grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for marker "STS060" from the experiment "Genome-wide patterns of nucleotide polymorphism in domesticated rice".

E.g., Germplasm "IRGC9542", RA4969, Basmati 1, Marker/locus RM22.

Items 1 to 25 of 79.       of 4 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Germplasm
Popot 165 IRGC43545 indica   RA4987 STS060 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAGCGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGCAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Popot 165" genotypes
Shoemed PI392539 japonica   RA5123 STS060 TCAAGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAGCGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGCAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Shoemed" genotypes
Early Wataribune CIor9738 japonica   RA5319 STS060 TCAAGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAGCGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGCAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Early Wataribune" genotypes
Chinese PI431222 japonica   RA5295 STS060 TCAAGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAGCGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGCAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Chinese" genotypes
Koshihikari IRGC10907 japonica   RA5337 STS060 TCAAGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAGCGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGCAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Koshihikari" genotypes
Luk Takhar IRGC58286 japonica   RA4977 STS060 TCAAGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAGCGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGCAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Luk Takhar" genotypes
Nep Hoa Vang IRGC40748 japonica   RA4945 STS060 TCAAGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAGCGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGCAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Nep Hoa Vang" genotypes
Norin 20 IRGC418 japonica   RA5302 STS060 TCAAGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAGCGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGCAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Norin 20" genotypes
Shinriki CIor1642 japonica   RA5327 STS060 TCAAGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAGCGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGCAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Shinriki" genotypes
Shoemed PI392539 japonica   RA5123 STS060 TCAAGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAGCGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGCAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Shoemed" genotypes
Suweon 362 PI597021 japonica   RA5338 STS060 TCAAGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAGCGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGCAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Suweon 362" genotypes
Tainan Iku 487 PI215936 japonica   PI215936 STS060 TCAAGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAGCGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGCAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Tainan Iku 487" genotypes
Taducan PI280681 indica   RA5374 STS060 TCAAGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAGCGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGCAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Taducan" genotypes
Gyehwa 3 PI584598 japonica   RA4997 STS060 TCAAGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAGCGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGCAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Gyehwa 3" genotypes
Jefferson x Oryza rufipogon NULL     Jefferson x Oryza rufipogon BC2F1 Line 68 STS060 TCACGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACGGTCGACGTCGG
GAAGCTCTATGAACGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGCAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCAAGACAAAAAGTACCTTCA
GAACATGA
View all "Jefferson x Oryza rufipogon" genotypes
Badkalamkati IRGC45011 indica   RA4991 STS060 TCACGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAAAGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGCAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Badkalamkati" genotypes
Oryza rufipogon-RA4783 W1953(-3)     RA4783 STS060 TCACGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAAAGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGCAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Oryza rufipogon-RA4783" genotypes
Oryza rufipogon-RA4784 W1955     RA4784 STS060 TCACGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAAAGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGCAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Oryza rufipogon-RA4784" genotypes
Oryza rufipogon-RA4792 W1963     RA4792 STS060 TCACGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAAAGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGCAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Oryza rufipogon-RA4792" genotypes
M-202 RA5539 japonica, temperate japonica   RA5539 STS060 TCACGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAAAGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGGAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "M-202" genotypes
NPE 417 IRGC38692 japonica   RA4944 STS060 TCACGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAAAGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGGAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "NPE 417" genotypes
Yelaik Meedon IRGC33888 japonica   RA4940 STS060 TCACGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAAAGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGGAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Yelaik Meedon" genotypes
Arias IRGC43325 japonica   RA4951 STS060 TCACGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAAAGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGGAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Arias" genotypes
Asse Y Pung CIor461 japonica   RA5333 STS060 TCACGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAAAGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGGAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Asse Y Pung" genotypes
Davao IRGC8244 japonica   RA4901 STS060 TCACGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAAAGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGGAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Davao" genotypes
[ Download ]