grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "IRGC5999" from the experiment "Genome-wide patterns of nucleotide polymorphism in domesticated rice".

E.g., Germplasm "IRGC9542", RA4969, Basmati 1, Marker/locus RM22.

Items 51 to 75 of 99.       Previous | of 4 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
Pankhari 203 IRGC5999     RA4888 STS058 CTCACAGTATCTGACATAGCATCCCACATCCAGGTCCAGATTTCTATTTG
TAGACTAATCACACTCTTATTGTACTACATATAGTTCACTTTCACATCTA
TGATCTGTTCACTGAACCTCTCAGCTAGGCTGTAGTATTATGAACGATGA
TATTTCATCACATTTCATTAATAGCTCCTGTCCTTACTCCTTACCCATGT
AGCCATGTTTATGGGTTTTTCTTGAATGTAGCACGAGATTGAGTATGGAG
GTGACAATGCATTAACTTCACCGAGATCGCAACACGCATTCCAGAATCTC
CAAGCTCCAATGCACATCCCCAACACAAGCACGCAGCAGCCGCCATCTTG
TTCAATCACACCATCAAACCCTTCCAAGGACTCTATGATATTTTCGAAAG
CGCTATCCAGCCCTGTCCGGCAAAACCTGCAACTGTACCATGTACAGCAA
TGCGGTGACACAGGATGCTTTGCAGATGGCATTTTTTGCCCTGGAAACGG
TGACTCGGATCCTGCAGCATCAAATGATTCGTCGGT
View all "STS058" genotypes
Pankhari 203 IRGC5999     RA4888 STS059 TACAGTGAATTTGATCCATTACACCTCTCCTCTGACCTCTGCAGATTCAA
CCTCTGGTCATACTGAGCTATCTTTGCCAGAGGAAATTAATTCACATGGT
GGCATATCAGCTTCTAGTGGTGAGACATGCTTGGATCCTGAACATTTATT
GGATGTAAATGTGCTTCATTACCAGCTTTATGTTCAGAAAATTTTGTCCG
AAAGTTTAGCTTCTACTAGTTTTTAGTTTCTCATTCTTTTCCATATTGTC
ATGTCATAATTTTTGTAGGCTGTTCCCTTCTCTACATGTCTTACTAATTT
TATCTTGGATTGTTCATTACGCAGAGACTGGCAATCATGATTCCAGCCTG
GAGGAGTTTTGGGCTAATCTTTTAGAGTCATCTATAAAAAACGACCCAAA
AGTTGTTACTTCTGCCTGCGGTGGGATTTTTGACAAAGCTATGACAATTG
ATATTACTGTTGTAGAGTTATAATCCTGCTTATTGTATAAAACAGGTGGT
T
View all "STS059" genotypes
Pankhari 203 IRGC5999     RA4888 STS060 TCACGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAACGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGCAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "STS060" genotypes
Pankhari 203 IRGC5999     RA4888 STS061 AAAAGTGTGATGGATTTCTTCTGCCTAATGCAGGTTGGTTAACATCACGA
AGGAAAAATACTAACTGAAGAGATGTAATAGATTGGATTATTCAAACATA
ATGTCAGATGCGGCTTTAATACTGTTTCAGTTATCATTGATCTTACATTT
TTATCTGGATTTAACATCTGTAGGAAACAAAGGTTATACATGCCAGAAAT
GTAGCACTTCTAGAGATGGGGAAGAGTTACAAAAGATGGCTAGCGATGTA
CTACTATTATCTGACAAAGTCTCTTCCTTAGTTTCATCTGGAAGTATCCT
TTTTCACTATTACTAGATGCTATCTGAGGCAAATGTATATAATTGATTGC
ATCATATTGTTTTGTGATTTT--GTAAAATGCTACCTTAACTTTGGGCAG
TAGATAACAGTGAGGTAGGTTCTATGTACAAGACCATTGAAGAGCTAGAG
CGGAAGCTTTACCATCCTTTGT
View all "STS061" genotypes
Pankhari 203 IRGC5999     RA4888 STS062 AGCTGTTTTGCCTTTTGAAAAACTACGAGTTCTTCTCTTAGGTATTTTTT
GTGATCTGGCTTCCCTTATCTATTCCATAACAAAATATCGAATCTAAGAT
ATTTTCTGTAATATCTGGCTTCCGTTATCTATTTGGGAAAATTGATCATG
CGCCATGAAATGTTTTCCATAATATTTTCTGTTTAAGAACTGCCTTTAAT
TCAAGTAAGTTCAAAATGACTTGCTAATGATCACTTTCAAATGCCTCAGG
ATCTAACCAGATAGATGAGGTCCTTTCTGTGGATTCACTTAACCTCTTTC
CGAGTTTAACAGTAAGCAAGTTTCTTTCTAATGGTTTGTGTTTATTATTC
TGAAATTTAGTATTGATGTTCAATTCCTTTTCTATGAGGTTTGAACAGTT
AGAACTGCAAGATTTTGATACACTGCGATTCTTAGATTTACAAGAATGTT
ATGATGTACACCACACTGTATTTTTATTAGTTATGGCTTAGCACGCCAAT
ACTAATATCTACTTTTCTAAAGGATGTCAGGCTTT
View all "STS062" genotypes
Pankhari 203 IRGC5999     RA4888 STS063 TGGTATTTCATCTACTTTATCTGCCTACGAAACTCTGTTGCTCAGAGGAT
ATGATGTGGGCTCAGTTATTTTGGAAGATCGTGGCTTGTCAAATGACAGA
TTCCTGCTTTCATACTTGAGAAAAAGGTGATTAATGCCTTTCTGTTCATG
GTCAAATCACTCTGGAAGTGTGAAGGAGCATAGAAGCATCTCTTTTATTT
GAATTATATTATCCTGTTAATAATGATT---TCAGTCTTTCATCTGGATA
TATTATAAACCTACTGCAACTTGCTTGTAATGTTGTTGTATTTCAATGTA
TGACTGATGTGTGCTATTTCTGTTATTTAGGGTACCTGTGCATGTCCTGC
CACCAATTCCAGAGGATCCCAAAGATGACCTAACTGATTGGTTTTCTGAG
TCATCCTCAGCTTTTAGTTCACTTAAAGATAGTCTGCAATCTTTTCATTC
AAGAAGAATTCAAAGGCTAAACAGTATGCAGAGAAAATCAAAGGATTTGT
TGTGG
View all "STS063" genotypes
Pankhari 203 IRGC5999     RA4888 STS065 TCTTTAAACATGCTTGCGCCAACTGCAAGCCAGCTTTTGCACACCATGAA
TTGTATATATGCTGTGAAAGGGTAGTCCTCAATAGGTAAACTGGATGCTA
TAGACCCATCCAAAACATTTTCCCCCTTCCATTAGGATATTATCCTGGAA
AAAACAAGTAGTGCTCGGTCCGAATTAGAAAAAGCAGAGATAACGATCAT
TCAATATGCTTGTCAGTGCTTCTTGTGCTCTACTTTTGCAGAAAGTTCAT
GTCCAGATACATTTAGTTTTGTTGATACATCTATTTTTGCTCTCCATAGC
TTGCTGTGTAGACTTGTGTATGAGGTAAGACTTGGGTTTTTACCCCTTCT
ATTCTGTTTATAATGCCTATCCAGAATTTATAAATCTGTGTAATCCTTTG
TACCCTTTGGTTGTAGGTTTACATCAGAC
View all "STS065" genotypes
Pankhari 203 IRGC5999     RA4888 STS066 CGAGGATGCTTCTAAAGCTGGTACGCATTCTTCTGCATAATCCAGAAAAG
CCTCCTCACTTCAATTTTTTAGCAATGTCTATAACACGGGATGTGAAAAA
ATAGCATTTTCGATGAATTATCAAATATCAAAATTCATATTTAAAAGCAT
TAAGGTAGAGAACTTATTCCATTTTTCGTTGCCAAGAATAGAATTGTTAT
TAATTTGACTGTCTGCAAATGCATTTAGAAAGCAGTAAATAAATTTATTT
TTGTCTGTTATTCTATTCAAACTTTATACCTTGCTGCACTGTACACTAGT
ACATCATCTTTGATTTTAGCGTGTCTTTGTTTTTTCTCTTCGAGATTATT
GGAGCTTACAAGATTGCTTTGTCTCTGCTTTACAGAGCATAAGTCTGGTC
AACAGATGGGGTATCAGGCTGCATATCCTCCATGGGCAATGCATCCTCCA
CCTTACCATATGCAAGGAATGCCTTACTATCCTGGGCCGTACTACCCTCC
ATATCCTCCAGTGGATGACCCC
View all "STS066" genotypes
Pankhari 203 IRGC5999     RA4888 STS068 GCCACGCGGACGGGGCTCAGGCCGTCGTCGTCGCGCGGCAACCGCGCCCC
GACGTCGTTCCGGTACGCCAACGTCAGCACCGGCGATCTCCCGGCGAGCG
TCGACTGGCGCGGCAAGGGCGCCGTCAACCCCGTCAAGGACCAAGGCGAT
TGCGGTAAGCGTGCGTGGTGTTCGTCCCATTTTGCGTGAGGTGGCGTTCG
CCGCCATGGCGAGCTGAGAGCGTTGTGCTGCGTCGTGCGTGCGTGTGCAG
GGTGTTGCTGGGCGTTCTCGGCGGTGGCGGCCATGGAGGGAGCCGTGAAG
CTGGCCACGGGGAAGCTGGTGTCGCTGTCGGAGCAGCAGCTGGTGTCGTG
CGACGTCAAGGGCGAGGACCAGGGCTGCGAGGGCGGGCTCATGGACGACG
CGTTCGACTTCATCATCAAGAACGGCGGCCTCGCCGCGGAGTCCGACTAC
CCGTACACGGCGAGCGACGACAAGTGCGCCACC
View all "STS068" genotypes
Pankhari 203 IRGC5999     RA4888 STS070 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNATACTGAAATTAACGACTTAATGGAAGCAGTAA
GTGGTCACTGTTATTGCAAAATACGATGCAAA-A-TGTACTGTAGCACAC
TTAAACCATATACATGGTATCTGTAGTATATAGACTGGATATTGTTTGTC
AACCTTTTGATCATGCTGCTTTTCAGAATTCTGTATTGTTTTGAATGTGT
GTGAAAAGTCGGGGCCAACACATTCATGTCAAAAGATTACTTAAACCATT
GGTTTAGTTGAAATGGAGTATGTCATGCANNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNAACCTTTTTGAGTACTACTTCAGG
CTGATGACACCACCTCCACCATCAACTGGGAAGAGTTNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NTAC
View all "STS070" genotypes
Pankhari 203 IRGC5999     RA4888 STS073 AGTTATTGTGGATTCCTCTGATCCAATAGGTGATTTGATAATCATGTGTG
AGTTTTTGTGTTTGTCATTGATCTATATCATCAAAATAATCCTGCCTAAC
CACTTATCCAGGACCGGCTCAAGAGCTTTTCGAGAAGCCTTTCTTCCAGT
CAGTTGCCAGAGCTTTGCGTCCTGGTGGTGTTGTATGTACCCAGGCAGAG
AGCATATGGTTGCATATGCATATTATTGAAGATATTGTAGCTAATTGTCG
CCAAGTTTTTAAAGGCTCAGTGAATTATGCTTGGACAACAGTACCAACAT
ACCCTAGGTATGCTAACTGATTATTTACATGTGGCTGAATTGATATTTCT
TTAGTTCCTAAGCTAATCATGCTTCCAATGCAGTGGTGTTATT
View all "STS073" genotypes
Pankhari 203 IRGC5999     RA4888 STS075 ACTCACATCTACTCAAGGTAGAGTACTCAATTTCTCATTGCTTTCACAGT
GATTTCACTGCTACTAGTGCCATGATCAGGCATTGCAATTTGCAAACCAC
ATTGGAGCTCCTGTAGATTAAATCTACTACTGGTAGTAGCTCATTGCCAT
TTGGTATTTTGATCATGATCCACAGAGGAGGAAGTCTTCTTCTTTTTCTT
GCAAGCCAAGCTCAGCAGCAGCTGACAAGGGATCATATGAAGAGGACTCC
TACTTTGAAGCACCC---TCACACTGCATGGGCAGGCCGGCTCCTGATTC
CTCTCCTGACCCTCTTCTCTCCCAGTTCATCTGCTGCAGCCTCGCTCCTC
CGGTCGATTCGCCGCGCCGCAGCGAAGCCGATGCCGAGGGCCATGGTTCA
TCTTCCTCAGATGATCAAAAAAGGTAAGAATTGTGCAGTTGGTGCTGTTG
GAGCAGCCTGAAATTTGGTAACAATTGTGCTGAATCTGAACAATGCTGAC
TGATCCAAATGCAATCTTTGATGCTTGCAGGAGAG
View all "STS075" genotypes
Pankhari 203 IRGC5999     RA4888 STS077 CTGGTGAAGCAACAGAACAGATTATTAGGCAAGTAGAGAAGATGACTAGA
AATATTGAGCGCGCTTCTCGTGCTAGCAAGGTAATGCCTGTACTGCTGTA
TGCATATATATTGCAGCATTAATAAATTTGGCATTTGCTTTTTTAGTTTT
CCTTGGTTATGCACGTTCCTTTCAGGAATGTTAAAGTGTTCTTTTATTTA
TAGGATGAACCTTCAACGTTGGATATGCCTTACGGAGATGTTAGTCGGAA
ATATCCTGCTGCCAGATCAAGTGATGCTTTTGCTACAGCTGATGGCATAG
CTAAAAGAGCAAGATTTGATACCTCTGCTGCTTTAAACCCACCATTTCAG
GGAGCATCTGATTATTCTAATATGCAGGTTGACAATGAAGCGAATGTGGA
TCATTCCTCTGATCCAGCTCTCTTGAATTGTGATATGTCTCCTGTTGAGA
AGATGATTGAAATGA
View all "STS077" genotypes
Pankhari 203 IRGC5999     RA4888 STS078 AAGGTCAGGCATCTCTTCGGCGTGTGCTTGTTGGTTACTCATTTCGTGAC
TCAGAAGTTGGATATTGCCAGGTAGGCATAAAGCAATGCTTTTCAAATGT
AACTGTTTTATAGAGAAGCTCCATTACTAACACCATGCAATGCAGGGTTT
AAATTATGTAGCTGCATTGTTGTTGCTTGTTATGAAGACAGAGGAAGATG
CATTCTGGATGCTTGCTGTACTACTGGAAAATGTACTTGTCAATGATTGC
TATACTGATAATCTTTCTGGATGCCATGTCGAGCAGAGAGTTTTCAAAGA
CCTCCTAGCTAAAAAGTGCCCCAGGTATTTCCCCCCTGTTATGTTTATGG
CTTTTATGCTATGATTTTTCATCAGTCGCTGGCAATAACAAGCATTACCA
TT-ATAAGATGATTGTGAATCATTGGATTACCCAAATGATGCAGGATTGC
TGCTCATCTTGAAGCAATGGGGTTTGATGTTTCTCTTGTTGCCACAGAAT
GGTTCTTGTG
View all "STS078" genotypes
Pankhari 203 IRGC5999     RA4888 STS079 GGTTCAGTATATCTCCATTTGGGAACAATGCTCCTGCTACTGAGGTGGAT
AAATCACTCTTCAATGTAAAAGTGATCACAGGCCCAAAGAAATCTACAGA
GCAAAAGCTTTCAAATGGGTCTCCACAAAATGTAGTGCACCTGGACATAT
TCAAAGGTAATTCCCCTGAGCTTTTGACTTGGATCATTCAGTTGTAGTTG
AACATATAATAGAATGAGGCGTTTTGGTTTGTCTTGTGAATTGGTGGGAT
AAACAGTTGGTTTTTAATGCAAGATGTAAAGTTGAAGTCTAGTAGTGTTT
GTTTTGCAATTTGCAACGCTCATTTTTGATGCTATCTTATCTTCTGTCTC
TGCGCTCTTTATTTTGTTACAGGAACAAAAGGAGGGGATGTGTGTGAGGA
TGAAGGGATGGTGAAAGATTGCCATCCATTCAGAAAGGGGAGGGATGAAA
TATCTCTAAAACCCATAGAAGTGAGGAAGAAAGTTGGGGGTGGACAGTCA
TGCTCGGATGCAGAGATCGA
View all "STS079" genotypes
Pankhari 203 IRGC5999     RA4888 STS080 CCTTTCTTATGCTTTCTCGGCACTTTTTAGGAAATTGAGTACATTTTATT
CTCTGTAAAACTAGGATAGCAGACAGCTTTTTCGATTCATTTTGTTGTCA
ATTTTCTGAAGGATGTTTCCTTTTCAGGCATTGACACCCCACATGCAAAC
ACTGGTGAAAGATATATCAAGTCCAAAGGCTGGGAGTTTGTTGGGACCTG
CTTTGGGTGATCAGCAACAAGGGAACTTCTCCATTCATCTTTGGAAAACT
GCTTTCCAAGATGCCTTCAGCAGAATATGTCCTCTTCGTGCTGGTGGACA
TGAGTGTGGATGCTTACCAGTGTTGGCAAAACTGGTATGTTTAATCATTG
ATATTTAATTTGAGAAGAATAATCATTTTTGTGAAGTTTATGCATGAGTT
GTTTTATTATTGTCAGGTGATGGAGCACTGTGTAGCTCGTTTAGACGTT
View all "STS080" genotypes
Pankhari 203 IRGC5999     RA4888 STS081 AGGGGATAACTATTGCACTAATGTGATGACCAAGGTCGATTATTTAGAGC
ATGATTCCATGGATGATCAGGCATTGTTTTTGCATGAAAAGAACTTATTT
GTTCCAGAAGGAAGGAGCTCAGACAATTATAATAATGATGCTGCATCAAG
CAATCCACTTATGTGTGATGGTGTTGGTGGAAAAGAATTGGATGATGACT
CCTCCAGTTCGAAGGTATGTGCTTTTGTCTAATTATTCCATTGACAAAGG
GATAATATTGATTCAACACCTTTTAAGTGTTTCTTTACTGAGTGTTTCCA
TGCTTAATGAAAGACAGAAAGCTAACCTTTTTCCCCTTGCAGGGTACACA
TACTGTAAAGTTTGATGGCCAGCTCACCAGCTCTAACGCAACTACTTCAT
CGAGTAAACCTGATCAGCTTTTCTGGATAAATGGCTACATTTGTTCCATT
TGTGGATTTGAACTACCTCCAGGTTTTGAGGAGGAGAGACAAGAACATTC
AGATTTCCACTTGGCTGAAA
View all "STS081" genotypes
Pankhari 203 IRGC5999     RA4888 STS082 GCCGGATGTTCATCATCAACGCCGGTCAAGGATTCAGGCTTCTCTGGAAC
ACCGTCAAGTCCTTCCTCGATCCCAAGACCACAGCCAAGATCCATGTAAT
CCAATCCATCCACAATCTTTTCGATGTCAATGTCACATCGATCATT-CGT
AATTAAGCTACATTTGATCAATTTGCAACTAAACATTACATAATGTTTGC
ATTTATGTGCCCTGTTTTAACCAGGTCCTAGGCAACAAGTACCAGAGCAA
GCTGCTGGAAGTGATTGATCCCAGGTCTGAGCATGAACCTTCTAGAGTTG
TTCGTTCCTGCTTCTATGCAAATGCAAATGGAATCACCTTGAATATTTAT
ATTAAATCTGCTA--ATATCATTATTAAAAAGAACAAGATTGAGCAGCGT
GTTGAGCTCACTCCCTGTTATTTCGAGACAGC
View all "STS082" genotypes
Pankhari 203 IRGC5999     RA4888 STS083 CGCAGAGGTTCGACGGCATCGACGTCCACGACCGATACGCCAACCGCAAC
ACCGTCTTCTTCGACGTGAG--------------------------ATAT
A--ATCTTTCAAAATCCAGAGCAAATCACGATCGATCGAGCAATGTGACT
GAAATTTTGTGT--TG-G--------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
-----------------------------------------TTCTTGGTG
AGATCATCAGATCAACATGAAGGGGCTTGATGGGATCCAGGGCCCGGTGT
ACGTCGGGACAGGGTGCGTGTTCAGGCGGCAGGCGCTGTACGGATACAAC
CCTCCCAAGGGACCCAAGAGGCCCAAGATGGTGACCTGCGACTGCTGCCC
TTGCTTCGGGAGGAAGAAGCGGAAGCACGGCAAGGACGGCCTCCCGGAGG
CCGTCGCCGCCGACGGCGGTGAGCTCCCAAATTCAGAGCTAAGAAAGAAA
TTTTGGTGTGTGAAAATTTTCAGCTGATGGAATAATGCAAGTTTGTATGT
GGTGGATCAGGG
View all "STS083" genotypes
Pankhari 203 IRGC5999     RA4888 STS085 CCATTATGGTGTTGGAATTAAAGGGAAGGAACCCTCAGATTGTGGTGGGT
AAGAGATGGTGGTAGTGGAATCATATCAAAGTGTGGTGCTATTGACTAGA
GAAAAGTTGATGCAGGAAGGAAAAAA--CTGGAGATTGTGGCGGAGGGTT
GGGTTTGGTTTGGCTTTGGCCAGGGATAATAAATGATGGAGCTGTAGCCT
GTAGAATTAGGCCTTGTTTAGTTCCTAAAACAAAAACTTTTCACCCATCA
CATCAAATATTTGGATACATGCGTGGAGTATTAATTATGGACAAAAAGAA
AAACCAATTACACAGTTTACGTGTAAATTGTGAGATGAATCTTTTAAGCC
TAATTGCGCCATGATTTGACAATGTGGTGCTACAGTAAACATTTGCTAAT
GACGGATTAATTAGGCTTAATAAATTTGTCTCGCAGTTTCCTAGCAGAAT
CTGTAATTTGTTTTGTTATTAGACTACGTTTAATACTTCAAATGTATATC
CGTATATCCGATGTGACAACCAAACCCGAAAATTTTC
View all "STS085" genotypes
Pankhari 203 IRGC5999     RA4888 STS086 ATTGAGGATCCGTTTGACCAGGATGACTGGGAACACTATGCTAAGATGAC
CGCTGAAATTGGAGAGCAAGTGCAGATTGTCGGTGATGACCTCCTTGTCA
CCAACCCAACAGTGAGTGCATAGTTTTCTATTACTTCTAAATATGATCTC
TCTTTCAGTGTGGTTGATAATTAATATTAATATATGTTATGCAGAGGGTG
GCAAAGGCAATCCAGGAGAAGTCATGCAATGCTCTTCTGCTGAAGGTATG
GTTCTATTGATTCTTTCCTTCACGTTTAATAGTTTATCTTCCATGTGCGA
ATATATCACCCTTGTCTTTCAACAGGTTAACCAAATTGGATCTGTCACTG
AGAGTATTGAGGCCGTGAAGATGTCAAAGCGTGCTGGCTGGGGTGTGATG
ACCAGCCACAGGAGGTATACTGATATGCTTACCTGTCTTTATTCCTGGTG
GACCTGGTCTGACTACCAACCATTTGTATATTGACTTGTG
View all "STS086" genotypes
Pankhari 203 IRGC5999     RA4888 STS087 CCTCCAGCTTCAAAGGAAGTCGTTGCGAATCTACCAGTTGTAACCGTGAC
AGAAGAAATCATAGCTAGATTGGGCAAAGAGACTCAGTGTGCTGTTTGCC
GGGAGAGCTTGCTGGTGGACGACAAGATGCAGGAGCTACCGTGCAAGCAT
CTTTTCCACCCTCCATGCCTCAAGCCATGGCTGGTAATGTCCACATAACC
CCTTTGAATCATCTGAAAGTAGCCTCGACGCATCGTTACAACTCGGTGTA
GCTGAACATTATACCCATCATGGTTGTGTTGTGTTGCACGCAGGACGAGA
ACAACTCCTGCCCGATCTGCCGGCACGAGCTGAGGACGGACGACCATGTG
TACGAGAGCCGGAAGGAGCGGGAGCGAGAAGAGGAGGAAGACAGGAAGGG
CGCCGCGA
View all "STS087" genotypes
Pankhari 203 IRGC5999     RA4888 STS089 AAGCTGTGAAGGTGGTCGACATTGTGGACACCTTCCGTCTTCAGGTTGCT
CTCACTTCCATTACCTTGGCTCTTGTATATGATACTATCTGCACTTTATT
TTTGTGCTTAAATTCCATGTGTGTTTGGCAGGAGCAACCTCCTTTTGACA
AGAAGCAGTTTGTGACCTTCATGAAGCGCTACATCAAGAACCTCTCCGCC
AAGCTGGATGCGGAAAAGCAAGAGGAATTCAAGAAGAACATTGAGGGTGC
CACCAAGTACTTGCTTGGAAAGCTCAAGGACCTTCAGTTGTAAGTTCACT
A--ATTGCTTGCCACAGGTCCAGGAAATAGTAACATATGTGATGCCATGA
ACATGTCTCACCATTAGTGCCTACAAATTCCAGTTTAAATGATTTGCTAT
GTTCTATCACATTAAATTCTTGAAGCAAT---------------------
-------------------------AAGACTTGTATTCAAACCTGCTTCT
TATGCTGTCTCTTATGATCTGTTTCAGCTTTGT
View all "STS089" genotypes
Pankhari 203 IRGC5999     RA4888 STS090 TACAGGGGGTAAGTTCTTCGACTAACCGATAAATGGTACTCCTATTTTAT
TTCTTTGAACCTCTTGAAATTATGGGAACTTGTAGATAGTTTTGGCTGAT
GGAACAGAGGTGCTCACATCAGTTGTTTTATCAAATGCAACTCCATATAG
AACATTTGTGGTAAGAGCTACTCAGAATATATAACAATGTGAAGATATA-
--CCTGTTCCAATTTTGTAGACACAATGAAACAAATATTTGTACACTAAT
ATATGGTTTCCTTTTCAGGACCTAGTGCCTGCCAATGTTCTTCCAGACAA
CTTCCTCTCTGCTATAAAAACTGCAGATTATAGCTCTGTAAGAACGTACT
TTGAAGCATAACATAATAAATAAGTGTTATAATATTGATTGATAACAATG
TAATATGATTCTGTGGAGAGCAGGCAACAACGAAAATTAATGTGGCTGTT
GACAGGCTGCCACAGTTTTCCTG
View all "STS090" genotypes
Pankhari 203 IRGC5999     RA4888 STS092 GGGTGGCATGGCCCGTATCCTGAACGCAAAACATTTTGAGAGGTTGAGTG
GCTATCTGGAGGATAATAGGGTGGCAGCTTCTGTAGTGCACGGTGGTTAC
ATGGACCCCAAGAAACTGTAAGTTCTGAAAACC-----------------
-----------TGTTGGCCAAGCGTCTGCACACAATTGGTCCCGCACGAT
TTCATTCCCAATTGCTTGCAGGAATATTGAGCCAACCTTACTGCTAAATC
CTCCTGCTGATTCTGATGTCATGACCGAGGAGGTATTTGGCCCGATTCTC
CCAATCATCACGGTACGCACTGACAACGATTGCATAGT-TTCTGGGTGGA
TGATTTCACATACATCTGCAACCTACGACTGAACCAATTTGATCATCCGT
TTGCAGGTAAAGAAGATCGAGGATTGCATCGCGTATTTAAAGTCCAAGCC
GAAACCGATTGCGATGTACGCCTTCACCAA
View all "STS092" genotypes
[ Download ]