grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for marker "STS112" from the experiment "Genome-wide patterns of nucleotide polymorphism in domesticated rice".

E.g., Germplasm "IRGC9542", RA4969, Basmati 1, Marker/locus RM22.

Items 1 to 25 of 95.       of 4 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Germplasm
Cicih Beton IRGC43372 japonica   RA4955 STS112 CAAAGAACTTTCAGATGGGTGTCTCCAACAAGACTCCTGAGTATCTCAAG
ATGAATCCTATTGGGAAGGTTTGAGCAAAACCACCTCTGAATTTTGGTAC
ATTTGCACAGAATCTGATTTGGACACGTTTCCTTTCAGGTCCCTATTCTA
GAGACTCCTGATGGTCCTGTTTTTGAAAGCAATGCGATTGCACGATATGG
TAAGTGATACATAGCAAGGATTCCGTTCTTTTAATCCTTTTCTCTCTATT
GCTTGATTTAGTTCTAAGTTCCTCTCATTTTCCTGAAGTTACTCGCTCGA
AGTCTGACAACCCACTCTATGGGTCTTCACTGATTGAATATGTGAGTGAT
CTTTCATAAATATTTAGGATCATTCTTGATTATTTTCCAGCTCCTAGAAT
TTTGTGTTTCTTTCAGGTTGATCTTTCATAGACATTTAGGATCATTCTTG
ATTATTTTACCAGCNNNNNNNNNNNNNNNNNNNNNNNNNN
View all "Cicih Beton" genotypes
Heukgyeong IRGC55530 japonica   RA4973 STS112 CAAAGAACTTTCAGATGGGTGTCTCCAACAAGACTCCTGAGTATCTCAAG
ATGAATCCTATTGGGAAGGTTTGAGCAAAACCACCTCTGAATTTTGGTAC
ATTTGCACAGAATCTGATTTGGACACGTTTCCTTTCAGGTCCCTATTCTA
GAGACTCCTGATGGTCCTGTTTTTGAAAGCAATGCGATTGCACGATATGG
TAAGTGATACATAGCAAGGATTCCGTTCTTTTAATCCTTTTCTCTCTATT
GCTTGATTTAGTTCTAAGTTCCTCTCATTTTCCTGAAGTTACTCGCTCGA
AGTCTGACAACCCACTCTATGGGTCTTCACTGATTGAATATGTGAGTGAT
CTTTCATAAATATTTAGGATCATTCTTGATTATTTTCCAGCTCCTAGAAT
TTTGTGTTTCTTTCAGGTTGATCTTTCATAGACATTTAGGATCATTCTTG
ATTATTTTACCAGCTCCNNNNNNNNNNNNNNNNNNNNNNN
View all "Heukgyeong" genotypes
Tainan Iku 487 PI215936 japonica   PI215936 STS112 CAAAGAACTTTCAGATGGGTGTCTCCAACAAGACTCCTGAGTATCTCAAG
ATGAATCCTATTGGGAAGGTTTGAGCAAAACCACCTCTGAATTTTGGTAC
ATTTGCACAGAATCTGATTTGGACACGTTTCCTTTCAGGTCCCTATTCTA
GAGACTCCTGATGGTCCTGTTTTTGAAAGCAATGCGATTGCACGATATGG
TAAGTGATACATAGCAAGGATTCCGTTCTTTTAATCCTTTTCTCTCTATT
GCTTGATTTAGTTCTAAGTTCCTCTCATTTTCCTGAAGTTACTCGCTCGA
AGTCTGACAACCCACTCTATGGGTCTTCACTGATTGAATATGTGAGTGAT
CTTTCATAAATATTTAGGATCATTCTTGATTATTTTCCAGCTCCTAGAAT
TTTGTGTTTCTTTCAGGTTGATCTTTCATAGACATTTAGGATCATTCTTG
ATTATTTTACCAGCTCCNNNNNNNNNNNNNNNNNNNNNNN
View all "Tainan Iku 487" genotypes
Basmati 217 IRGC53637     RA4993 STS112 CAAAGAACTTTCAGATGGGTGTCTCCAACAAGACTCCTGAGTATCTCAAG
ATGAATCCTATTGGGAAGGTTTGAGCAAAACCACCTCTGAATTTTGGTAC
ATTTGCACAGAATCTGATTTGGACACGTTTCCTTTCAGGTCCCTATTCTA
GAGACTCCTGATGGTCCTGTTTTTGAAAGCAATGCGATTGCACGATATGG
TAAGTGATACATAGCAAGGATTCCGTTCTTTTAATCCTTTTCTCTCTATT
GCTTGATTTAGTTCTAAGTTCCTCTCATTTTCCTGAAGTTACTCGCTCGA
AGTCTGACAACCCACTCTATGGGTCTTCACTGATTGAATATGTGAGTGAT
CTTTCATAAATATTTAGGATCATTCTTGATTATTTTCCAGCTCCTAGAAT
TTTGTGTTTCTTTCAGGTTGATCTTTCATAGACATTTAGGATCATTCTTG
ATTATTTTACCAGCTCCTTGAATTTCTTGTTTCTTTCAGG
View all "Basmati 217" genotypes
DA13 IRGC5857     RA4887 STS112 CAAAGAACTTTCAGATGGGTGTCTCCAACAAGACTCCTGAGTATCTCAAG
ATGAATCCTATTGGGAAGGTTTGAGCAAAACCACCTCTGAATTTTGGTAC
ATTTGCACAGAATCTGATTTGGACACGTTTCCTTTCAGGTCCCTATTCTA
GAGACTCCTGATGGTCCTGTTTTTGAAAGCAATGCGATTGCACGATATGG
TAAGTGATACATAGCAAGGATTCCGTTCTTTTAATCCTTTTCTCTCTATT
GCTTGATTTAGTTCTAAGTTCCTCTCATTTTCCTGAAGTTACTCGCTCGA
AGTCTGACAACCCACTCTATGGGTCTTCACTGATTGAATATGTGAGTGAT
CTTTCATAAATATTTAGGATCATTCTTGATTATTTTCCAGCTCCTAGAAT
TTTGTGTTTCTTTCAGGTTGATCTTTCATAGACATTTAGGATCATTCTTG
ATTATTTTACCAGCTCCTTGAATTTCTTGTTTCTTTCAGG
View all "DA13" genotypes
Dom Sufid IRGC12880 aromatic   RA4929 STS112 CAAAGAACTTTCAGATGGGTGTCTCCAACAAGACTCCTGAGTATCTCAAG
ATGAATCCTATTGGGAAGGTTTGAGCAAAACCACCTCTGAATTTTGGTAC
ATTTGCACAGAATCTGATTTGGACACGTTTCCTTTCAGGTCCCTATTCTA
GAGACTCCTGATGGTCCTGTTTTTGAAAGCAATGCGATTGCACGATATGG
TAAGTGATACATAGCAAGGATTCCGTTCTTTTAATCCTTTTCTCTCTATT
GCTTGATTTAGTTCTAAGTTCCTCTCATTTTCCTGAAGTTACTCGCTCGA
AGTCTGACAACCCACTCTATGGGTCTTCACTGATTGAATATGTGAGTGAT
CTTTCATAAATATTTAGGATCATTCTTGATTATTTTCCAGCTCCTAGAAT
TTTGTGTTTCTTTCAGGTTGATCTTTCATAGACATTTAGGATCATTCTTG
ATTATTTTACCAGCTCCTTGAATTTCTTGTTTCTTTCAGG
View all "Dom Sufid" genotypes
DV85 IRGC8839     RA5323 STS112 CAAAGAACTTTCAGATGGGTGTCTCCAACAAGACTCCTGAGTATCTCAAG
ATGAATCCTATTGGGAAGGTTTGAGCAAAACCACCTCTGAATTTTGGTAC
ATTTGCACAGAATCTGATTTGGACACGTTTCCTTTCAGGTCCCTATTCTA
GAGACTCCTGATGGTCCTGTTTTTGAAAGCAATGCGATTGCACGATATGG
TAAGTGATACATAGCAAGGATTCCGTTCTTTTAATCCTTTTCTCTCTATT
GCTTGATTTAGTTCTAAGTTCCTCTCATTTTCCTGAAGTTACTCGCTCGA
AGTCTGACAACCCACTCTATGGGTCTTCACTGATTGAATATGTGAGTGAT
CTTTCATAAATATTTAGGATCATTCTTGATTATTTTCCAGCTCCTAGAAT
TTTGTGTTTCTTTCAGGTTGATCTTTCATAGACATTTAGGATCATTCTTG
ATTATTTTACCAGCTCCTTGAATTTCTTGTTTCTTTCAGG
View all "DV85" genotypes
Pankhari 203 IRGC5999     RA4888 STS112 CAAAGAACTTTCAGATGGGTGTCTCCAACAAGACTCCTGAGTATCTCAAG
ATGAATCCTATTGGGAAGGTTTGAGCAAAACCACCTCTGAATTTTGGTAC
ATTTGCACAGAATCTGATTTGGACACGTTTCCTTTCAGGTCCCTATTCTA
GAGACTCCTGATGGTCCTGTTTTTGAAAGCAATGCGATTGCACGATATGG
TAAGTGATACATAGCAAGGATTCCGTTCTTTTAATCCTTTTCTCTCTATT
GCTTGATTTAGTTCTAAGTTCCTCTCATTTTCCTGAAGTTACTCGCTCGA
AGTCTGACAACCCACTCTATGGGTCTTCACTGATTGAATATGTGAGTGAT
CTTTCATAAATATTTAGGATCATTCTTGATTATTTTCCAGCTCCTAGAAT
TTTGTGTTTCTTTCAGGTTGATCTTTCATAGACATTTAGGATCATTCTTG
ATTATTTTACCAGCTCCTTGAATTTCTTGTTTCTTTCAGG
View all "Pankhari 203" genotypes
BJ1 IRGC45195     RA5345 STS112 CAAAGAACTTTCAGATGGGTGTCTCCAACAAGACTCCTGAGTATCTCAAG
ATGAATCCTATTGGGAAGGTTTGAGCAAAACCACCTCTGAATTTTGGTAC
ATTTGCACAGAATCTGATTTGGACACGTTTCCTTTCAGGTCCCTATTCTA
GAGACTCCTGATGGTCCTGTTTTTGAAAGCAATGCGATTGCACGATATGG
TAAGTGATACATAGCAAGGATTCCGTTCTTTTAATCCTTTTCTCTCTATT
GCTTGATTTAGTTCTAAGTTCCTCTCATTTTCCTGAAGTTACTCGCTCGA
AGTCTGACAACCCACTCTATGGGTCTTCACTGATTGAATATGTGAGTGAT
CTTTCATAAATATTTAGGATCATTCTTGATTATTTTCCAGCTCCTAGAAT
TTTGTGTTTCTTTCAGGTTGATCTTTCATAGACATTTAGGATCATTCTTG
ATTATTTTACCAGCTCCTTGAATTTCTTGTTTCTTTCAGG
View all "BJ1" genotypes
Dhala Shaitta PI180060     RA5361 STS112 CAAAGAACTTTCAGATGGGTGTCTCCAACAAGACTCCTGAGTATCTCAAG
ATGAATCCTATTGGGAAGGTTTGAGCAAAACCACCTCTGAATTTTGGTAC
ATTTGCACAGAATCTGATTTGGACACGTTTCCTTTCAGGTCCCTATTCTA
GAGACTCCTGATGGTCCTGTTTTTGAAAGCAATGCGATTGCACGATATGG
TAAGTGATACATAGCAAGGATTCCGTTCTTTTAATCCTTTTCTCTCTATT
GCTTGATTTAGTTCTAAGTTCCTCTCATTTTCCTGAAGTTACTCGCTCGA
AGTCTGACAACCCACTCTATGGGTCTTCACTGATTGAATATGTGAGTGAT
CTTTCATAAATATTTAGGATCATTCTTGATTATTTTCCAGCTCCTAGAAT
TTTGTGTTTCTTTCAGGTTGATCTTTCATAGACATTTAGGATCATTCTTG
ATTATTTTACCAGCTCCTTGAATTTCTTGTTTCTTTCAGG
View all "Dhala Shaitta" genotypes
Davao IRGC8244 japonica   RA4901 STS112 CAAAGAACTTTCAGATGGGTGTCTCCAACAAGACTCCTGAGTATCTCAAG
ATGAATCCTATTGGGAAGGTTTGAGCAAAACCACCTCTGAATTTTGGTAC
ATTTGCACAGAATCTGATTTGGACACGTTTCCTTTCAGGTCCCTATTCTA
GAGACTCCTGATGGTCCTGTTTTTGAAAGCAATGCGATTGCACGATATGG
TAAGTGATACATAGCAAGGATTCCGTTCTTTTAATCCTTTTCTCTCTATT
GCTTGATTTAGTTCTAAGTTCCTCTCATTTTCCTGAAGTTACTCGCTCGA
AGTCTGACAACCCACTCTATGGGTCTTCACTGATTGAATATGTGAGTGAT
CTTTCATAAATATTTAGGATCATTCTTGATTATTTTCCAGCTCCTAGAAT
TTTGTGTTTCTTTCAGGTTGATCTTTCATAGACATTTAGGATCATTCTTG
ATTATTTTACCAGCTCCTTGAATTTCTTGTTTCTTTCAGG
View all "Davao" genotypes
Jhona 349 IRGC6307     RA4979 STS112 CAAAGAACTTTCAGATGGGTGTCTCCAACAAGACTCCTGAGTATCTCAAG
ATGAATCCTATTGGGAAGGTTTGAGCAAAACCACCTCTGAATTTTGGTAC
ATTTGCACAGAATCTGATTTGGACACGTTTCCTTTCAGGTCCCTATTCTA
GAGACTCCTGATGGTCCTGTTTTTGAAAGCAATGCGATTGCACGATATGG
TAAGTGATACATAGCAAGGATTCCGTTCTTTTAATCCTTTTCTCTCTATT
GCTTGATTTAGTTCTAAGTTCCTCTCATTTTCCTGAAGTTACTCGCTCGA
AGTCTGACAACCCACTCTATGGGTCTTCACTGATTGAATATGTGAGTGAT
CTTTCATAAATATTTAGGATCATTCTTGATTATTTTCCAGCTCCTAGAAT
TTTGTGTTTCTTTCAGGTTGATCTTTCATAGACATTTAGGATCATTCTTG
ATTATTTTACCAGCTCCTTGAATTTCTTGTTTCTTTCAGG
View all "Jhona 349" genotypes
Kasalath HO1195     RA5339 STS112 CAAAGAACTTTCAGATGGGTGTCTCCAACAAGACTCCTGAGTATCTCAAG
ATGAATCCTATTGGGAAGGTTTGAGCAAAACCACCTCTGAATTTTGGTAC
ATTTGCACAGAATCTGATTTGGACACGTTTCCTTTCAGGTCCCTATTCTA
GAGACTCCTGATGGTCCTGTTTTTGAAAGCAATGCGATTGCACGATATGG
TAAGTGATACATAGCAAGGATTCCGTTCTTTTAATCCTTTTCTCTCTATT
GCTTGATTTAGTTCTAAGTTCCTCTCATTTTCCTGAAGTTACTCGCTCGA
AGTCTGACAACCCACTCTATGGGTCTTCACTGATTGAATATGTGAGTGAT
CTTTCATAAATATTTAGGATCATTCTTGATTATTTTCCAGCTCCTAGAAT
TTTGTGTTTCTTTCAGGTTGATCTTTCATAGACATTTAGGATCATTCTTG
ATTATTTTACCAGCTCCTTGAATTTCTTGTTTCTTTCAGG
View all "Kasalath" genotypes
Phudugey IRGC32399     RA4939 STS112 CAAAGAACTTTCAGATGGGTGTCTCCAACAAGACTCCTGAGTATCTCAAG
ATGAATCCTATTGGGAAGGTTTGAGCAAAACCACCTCTGAATTTTGGTAC
ATTTGCACAGAATCTGATTTGGACACGTTTCCTTTCAGGTCCCTATTCTA
GAGACTCCTGATGGTCCTGTTTTTGAAAGCAATGCGATTGCACGATATGG
TAAGTGATACATAGCAAGGATTCCGTTCTTTTAATCCTTTTCTCTCTATT
GCTTGATTTAGTTCTAAGTTCCTCTCATTTTCCTGAAGTTACTCGCTCGA
AGTCTGACAACCCACTCTATGGGTCTTCACTGATTGAATATGTGAGTGAT
CTTTCATAAATATTTAGGATCATTCTTGATTATTTTCCAGCTCCTAGAAT
TTTGTGTTTCTTTCAGGTTGATCTTTCATAGACATTTAGGATCATTCTTG
ATTATTTTACCAGCTCCTTGAATTTCTTGTTTCTTTCAGG
View all "Phudugey" genotypes
Mudgo IRGC6663 indica   RA5282 STS112 CAAAGAACTTTCAGATGGGTGTCTCCAACAAGACTCCTGAGTATCTCAAG
ATGAATCCTATTGGGAAGGTTTGAGCAAAACCACCTCTGAATTTTGGTAC
ATTTGCACAGAATCTGATTTGGACACGTTTCCTTTCAGGTCCCTATTCTA
GAGACTCCTGATGGTCCTGTTTTTGAAAGCAATGCGATTGCACGATATGG
TAAGTGATACATAGCAAGGATTCCGTTCTTTTAATCCTTTTCTCTCTATT
GCTTGATTTAGTTCTAAGTTCCTCTCATTTTCCTGAAGTTACTCGCTCGA
AGTCTGACAACCCACTCTATGGGTCTTCACTGATTGAATATGTGAGTGAT
CTTTCATAAATATTTAGGATCATTCTTGATTATTTTCCAGCTCCTAGAAT
TTTGTGTTTCTTTCAGGTTGATCTTTCATAGACATTTAGGATCATTCTTG
ATTATTTTACCAGCTCCTTGAATTTCTTGTTTCTTTCAGG
View all "Mudgo" genotypes
Shoemed PI392539 japonica   RA5123 STS112 CAAAGAACTTTCAGATGGGTGTCTCCAACAAGACTCCTGAGTATCTCAAG
ATGAATCCTATTGGGAAGGTTTGAGCAAAACCACCTCTGAATTTTGGTAC
ATTTGCACAGAATCTGATTTGGACACGTTTCCTTTCAGGTCCCTATTCTA
GAGACTCCTGATGGTCCTGTTTTTGAAAGCAATGCGATTGCACGATATGG
TAAGTGATACATAGCAAGGATTCCGTTCTTTTAATCCTTTTCTCTCTATT
GCTTGATTTAGTTCTAAGTTCCTCTCATTTTCCTGAAGTTACTCGCTCGA
AGTCTGACAACCCACTCTATGGGTCTTCACTGATTGAATATGTGAGTGAT
CTTTCATAAATATTTAGGATCATTCTTGATTATTTTCCAGCTCCTAGAAT
TTTGTGTTTCTTTCAGGTTGATCTTTCATAGACATTTAGGATCATTCTTG
ATTATTTTACCAGCTCCTTGAATTTCTTGTTTCTTTCAGG
View all "Shoemed" genotypes
Early Wataribune CIor9738 japonica   RA5319 STS112 CAAAGAACTTTCAGATGGGTGTCTCCAACAAGACTCCTGAGTATCTCAAG
ATGAATCCTATTGGGAAGGTTTGAGCAAAACCACCTCTGAATTTTGGTAC
ATTTGCACAGAATCTGATTTGGACACGTTTCCTTTCAGGTCCCTATTCTA
GAGACTCCTGATGGTCCTGTTTTTGAAAGCAATGCGATTGCACGATATGG
TAAGTGATACATAGCAAGGATTCCGTTCTTTTAATCCTTTTCTCTCTATT
GCTTGATTTAGTTCTAAGTTCCTCTCATTTTCCTGAAGTTACTCGCTCGA
AGTCTGACAACCCACTCTATGGGTCTTCACTGATTGAATATGTGAGTGAT
CTTTCATAAATATTTAGGATCATTCTTGATTATTTTCCAGCTCCTAGAAT
TTTGTGTTTCTTTCAGGTTGATCTTTCATAGACATTTAGGATCATTCTTG
ATTATTTTACCAGCTCCTTGAATTTCTTGTTTCTTTCAGG
View all "Early Wataribune" genotypes
Chinese PI431222 japonica   RA5295 STS112 CAAAGAACTTTCAGATGGGTGTCTCCAACAAGACTCCTGAGTATCTCAAG
ATGAATCCTATTGGGAAGGTTTGAGCAAAACCACCTCTGAATTTTGGTAC
ATTTGCACAGAATCTGATTTGGACACGTTTCCTTTCAGGTCCCTATTCTA
GAGACTCCTGATGGTCCTGTTTTTGAAAGCAATGCGATTGCACGATATGG
TAAGTGATACATAGCAAGGATTCCGTTCTTTTAATCCTTTTCTCTCTATT
GCTTGATTTAGTTCTAAGTTCCTCTCATTTTCCTGAAGTTACTCGCTCGA
AGTCTGACAACCCACTCTATGGGTCTTCACTGATTGAATATGTGAGTGAT
CTTTCATAAATATTTAGGATCATTCTTGATTATTTTCCAGCTCCTAGAAT
TTTGTGTTTCTTTCAGGTTGATCTTTCATAGACATTTAGGATCATTCTTG
ATTATTTTACCAGCTCCTTGAATTTCTTGTTTCTTTCAGG
View all "Chinese" genotypes
Kamenoo PI403629 japonica   RA4990 STS112 CAAAGAACTTTCAGATGGGTGTCTCCAACAAGACTCCTGAGTATCTCAAG
ATGAATCCTATTGGGAAGGTTTGAGCAAAACCACCTCTGAATTTTGGTAC
ATTTGCACAGAATCTGATTTGGACACGTTTCCTTTCAGGTCCCTATTCTA
GAGACTCCTGATGGTCCTGTTTTTGAAAGCAATGCGATTGCACGATATGG
TAAGTGATACATAGCAAGGATTCCGTTCTTTTAATCCTTTTCTCTCTATT
GCTTGATTTAGTTCTAAGTTCCTCTCATTTTCCTGAAGTTACTCGCTCGA
AGTCTGACAACCCACTCTATGGGTCTTCACTGATTGAATATGTGAGTGAT
CTTTCATAAATATTTAGGATCATTCTTGATTATTTTCCAGCTCCTAGAAT
TTTGTGTTTCTTTCAGGTTGATCTTTCATAGACATTTAGGATCATTCTTG
ATTATTTTACCAGCTCCTTGAATTTCTTGTTTCTTTCAGG
View all "Kamenoo" genotypes
Koshihikari IRGC10907 japonica   RA5337 STS112 CAAAGAACTTTCAGATGGGTGTCTCCAACAAGACTCCTGAGTATCTCAAG
ATGAATCCTATTGGGAAGGTTTGAGCAAAACCACCTCTGAATTTTGGTAC
ATTTGCACAGAATCTGATTTGGACACGTTTCCTTTCAGGTCCCTATTCTA
GAGACTCCTGATGGTCCTGTTTTTGAAAGCAATGCGATTGCACGATATGG
TAAGTGATACATAGCAAGGATTCCGTTCTTTTAATCCTTTTCTCTCTATT
GCTTGATTTAGTTCTAAGTTCCTCTCATTTTCCTGAAGTTACTCGCTCGA
AGTCTGACAACCCACTCTATGGGTCTTCACTGATTGAATATGTGAGTGAT
CTTTCATAAATATTTAGGATCATTCTTGATTATTTTCCAGCTCCTAGAAT
TTTGTGTTTCTTTCAGGTTGATCTTTCATAGACATTTAGGATCATTCTTG
ATTATTTTACCAGCTCCTTGAATTTCTTGTTTCTTTCAGG
View all "Koshihikari" genotypes
Luk Takhar IRGC58286 japonica   RA4977 STS112 CAAAGAACTTTCAGATGGGTGTCTCCAACAAGACTCCTGAGTATCTCAAG
ATGAATCCTATTGGGAAGGTTTGAGCAAAACCACCTCTGAATTTTGGTAC
ATTTGCACAGAATCTGATTTGGACACGTTTCCTTTCAGGTCCCTATTCTA
GAGACTCCTGATGGTCCTGTTTTTGAAAGCAATGCGATTGCACGATATGG
TAAGTGATACATAGCAAGGATTCCGTTCTTTTAATCCTTTTCTCTCTATT
GCTTGATTTAGTTCTAAGTTCCTCTCATTTTCCTGAAGTTACTCGCTCGA
AGTCTGACAACCCACTCTATGGGTCTTCACTGATTGAATATGTGAGTGAT
CTTTCATAAATATTTAGGATCATTCTTGATTATTTTCCAGCTCCTAGAAT
TTTGTGTTTCTTTCAGGTTGATCTTTCATAGACATTTAGGATCATTCTTG
ATTATTTTACCAGCTCCTTGAATTTCTTGTTTCTTTCAGG
View all "Luk Takhar" genotypes
M-202 RA5539 japonica, temperate japonica   RA5539 STS112 CAAAGAACTTTCAGATGGGTGTCTCCAACAAGACTCCTGAGTATCTCAAG
ATGAATCCTATTGGGAAGGTTTGAGCAAAACCACCTCTGAATTTTGGTAC
ATTTGCACAGAATCTGATTTGGACACGTTTCCTTTCAGGTCCCTATTCTA
GAGACTCCTGATGGTCCTGTTTTTGAAAGCAATGCGATTGCACGATATGG
TAAGTGATACATAGCAAGGATTCCGTTCTTTTAATCCTTTTCTCTCTATT
GCTTGATTTAGTTCTAAGTTCCTCTCATTTTCCTGAAGTTACTCGCTCGA
AGTCTGACAACCCACTCTATGGGTCTTCACTGATTGAATATGTGAGTGAT
CTTTCATAAATATTTAGGATCATTCTTGATTATTTTCCAGCTCCTAGAAT
TTTGTGTTTCTTTCAGGTTGATCTTTCATAGACATTTAGGATCATTCTTG
ATTATTTTACCAGCTCCTTGAATTTCTTGTTTCTTTCAGG
View all "M-202" genotypes
Asse Y Pung CIor461 japonica   RA5333 STS112 CAAAGAACTTTCAGATGGGTGTCTCCAACAAGACTCCTGAGTATCTCAAG
ATGAATCCTATTGGGAAGGTTTGAGCAAAACCACCTCTGAATTTTGGTAC
ATTTGCACAGAATCTGATTTGGACACGTTTCCTTTCAGGTCCCTATTCTA
GAGACTCCTGATGGTCCTGTTTTTGAAAGCAATGCGATTGCACGATATGG
TAAGTGATACATAGCAAGGATTCCGTTCTTTTAATCCTTTTCTCTCTATT
GCTTGATTTAGTTCTAAGTTCCTCTCATTTTCCTGAAGTTACTCGCTCGA
AGTCTGACAACCCACTCTATGGGTCTTCACTGATTGAATATGTGAGTGAT
CTTTCATAAATATTTAGGATCATTCTTGATTATTTTCCAGCTCCTAGAAT
TTTGTGTTTCTTTCAGGTTGATCTTTCATAGACATTTAGGATCATTCTTG
ATTATTTTACCAGCTCCTTGAATTTCTTGTTTCTTTCAGG
View all "Asse Y Pung" genotypes
Nep Hoa Vang IRGC40748 japonica   RA4945 STS112 CAAAGAACTTTCAGATGGGTGTCTCCAACAAGACTCCTGAGTATCTCAAG
ATGAATCCTATTGGGAAGGTTTGAGCAAAACCACCTCTGAATTTTGGTAC
ATTTGCACAGAATCTGATTTGGACACGTTTCCTTTCAGGTCCCTATTCTA
GAGACTCCTGATGGTCCTGTTTTTGAAAGCAATGCGATTGCACGATATGG
TAAGTGATACATAGCAAGGATTCCGTTCTTTTAATCCTTTTCTCTCTATT
GCTTGATTTAGTTCTAAGTTCCTCTCATTTTCCTGAAGTTACTCGCTCGA
AGTCTGACAACCCACTCTATGGGTCTTCACTGATTGAATATGTGAGTGAT
CTTTCATAAATATTTAGGATCATTCTTGATTATTTTCCAGCTCCTAGAAT
TTTGTGTTTCTTTCAGGTTGATCTTTCATAGACATTTAGGATCATTCTTG
ATTATTTTACCAGCTCCTTGAATTTCTTGTTTCTTTCAGG
View all "Nep Hoa Vang" genotypes
Norin 20 IRGC418 japonica   RA5302 STS112 CAAAGAACTTTCAGATGGGTGTCTCCAACAAGACTCCTGAGTATCTCAAG
ATGAATCCTATTGGGAAGGTTTGAGCAAAACCACCTCTGAATTTTGGTAC
ATTTGCACAGAATCTGATTTGGACACGTTTCCTTTCAGGTCCCTATTCTA
GAGACTCCTGATGGTCCTGTTTTTGAAAGCAATGCGATTGCACGATATGG
TAAGTGATACATAGCAAGGATTCCGTTCTTTTAATCCTTTTCTCTCTATT
GCTTGATTTAGTTCTAAGTTCCTCTCATTTTCCTGAAGTTACTCGCTCGA
AGTCTGACAACCCACTCTATGGGTCTTCACTGATTGAATATGTGAGTGAT
CTTTCATAAATATTTAGGATCATTCTTGATTATTTTCCAGCTCCTAGAAT
TTTGTGTTTCTTTCAGGTTGATCTTTCATAGACATTTAGGATCATTCTTG
ATTATTTTACCAGCTCCTTGAATTTCTTGTTTCTTTCAGG
View all "Norin 20" genotypes
[ Download ]