipogon-RA4790" genotypes
BJ1 IRGC45195     RA5345 STS021 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATGGCCC
AAATAAAGGGAACAAACGTNCTAAGGNGNNNNNGAATCTTATTATTCAAT
TCTTGCATTTTTCTTTTAGANNNNNNNNNNGGTATACATTCATTATCTCT
GCACACAACTAGTGAAATTTATAATAGGTTTACTAGTAGTATTATGTTAT
TTTGAAACTTTTCTTGCAGATTCAGCTTGGTCTTATAGAGTATGTAACGG
AAGTTTCTGGGACAATCGGACCATTTGATAGGGCACCCGCTGGTGTTATT
ACATCGCTTACGTTTATCACTAATAAGGGAAGCTACGGACCTTTTGGAGA
AGTAAGAGGAACTCCTTTCCACATCCCAGTGCAGGACAATGGCAGCATTG
TTGGCTTTTTTGCACGTGC
View all "BJ1" genotypes
Chhote Dhan IRGC58930 indica   RA4978 STS021 TGGTTCCAGTCACTATGACATNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GACCACAGTGGGCAGCAGCACACATCAGGCACATGGGGCGGCTATGGCCC
AAATAAAGGGAACAAACGTACTAAGGTGACTATGAATCTTATTATTCAAT
TCTTGCATTTTTCTTTTAGATAAAATGATTGGTATACATTCATTATCTCT
GCACACAACTAGTGAAATTTATAATAGGTTTACTAGTAGTATTATGTTAT
TTTGAAACTTTTCTTGCAGATTCAGCTTGGTCTTATAGAGTATGTAACGG
AAGTTTCTGGGACAATCGGACCATTTGATAGGGCACCCGCTGGTGTTATT
ACATCGCTTACGTTTATCACTAATAAGGGAAGCTACGGACCTTTTGGAGA
AGTAAGAGGAACTCCTTTCCACATCCCAGTGCAGGACAATGGCAGCATTG
TTGNNNNNNNNNNNNNNNN
View all "Chhote Dhan" genotypes
Basmati 217 IRGC53637     RA4993 STS021 TGGTTCCAGTCACTATGACATTGAGGTGGCACCCCGCCGGTTGGAAAGCT
TGATAATTTCTAGCGGTGAGGTCATCTACTCACTCGAGTTCTCATACGTT
GACCACAGTGGGCAGCAGCACACATCAGGCACATGGGGCGGCTATGGCCC
AAATAAAGGGAACAAACGTACTCAGGTGACTATGAATCTTATTATTCAAT
TCTTGCATTTTTCTTCTAGATAAAATGATTGGTATACATTCATTATCTCT
GC-------TAGTGAAATTTATAATAGGTTTATTAGTAGTGTTATGTTAT
TTTGGAACTTCTCTTGCAGATTCAGCTTGGTCTTATAGAGTATGTAACAG
AGGTTTGTGGGACAATCGGACCATTTGATAGGGCACCCGCTGGTGTTATT
ACATCGCTTACGTTTATCACTAACAAGGGAAGCTACGGACCTTTTGGAGA
AGTAAGAGGGACTCCTTTCCACATCCCAGTGCAGGACAATGGCAGCATTG
TTGGTTTTTTTGCGCGTGC
View all "Basmati 217" genotypes
DV85 IRGC8839     RA5323 STS021 TGGTTCCAGTCACTATGACATTGAGGTGGCACCCCGCCGGTTGGAAAGCT
TGATAATTTCTAGCGGTGAGGTCATCTACTCACTCGAGTTCTCATACGTT
GACCACAGTGGGCAGCAGCACACATCAGGCACATGGGGCGGCTATGGCCC
AAATAAAGGGAACAAACGTACTCAGGTGACTATGAATCTTATTATTCAAT
TCTTGCATTTTTCTTCTAGATAAAATGATTGGTATACATTCATTATCTCT
GC-------TAGTGAAATTTATAATAGGTTTATTAGTAGTGTTATGTTAT
TTTGGAACTTCTCTTGCAGATTCAGCTTGGTCTTATAGAGTATGTAACAG
AGGTTTGTGGGACAATCGGACCATTTGATAGGGCACCCGCTGGTGTTATT
ACATCGCTTACGTTTATCACTAACAAGGGAAGCTACGGACCTTTTGGAGA
AGTAAGAGGGACTCCTTTCCACATCCCAGTGCAGGACAATGGCAGCATTG
TTGGTTTTTTTGCGCGTGC
View all "DV85" genotypes
Binulawan IRGC26872 indica   RA4871 STS021 TGGTTCCAGTCACTATGACATTGAGGTGGCACCCCGCCGGTTGGAAAGCT
TGATAATTTCTAGCGGTGAGGTCATCTACTCACTCGAGTTCTCATACGTT
GACCACAGTGGGCAGCAGCACACATCAGGCACATGGGGCGGCTATGGCCC
AAATAAAGGGAACAAACGTACTCAGGTGACTATGAATCTTATTATTCAAT
TCTTGCATTTTTCTTCTAGATAAAATGATTGGTATACATTCATTATCTCT
GC-------TAGTGAAATTTATAATAGGTTTATTAGTAGTGTTATGTTAT
TTTGGAACTTCTCTTGCAGATTCAGCTTGGTCTTATAGAGTATGTAACAG
AGGTTTGTGGGACAATCGGACCATTTGATAGGGCACCCGCTGGTGTTATT
ACATCGCTTACGTTTATCACTAACAAGGGAAGCTACGGACCTTTTGGAGA
AGTAAGAGGGACTCCTTTCCACATCCCAGTGCAGGACAATGGCAGCATTG
TTGGTTTTTTTGCGCGTGC
View all "Binulawan" genotypes
Arias IRGC43325 japonica   RA4951 STS021 TGGTTCCAGTCACTATGACATTGAGGTGGCACCCCGCCGGTTGGAAAGCT
TGATAATTTCTAGCGGTGAGGTCATCTACTCACTCGAGTTCTCATACGTT
GACCACAGTGGGCAGCAGCACACATCAGGCACATGGGGCGGCTATGGCCC
AAATAAAGGGAACAAACGTACTCAGGTGACTATGAATCTTATTATTCAAT
TCTTGCATTTTTCTTCTAGATAAAATGATTGGTATACATTCATTATCTCT
GC-------TAGTGAAATTTATAATAGGTTTATTAGTAGTGTTATGTTAT
TTTGGAACTTCTCTTGCAGATTCAGCTTGGTCTTATAGAGTATGTAACAG
AGGTTTGTGGGACAATCGGACCATTTGATAGGGCACCCGCTGGTGTTATT
ACATCGCTTACGTTTATCACTAACAAGGGAAGCTACGGACCTTTTGGAGA
AGTAAGAGGGACTCCTTTCCACATCCCAGTGCAGGACAATGGCAGCATTG
TTGGTTTTTTTGCGCGTGC
View all "Arias" genotypes
Asse Y Pung CIor461 japonica   RA5333 STS021 TGGTTCCAGTCACTATGACATTGAGGTGGCACCCCGCCGGTTGGAAAGCT
TGATAATTTCTAGCGGTGAGGTCATCTACTCACTCGAGTTCTCATACGTT
GACCACAGTGGGCAGCAGCACACATCAGGCACATGGGGCGGCTATGGCCC
AAATAAAGGGAACAAACGTACTCAGGTGACTATGAATCTTATTATTCAAT
TCTTGCATTTTTCTTCTAGATAAAATGATTGGTATACATTCATTATCTCT
GC-------TAGTGAAATTTATAATAGGTTTATTAGTAGTGTTATGTTAT
TTTGGAACTTCTCTTGCAGATTCAGCTTGGTCTTATAGAGTATGTAACAG
AGGTTTGTGGGACAATCGGACCATTTGATAGGGCACCCGCTGGTGTTATT
ACATCGCTTACGTTTATCACTAACAAGGGAAGCTACGGACCTTTTGGAGA
AGTAAGAGGGACTCCTTTCCACATCCCAGTGCAGGACAATGGCAGCATTG
TTGGTTTTTTTGCGCGTGC
View all "Asse Y Pung" genotypes
Davao IRGC8244 japonica   RA4901 STS021 TGGTTCCAGTCACTATGACATTGAGGTGGCACCCCGCCGGTTGGAAAGCT
TGATAATTTCTAGCGGTGAGGTCATCTACTCACTCGAGTTCTCATACGTT
GACCACAGTGGGCAGCAGCACACATCAGGCACATGGGGCGGCTATGGCCC
AAATAAAGGGAACAAACGTACTCAGGTGACTATGAATCTTATTATTCAAT
TCTTGCATTTTTCTTCTAGATAAAATGATTGGTATACATTCATTATCTCT
GC-------TAGTGAAATTTATAATAGGTTTATTAGTAGTGTTATGTTAT
TTTGGAACTTCTCTTGCAGATTCAGCTTGGTCTTATAGAGTATGTAACAG
AGGTTTGTGGGACAATCGGACCATTTGATAGGGCACCCGCTGGTGTTATT
ACATCGCTTACGTTTATCACTAACAAGGGAAGCTACGGACCTTTTGGAGA
AGTAAGAGGGACTCCTTTCCACATCCCAGTGCAGGACAATGGCAGCATTG
TTGGTTTTTTTGCGCGTGC
View all "Davao" genotypes
Fortuna CIor1344 japonica   RA5045 STS021 TGGTTCCAGTCACTATGACATTGAGGTGGCACCCCGCCGGTTGGAAAGCT
TGATAATTTCTAGCGGTGAGGTCATCTACTCACTCGAGTTCTCATACGTT
GACCACAGTGGGCAGCAGCACACATCAGGCACATGGGGCGGCTATGGCCC
AAATAAAGGGAACAAACGTACTCAGGTGACTATGAATCTTATTATTCAAT
TCTTGCATTTTTCTTCTAGATAAAATGATTGGTATACATTCATTATCTCT
GC-------TAGTGAAATTTATAATAGGTTTATTAGTAGTGTTATGTTAT
TTTGGAACTTCTCTTGCAGATTCAGCTTGGTCTTATAGAGTATGTAACAG
AGGTTTGTGGGACAATCGGACCATTTGATAGGGCACCCGCTGGTGTTATT
ACATCGCTTACGTTTATCACTAACAAGGGAAGCTACGGACCTTTTGGAGA
AGTAAGAGGGACTCCTTTCCACATCCCAGTGCAGGACAATGGCAGCATTG
TTGGTTTTTTTGCGCGTGC
View all "Fortuna" genotypes
Gotak Gatik IRGC43397 japonica   RA4959 STS021 TGGTTCCAGTCACTATGACATTGAGGTGGCACCCCGCCGGTTGGAAAGCT
TGATAATTTCTAGCGGTGAGGTCATCTACTCACTCGAGTTCTCATACGTT
GACCACAGTGGGCAGCAGCACACATCAGGCACATGGGGCGGCTATGGCCC
AAATAAAGGGAACAAACGTACTCAGGTGACTATGAATCTTATTATTCAAT
TCTTGCATTTTTCTTCTAGATAAAATGATTGGTATACATTCATTATCTCT
GC-------TAGTGAAATTTATAATAGGTTTATTAGTAGTGTTATGTTAT
TTTGGAACTTCTCTTGCAGATTCAGCTTGGTCTTATAGAGTATGTAACAG
AGGTTTGTGGGACAATCGGACCATTTGATAGGGCACCCGCTGGTGTTATT
ACATCGCTTACGTTTATCACTAACAAGGGAAGCTACGGACCTTTTGGAGA
AGTAAGAGGGACTCCTTTCCACATCCCAGTGCAGGACAATGGCAGCATTG
TTGGTTTTTTTGCGCGTGC
View all "Gotak Gatik" genotypes
Jambu IRGC17757 japonica   RA5353 STS021 TGGTTCCAGTCACTATGACATTGAGGTGGCACCCCGCCGGTTGGAAAGCT
TGATAATTTCTAGCGGTGAGGTCATCTACTCACTCGAGTTCTCATACGTT
GACCACAGTGGGCAGCAGCACACATCAGGCACATGGGGCGGCTATGGCCC
AAATAAAGGGAACAAACGTACTCAGGTGACTATGAATCTTATTATTCAAT
TCTTGCATTTTTCTTCTAGATAAAATGATTGGTATACATTCATTATCTCT
GC-------TAGTGAAATTTATAATAGGTTTATTAGTAGTGTTATGTTAT
TTTGGAACTTCTCTTGCAGATTCAGCTTGGTCTTATAGAGTATGTAACAG
AGGTTTGTGGGACAATCGGACCATTTGATAGGGCACCCGCTGGTGTTATT
ACATCGCTTACGTTTATCACTAACAAGGGAAGCTACGGACCTTTTGGAGA
AGTAAGAGGGACTCCTTTCCACATCCCAGTGCAGGACAATGGCAGCATTG
TTGGTTTTTTTGCGCGTGC
View all "Jambu" genotypes
Kotobuki Mochi IRGC2545 japonica   RA4882 STS021 TGGTTCCAGTCACTATGACATTGAGGTGGCACCCCGCCGGTTGGAAAGCT
TGATAATTTCTAGCGGTGAGGTCATCTACTCACTCGAGTTCTCATACGTT
GACCACAGTGGGCAGCAGCACACATCAGGCACATGGGGCGGCTATGGCCC
AAATAAAGGGAACAAACGTACTCAGGTGACTATGAATCTTATTATTCAAT
TCTTGCATTTTTCTTCTAGATAAAATGATTGGTATACATTCATTATCTCT
GC-------TAGTGAAATTTATAATAGGTTTATTAGTAGTGTTATGTTAT
TTTGGAACTTCTCTTGCAGATTCAGCTTGGTCTTATAGAGTATGTAACAG
AGGTTTGTGGGACAATCGGACCATTTGATAGGGCACCCGCTGGTGTTATT
ACATCGCTTACGTTTATCACTAACAAGGGAAGCTACGGACCTTTTGGAGA
AGTAAGAGGGACTCCTTTCCACATCCCAGTGCAGGACAATGGCAGCATTG
TTGGTTTTTTTGCGCGTGC
View all "Kotobuki Mochi" genotypes
KU115 IRGC15046 japonica   RA5294 STS021 TGGTTCCAGTCACTATGACATTGAGGTGGCACCCCGCCGGTTGGAAAGCT
TGATAATTTCTAGCGGTGAGGTCATCTACTCACTCGAGTTCTCATACGTT
GACCACAGTGGGCAGCAGCACACATCAGGCACATGGGGCGGCTATGGCCC
AAATAAAGGGAACAAACGTACTCAGGTGACTATGAATCTTATTATTCAAT
TCTTGCATTTTTCTTCTAGATAAAATGATTGGTATACATTCATTATCTCT
GC-------TAGTGAAATTTATAATAGGTTTATTAGTAGTGTTATGTTAT
TTTGGAACTTCTCTTGCAGATTCAGCTTGGTCTTATAGAGTATGTAACAG
AGGTTTGTGGGACAATCGGACCATTTGATAGGGCACCCGCTGGTGTTATT
ACATCGCTTACGTTTATCACTAACAAGGGAAGCTACGGACCTTTTGGAGA
AGTAAGAGGGACTCCTTTCCACATCCCAGTGCAGGACAATGGCAGCATTG
TTGGTTTTTTTGCGCGTGC
View all "KU115" genotypes
Lemont IRGC66756 japonica   RA4998 STS021 TGGTTCCAGTCACTATGACATTGAGGTGGCACCCCGCCGGTTGGAAAGCT
TGATAATTTCTAGCGGTGAGGTCATCTACTCACTCGAGTTCTCATACGTT
GACCACAGTGGGCAGCAGCACACATCAGGCACATGGGGCGGCTATGGCCC
AAATAAAGGGAACAAACGTACTCAGGTGACTATGAATCTTATTATTCAAT
TCTTGCATTTTTCTTCTAGATAAAATGATTGGTATACATTCATTATCTCT
GC-------TAGTGAAATTTATAATAGGTTTATTAGTAGTGTTATGTTAT
TTTGGAACTTCTCTTGCAGATTCAGCTTGGTCTTATAGAGTATGTAACAG
AGGTTTGTGGGACAATCGGACCATTTGATAGGGCACCCGCTGGTGTTATT
ACATCGCTTACGTTTATCACTAACAAGGGAAGCTACGGACCTTTTGGAGA
AGTAAGAGGGACTCCTTTCCACATCCCAGTGCAGGACAATGGCAGCATTG
TTGGTTTTTTTGCGCGTGC
View all "Lemont" genotypes
Miriti IRGC25901 japonica   RA4970 STS021 TGGTTCCAGTCACTATGACATTGAGGTGGCACCCCGCCGGTTGGAAAGCT
TGATAATTTCTAGCGGTGAGGTCATCTACTCACTCGAGTTCTCATACGTT
GACCACAGTGGGCAGCAGCACACATCAGGCACATGGGGCGGCTATGGCCC
AAATAAAGGGAACAAACGTACTCAGGTGACTATGAATCTTATTATTCAAT
TCTTGCATTTTTCTTCTAGATAAAATGATTGGTATACATTCATTATCTCT
GC-------TAGTGAAATTTATAATAGGTTTATTAGTAGTGTTATGTTAT
TTTGGAACTTCTCTTGCAGATTCAGCTTGGTCTTATAGAGTATGTAACAG
AGGTTTGTGGGACAATCGGACCATTTGATAGGGCACCCGCTGGTGTTATT
ACATCGCTTACGTTTATCACTAACAAGGGAAGCTACGGACCTTTTGGAGA
AGTAAGAGGGACTCCTTTCCACATCCCAGTGCAGGACAATGGCAGCATTG
TTGGTTTTTTTGCGCGTGC
View all "Miriti" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS021 TGGTTCCAGTCACTATGACATTGAGGTGGCACCCCGCCGGTTGGAAAGCT
TGATAATTTCTAGCGGTGAGGTCATCTACTCACTCGAGTTCTCATACGTT
GACCACAGTGGGCAGCAGCACACATCAGGCACATGGGGCGGCTATGGCCC
AAATAAAGGGAACAAACGTACTCAGGTGACTATGAATCTTATTATTCAAT
TCTTGCATTTTTCTTCTAGATAAAATGATTGGTATACATTCATTATCTCT
GC-------TAGTGAAATTTATAATAGGTTTATTAGTAGTGTTATGTTAT
TTTGGAACTTCTCTTGCAGATTCAGCTTGGTCTTATAGAGTATGTAACAG
AGGTTTGTGGGACAATCGGACCATTTGATAGGGCACCCGCTGGTGTTATT
ACATCGCTTACGTTTATCACTAACAAGGGAAGCTACGGACCTTTTGGAGA
AGTAAGAGGGACTCCTTTCCACATCCCAGTGCAGGACAATGGCAGCATTG
TTGGTTTTTTTGCGCGTGC
View all "NPE 844" genotypes
Sinampaga Selection IRGC3967 japonica   RA5396 STS021 TGGTTCCAGTCACTATGACATTGAGGTGGCACCCCGCCGGTTGGAAAGCT
TGATAATTTCTAGCGGTGAGGTCATCTACTCACTCGAGTTCTCATACGTT
GACCACAGTGGGCAGCAGCACACATCAGGCACATGGGGCGGCTATGGCCC
AAATAAAGGGAACAAACGTACTCAGGTGACTATGAATCTTATTATTCAAT
TCTTGCATTTTTCTTCTAGATAAAATGATTGGTATACATTCATTATCTCT
GC-------TAGTGAAATTTATAATAGGTTTATTAGTAGTGTTATGTTAT
TTTGGAACTTCTCTTGCAGATTCAGCTTGGTCTTATAGAGTATGTAACAG
AGGTTTGTGGGACAATCGGACCATTTGATAGGGCACCCGCTGGTGTTATT
ACATCGCTTACGTTTATCACTAACAAGGGAAGCTACGGACCTTTTGGAGA
AGTAAGAGGGACTCCTTTCCACATCCCAGTGCAGGACAATGGCAGCATTG
TTGGTTTTTTTGCGCGTGC
View all "Sinampaga Selection" genotypes
Oryza nivara-RA154 IRGC105706     RA154 STS021 TGGTTCCAGTCACTATGACATTGAGGTGGCACCCCGCCGGTTGGAAAGCT
TGATAATTTCTAGCGGTGAGGTCATCTACTCACTCGAGTTCTCATACGTT
GACCACAGTGGGCAGCAGCACACATCAGGCACATGGGGCGGCTATGGCCC
AAATAAAGGGAACAAACGTACTCAGGTGACTATGAATCTTATTATTCAAT
TCTTGCATTTTTCTTCTAGATAAAATGATTGGTATACATTCATTATCTCT
GC-------TAGTGAAATTTATAATAGGTTTATTAGTAGTGTTATGTTAT
TTTGGAACTTCTCTTGCAGATTCAGCTTGGTCTTATAGAGTATGTAACAG
AGGTTTGTGGGACAATCGGACCATTTGATAGGGCACCCGCTGGTGTTATT
ACATCGCTTACGTTTATCACTAACAAGGGAAGCTACGGACCTTTTGGAGA
AGTAAGAGGGACTCCTTTCCACATCCCAGTGCAGGACAATGGCAGCATTG
TTGGTTTTTTTGCGCGTGC
View all "Oryza nivara-RA154" genotypes
Oryza rufipogon-RA4820 R7(b)     RA4820 STS021 TGGTTCCAGTCACTATGACATTGAGGTGGCACCCCGCCGGTTGGAAAGCT
TGATAATTTCTAGCGGTGAGGTCATCTACTCACTCGAGTTCTCATACGTT
GACCACAGTGGGCAGCAGCACACATCAGGCACATGGGGCGGCTATGGCCC
AAATAAAGGGAACAAACGTACTCAGGTGACTATGAATCTTATTATTCAAT
TCTTGCATTTTTCTTCTAGATAAAATGATTGGTATACATTCATTATCTCT
GC-------TAGTGAAATTTATAATAGGTTTATTAGTAGTGTTATGTTAT
TTTGGAACTTCTCTTGCAGATTCAGCTTGGTCTTATAGAGTATGTAACAG
AGGTTTGTGGGACAATCGGACCATTTGATAGGGCACCCGCTGGTGTTATT
ACATCGCTTACGTTTATCACTAACAAGGGAAGCTACGGACCTTTTGGAGA
AGTAAGAGGGACTCCTTTCCACATCCCAGTGCAGGACAATGGCAGCATTG
TTGGTTTTTTTGCGCGTGC
View all "Oryza rufipogon-RA4820" genotypes
Chau IRGC56036 indica   RA4974 STS021 TGGTTCCAGTCACTATGACATTGAGGTGGCACCCCGCCGGTTGGAAAGCT
TGATAATTTCTAGCGGTGAGGTCATCTACTCACTTGAGTTCTCATACATT
GACCACAGTGGGCAGCAGCACACATCAGGCACATGGGGCGGCTATGGCCC
AAATAAAGGGAACAAACATACTAAGGTGACTATGAATCTTATTATTCAAT
TCTTGCATTTTTCTTTTAGATAAAATGATTGGTATACATTCATTATCTCT
GCACACAACTAGTGAAATTTATAATAGGTTTACTAGTAGTATTATGTTAT
TATGAAACTTTTCTTGCAGATTCAGCTTGGTCTTATAGAGTATGTAACGG
AAGTTTCTGGGACAATCGGACCATTTGATAGGGCACCCGCTGGTGTTATT
ACATCGCTAACGTTTATCACTAATAAGGGAAGCTACGGACCTTTTGGAGA
AGTAGGAGGAACTCCTTTCCACATCCCAGTGCAGGACAATGGCAGCATTG
TTGGCTTTTTTGCACGTGC
View all "Chau" genotypes
Hsia-Chioh-Keh-Tu IRGC8240 indica   RA4898 STS021 TGGTTCCAGTCACTATGACATTGAGGTGGCACCCCGCCGGTTGGAAAGCT
TGATAATTTCTAGCGGTGAGGTCATCTACTCACTTGAGTTCTCATACATT
GACCACAGTGGGCAGCAGCACACATCAGGCACATGGGGCGGCTATGGCCC
AAATAAAGGGAACAAACATACTAAGGTGACTATGAATCTTATTATTCAAT
TCTTGCATTTTTCTTTTAGATAAAATGATTGGTATACATTCATTATCTCT
GCACACAACTAGTGAAATTTATAATAGGTTTACTAGTAGTATTATGTTAT
TATGAAACTTTTCTTGCAGATTCAGCTTGGTCTTATAGAGTATGTAACGG
AAGTTTCTGGGACAATCGGACCATTTGATAGGGCACCCGCTGGTGTTATT
ACATCGCTAACGTTTATCACTAATAAGGGAAGCTACGGACCTTTTGGAGA
AGTAGGAGGAACTCCTTTCCACATCCCAGTGCAGGACAATGGCAGCATTG
TTGGCTTTTTTGCACGTGC
View all "Hsia-Chioh-Keh-Tu" genotypes
[ Download ]