grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for marker "STS060" from the experiment "Genome-wide patterns of nucleotide polymorphism in domesticated rice".

E.g., Germplasm "IRGC9542", RA4969, Basmati 1, Marker/locus RM22.

Items 1 to 25 of 79.       of 4 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Germplasm
Jefferson x Oryza rufipogon NULL     Jefferson x Oryza rufipogon BC2F1 Line 113 STS060 TCACGAGTTCAAAGGTTGTACTGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAAAGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGCAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Jefferson x Oryza rufipogon" genotypes
Jefferson x Oryza rufipogon NULL     Jefferson x Oryza rufipogon BC2F1 Line 68 STS060 TCACGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACGGTCGACGTCGG
GAAGCTCTATGAACGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGCAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCAAGACAAAAAGTACCTTCA
GAACATGA
View all "Jefferson x Oryza rufipogon" genotypes
Tainan Iku 487 PI215936 japonica   PI215936 STS060 TCAAGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAGCGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGCAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Tainan Iku 487" genotypes
Oryza rufipogon-RA162 IRGC105404     RA162 STS060 TCACGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAACGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGCAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Oryza rufipogon-RA162" genotypes
Oryza rufipogon-RA171 IRGC106163     RA171 STS060 TCACGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATTACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAACGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGCAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Oryza rufipogon-RA171" genotypes
Oryza rufipogon-RA2662 IRGC106262     RA2662 STS060 TCACGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACTTCGG
GAAGCTCTATGAACGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGCAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Oryza rufipogon-RA2662" genotypes
Oryza rufipogon-RA2747 IRGC105491     RA2747 STS060 TCACGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAACGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGCAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Oryza rufipogon-RA2747" genotypes
Oryza rufipogon-RA4782 W1952     RA4782 STS060 TCACGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAAAGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGSAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Oryza rufipogon-RA4782" genotypes
Oryza rufipogon-RA4783 W1953(-3)     RA4783 STS060 TCACGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAAAGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGCAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Oryza rufipogon-RA4783" genotypes
Oryza rufipogon-RA4784 W1955     RA4784 STS060 TCACGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAAAGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGCAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Oryza rufipogon-RA4784" genotypes
Oryza rufipogon-RA4785 W1956(-2)     RA4785 STS060 TCACGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATG
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAACGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGCAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Oryza rufipogon-RA4785" genotypes
Oryza rufipogon-RA4786 W1957     RA4786 STS060 TCACGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAAAGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGSAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Oryza rufipogon-RA4786" genotypes
Oryza rufipogon-RA4790 W1961(-1)     RA4790 STS060 TCACGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAAMGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGSAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Oryza rufipogon-RA4790" genotypes
Oryza rufipogon-RA4792 W1963     RA4792 STS060 TCACGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAAAGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGCAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Oryza rufipogon-RA4792" genotypes
Oryza rufipogon-RA4794 W1965(-2)     RA4794 STS060 TCACGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAACTTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAAAGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGCAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Oryza rufipogon-RA4794" genotypes
Oryza rufipogon-RA4816 R3(a)     RA4816 STS060 TCACGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAACGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGCAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Oryza rufipogon-RA4816" genotypes
Oryza rufipogon-RA4826 R13     RA4826 STS060 TCACGAGTTCAAAGGTTGTACTGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAAAGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGCAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Oryza rufipogon-RA4826" genotypes
Binulawan IRGC26872 indica   RA4871 STS060 TCACGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAACGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGCAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Binulawan" genotypes
Khao Dawk Mali 105 IRGC27748 indica   RA4878 STS060 TCACGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAACGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGCAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Khao Dawk Mali 105" genotypes
Kotobuki Mochi IRGC2545 japonica   RA4882 STS060 TCACGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAAAGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGGAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Kotobuki Mochi" genotypes
Pin Kaeo IRGC5803 indica   RA4883 STS060 TCACGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAACTTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAAAGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGCAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Pin Kaeo" genotypes
DA13 IRGC5857     RA4887 STS060 TCACGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAACGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGCAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "DA13" genotypes
Pankhari 203 IRGC5999     RA4888 STS060 TCACGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAACGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGCAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Pankhari 203" genotypes
Hsia-Chioh-Keh-Tu IRGC8240 indica   RA4898 STS060 TCACGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAACTTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAAAGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGCAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Hsia-Chioh-Keh-Tu" genotypes
Hsia-Chioh-Keh-Tu IRGC8240 indica   RA4898 STS060 TCACGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAACGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGCAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "Hsia-Chioh-Keh-Tu" genotypes
[ Download ]