grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "IRGC9091" from the experiment "Genome-wide patterns of nucleotide polymorphism in domesticated rice".

E.g., Germplasm "IRGC9542", RA4969, Basmati 1, Marker/locus RM22.

Items 1 to 25 of 103.       of 5 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
JC1 IRGC9091     RA4917 STS072 ATTGGTACGTTTGGGCATGGTGATTTAGATCTGTCTCAAGTTATTGTCCA
ATTATTTGAGTTGTTTCTTTTCTCTTCACAGTGTTGCTCTCTTCTTTTAA
TATGTTCTTCCATGTAAAAAACGATTAATAATAAAATGTCACTACCGAAC
TAAAAGATACAACCTCAAAATGATGGTTTTGTCATTTAAGAAAAACTAAA
GACTTGTTTTCTACCTATAACTGAATTATATTAAGATTCTCCGCCGGGCA
ACTGAATTATATTAAGGGTTTAGAGAAATATATTTTTCCCTCAATTTTCA
TTTTTATTTTAGAGAATGTCTCCCTTTGGCTAGTCACTCTAACATTTATG
TGCCTGTGTAATTTTGTGAACAGGTTTTACTTGGGTCAATGGCTGCTCTT
T
View all "STS072" genotypes
JC1 IRGC9091     RA4917 STS102 TGCAGTCAGTGCTGGCAACAATTATGAAATCGGTAATATGATAGCAGAGG
CTATGAGCAAGGTTGGCAGGAAGGGTGTGGTTACCCTTGAAGAAGGGAGA
AGTTCTGAGAATAATCTCTATGTTGTGGAGGGAATGCAGTTTGAACGTGG
TTATATCTCCCCGTATTTTGTAACTGACAGCGAGAAAATGTCTGCAGAAT
ATGAGAACTGCAAGGTAGCTTCAGCCTGAGCACACATACC-------CCT
GCTGTATGCTGCTTTAATCTGTTTCAGTTTCTTATTGCACTATGTTTCCA
CTATTTTTCAGCTTCTTTTGGTGGACAAAAAAATCACCAACGCAAGGGAT
CTTATCAATGTTTTGGAGGAGGCCATAAGAGGTGCATACCCAATTCTGAT
AATTGCTGAGGATATTGAGCAGGAGGCTCTTGCTACTCTTGTTGTCAACA
AGCTTAGAGGGTCATTGAAAATTGCCGCTATCAAAGCCCCTGGTTT
View all "STS102" genotypes
JC1 IRGC9091     RA4917 STS121 GACTTCCGAAAAGGCCGGCGCCTCCGAGATTTGGCCGGAAATTGACGGAA
TCACAAAAGGTAAGCTCAAGATAGTTCTGTCTGCTTCTCAGAGCTTATGC
TGCCTGCAATCGTCTGCTCTTTCCAACTTTTAAGCCTCAACCTGCAAAGT
TGTGAATTGTCACAGGCTAGAGCAACACACATTTGCCTTGATTGTGGATA
CATATACTTCCTTCCCAAGCCTTTCGAAGAACAGGTAAGATTCACTTCAA
TTCTTTCACAGAGAATCAGTCTTTTGGCACTCACAGCCCGCAAAATCAGG
TGTATCCAACAATTCAACTAGTGCTTTTTATCCATTTCAGCCTGATGAAT
ATGGCTGCCCACAATGCAACGCACCAAAGAAGCGGTTCGCGAAATATGAT
GCAGAAACCGGGAGGGCGATTGGTGGTGCGCTACCACCTATTACAGTGAT
CGTCAGTTTGATAATCGGCAT
View all "STS121" genotypes
JC1 IRGC9091     RA4917 STS111 CCAACCAGCTCGACCAAACCTCCAGGGTACGTACGTGCGTAATCAATCTC
GAGATTAATTAATTGATGGACTCCA-----TCGGTCGAACACCTAACGTG
CAATGTTTCTTCTGCAGCGTTTCCGGCTAGCCGGCGGGCAGGCGAGGAGC
GAGGGGAGGCAGAGGTACGGTGAGGGCGAGTCGTCGGAGTCGGAGACGGA
ACGCGGCGGCGAGGAGTCGTACAACATCCTGAGCGGCTTCGACACCGAGC
TGCTCGCCGAGTCGATGCGCGTCAGCCCGGACATCGCGCGCAAGCTGCAG
GGCCGCAGCGACAAGCGCGGCAACATCGTGCGCGTCCGCCGCGGCGGCCT
CCGCATGCTCCGCCCGGCGACGGAGCGGGTGACCGACGAGGAGATGATGA
GGGGCGCCAACGCCGCCGCCGCCGCC------GGGAACGGGATCGACGAG
GCCGTCTGCTTGATGAAGCTCCGCGAGAACGTCGCCGACC
View all "STS111" genotypes
JC1 IRGC9091     RA4917 STS125 ACGGTGGCGATATTTGGTCTAGGAGCTGTAGGCCTTGCTGTGAGTGTCTG
AACTCACCTTGAATGTTCTCAATTACAATGAGAGATCCATCTAATTACTC
TACATATTGTCTGATTAGGCCGCAGAAGGTGCAAGGATTGCAGGAGCGTC
AAGGATCATTGGCATTGACCTGAACGCCAACAGATTTGAAGAAGGTAAAA
TCCTCTTGATTTACCAGATCATCAGTTTGTTTGATGGTCTTTTAAAGTCA
TCTTATATATTTTGTATATCTTCAGCTAGGAAATTTGGTTGCACTGAATT
TGTGAACCCAAAGGACCATGACAAGCCAGTTCAGCAGGTATGTATGTTCC
CTTACATCAGGAAAAGGAAAATCTGTATCACTTGATTGTACTGATACAGT
GTGTTATGGTAATTTAGGTACTTGCTGAGATGACCAATGGCGGAGTTGAC
CGCAG
View all "STS125" genotypes
JC1 IRGC9091     RA4917 STS022 TGTTGGATCATTATTACAAGAGTGCTGTTTGGCACTGAATAAATTGCATC
CCTAGTTGAACATAAGAGTCAATCTTTGCTTTTCCTCCAGTTAAGCGAGC
TAAGAAGTACGTATATCATACCTGAGCCTGCCTTTTCTTTGCTCTTATGA
AGCTTGCTGGAAAAAACTCACACCATATTATTGAGGCAACTTTCAAAGCA
TTTGCTAGAGCCCTTCGACAAGCAACAGAATATGACTTGCGCCGACGCGG
CACTGTCCCCAGGTTCGTTTTAGCTTATTGCAAATAGCGTTTAGGAAATT
CTATGTTGTGCCCAACTACACTGTTGATGCCTGATTCAAAAACTTCACAC
CTGCTAAGCATATGGTTTATCTCTGACCTTTGCTGATATTGAAACATTAA
CGTATCTTTCTTGACTTGATCGCAGCTCAAAAGGTGTGTTGTCAAGGTCA
TAGTGTTGCAGGTTTGGAAAACAAGGGGTGCATGCTACTGTTCCTTGTAG
ATTGCAATATTCAAAGGAAACAAATGGAATGGCCTCTACAGCT
View all "STS022" genotypes
JC1 IRGC9091     RA4917 STS112 CAAAGAACTTTCAGATGGGTGTCTCCAACAAGACTCCTGAGTATCTCAAG
ATGAATCCTATTGGGAAGGTTTGAGCAAAACCACCTCTGAATTTTGGTAC
ATTTGCACAGAATCTGATTTGGACACGTTTCCTTTCAGGTCCCTATTCTA
GAGACTCCTGATGGTCCTGTTTTTGAAAGCAATGCGATTGCACGATATGG
TAAGTGATACATAGCAAGGATTCCGTTCTTTTAATCCTTTTCTCTCTATT
GCTTGATTTAGTTCTAAGTTCCTCTCATTTTCCTGAAGTTACTCGCTCGA
AGTCTGACAACCCACTCTATGGGTCTTCACTGATTGAATATGTGAGTGAT
CTTTCATAAATATTTAGGATCATTCTTGATTATTTTCCAGCTCCTAGAAT
TTTGTGTTTCTTTCAGGTTGATCTTTCATAGACATTTAGGATCATTCTTG
ATTATTTTACCAGCTCCTTGAATTTCTTGTTTCTTTCAGG
View all "STS112" genotypes
JC1 IRGC9091     RA4917 STS094 ACAAGTTGAGGGTGGAGATCGGGAATTTGCCCGAGGAGAAAATGGGGAAT
GTGCTACAGATTGTGCAGAAGAGGAATACCGATCCGGCGCTAATGGGAGA
GGTTGTTGAGCTTGATTTCGACGAAATGGATGTCGAGACGCTGTGGGAGC
TCGATCGATTTGTGGTCAATTGCAAGAAGGCGCTCAGCAAGAGCCGGAGG
ACTGTCGCGATGAACGGTGATGCTGTTGATGCGACTGCTATTGTTCCAAT
TGAGGACGATACCGTGCAGGTGAATGTGCATCATCAGCCTTCGGTGGTTG
AAATTGGGGACTCGGTATGGCAATGTTGCAATCCTTTGTTCTGTGTAATG
ACTAATGCTTGAATTGTGTTCTCATGTTTTGTTTATGTTGCACTTTTGCA
GGAGAATGACACGCCGGAGAAGAGGGTTTCAGAGGTTGATATGGTTGATG
AGTATGTTGATATTGGCGATGAGATGCC
View all "STS094" genotypes
JC1 IRGC9091     RA4917 STS042 AGGTGGATTCCAATGGTGAAATGGTGAGGACTTGTTGTGCAAACTGAGCC
TAGATTACTGCCATATACGTGTTCCTAAAACTTATGCATTGTGCTCTTAT
AATCACTGTGCTGATATGGTAGTATGTGTTGGTGTATAATT--CAATAAA
TGCTGTATAGCAACTAGCAATAGTCTTTTGATTATAATTTATCCCTATTG
GTTGGGTATAGCTGTGCATCTTTAACTATTAGAATTGTGAATTCGCAAAC
AACTTGTTAATACAGCTAATTGGTAGAATATATCTTGGAATTAGTTATAT
GTTGAGAAATCGAAAAGGAATATGAATATTTCCTGCTCAAAGTACAAACT
ACATACTTCAAAACTTTTAAGAAGTGGTCTTTCAGTTATGCCCAATTAAC
TAGGTGTCTCAACTGTTATTATGTGAAGGGGCAACAGGTTGATAAGTCAA
GAAGCGAAAGGTTAATCCAATTGCCTATTGTTCAGTCCATTTATGGTGCA
ATGAGTAATCAGGAATTGCTGGAAGCTCAAGAGCAAGAATCACAACTTGC
TTATCA
View all "STS042" genotypes
JC1 IRGC9091     RA4917 STS029 CCGGCGAGGGTGCCCCGGCGGCTGACCGCCGCCGAGCTCCTGCCGGTGAC
CCCGACTCCCCCCGCCGCCGAGAGGAGAACCACCCGGAAGCGCAAGTCCG
ACGTCGACTTCGAGGCGGAGTTCGAGCTTTTCGAG------------GAT
GACGACGACGACGATGAGTTCGAGCTTTCCGACGATGGCGACGAGAGTTT
GGCCGTGTCATGTGTGTCGTCCCCCAAGTCGAAGGCAGTACCTTCGTTTT
CTTGTACGATGAGATGGAGAAATCTTGCCTGCTTTCTTGAAGGATTTTCA
CCTGACGGCAACCTGAACTTTACACGATTTCTTCTCCTGCTGTTGATTTC
ATCGATCGCCGGCGGCAGTTTCGTCGGATGTCTCCTCGAGCTCCAGGCCG
CGGCGGCGCGTGGCGGCGGCGGCGGCCGGTCGTCGGAAGGCGAGCAAGAA
GAG---------CAAGTACAGGGGCGTCCGGCGCCGGCCGTCGGGGAGGT
TCGCGGC
View all "STS029" genotypes
JC1 IRGC9091     RA4917 STS005 TCCTCAGTTCCTCCAAGTCCTCCTTACAGAGTAACTGGCATGTATGGAAC
ACCTAGATATCCTGCAGAGAAATCGGTGCTATTGAAAAAGAATAATGTGA
TTCATCGGCAAGGCGTCGGTCGATCCGAAGGCGACGCAAACATGAACCAC
ACCGGCAAAGGAACTGTGGATAAGTGGCTTCAAATGCTCATGGAGGATCA
GCAGCAGCAAGAAGATCCTGCAGCAGCATATCATTCTTCTGAAGATCACA
ACACTGCTGATGAAATCGCTTCAGACGAGCACCAAATGCAAAGCAGAATT
GATGATGAGAGCTGCAGGAATGAGATCACCGAATGCTCCGATGAGATCGT
CGAGGTCGGTGGCGATGGTGCTACTGAGCAGCAGGACAGGTGCAGGAACA
GCTTTGAGATCAAGGAGAGGGGAGAGGAGAAGAAGATCTGGTTCCCAAGG
TCTGACAGCTCCAGGGGTTTCAGGTCTCTG
View all "STS005" genotypes
JC1 IRGC9091     RA4917 STS012 AAAGGTTTCAAGTACAAAAGTCGAAGAGCTCCAAGTAGATGTGGCGTCTA
TGGATGTTGAAATCTCTGCGTTAATGAAGCTATTTAGAAAAATAACAGAA
AACGACCGAGCCCCTTACTCGAGGGAGAGAGCCGATGATTCATCTTTGGA
ATGTGAACCGGTTCAACTTGACGTAAGCTCATTTTTTCCTTGTTATAGTT
TCCTTTCGCTCTTCAACCCAAAGTACGTCATGTAGTTTTACCACCTCTTT
GATGAGCGATTGTTTTT-CCTCAATACAATTGGCTAAACGTCCTACTTGA
TATGGGCAGGATATGGTTGGTGACATCGACATGGAGAAGATGGAGCAGGA
AATGTCTGCATACGCTACAGCTCTCGCTGCCGCGAAAGACAATCCTACTG
A
View all "STS012" genotypes
JC1 IRGC9091     RA4917 STS103 GGTTAATACCTGGCTTCAAAGGCAAGGGCATTTCAACATACTACATAAGA
AGCATTCTGTAAGTACTCTAGCCCAAACTGGCATGTAAAGAAAGTTAAGT
TCAGTAATCAACCTAACCTGGAATGCAGGTTACCTTGCCAGATCAATTCA
TCGAAGGGCTGTCAAGTGCTTGTTTGCAAGGACGAGCACAGATTGTTCCA
GATCCGGAAGTGCTGTCCAAAGACAGCAGTTCCTTAATTTTCTATTTGGA
TGGAGCACATAGCCCAGAAAGTATGGAAATTTGTGCGAAGTGGTTTTCCT
GTGTTACAAGAAAGGATGAACAACAACCAGGCCCTTTGGATCAGCTACAT
ATTGGCACCAATTCTAGGAAGGTATGCCTTGCAGTTGCAGTGAGCCAGTG
AGAGGTCTCTC--------------------TGTGTGTGTGTGTGTGTGT
GTGTGTGTGTGTGTG----------------------GCTCATATCATTG
TTCTTTCTTTCTTATGAGCACTCTTTGTTTGTGATCCTTGCAG
View all "STS103" genotypes
JC1 IRGC9091     RA4917 STS110 TGATGAGAAGAAAGGTACATGCA--ACAAATTAACAATATGATCGATCGA
CGATAACGAACTGAATGGGAAGATTATTTCCTTAGTTATATATACCCACA
CAAATAATTCAATATGTATTGATCGGTCAATCGATCTGTAATTAATTAAT
TTGATCTGTTTTTGTTGAGTATAGTTCGGATGATGAGGAACCGCTCGCTG
ACCAGGGAGGAGGTGGACGCGTTCTGGAGGCGCCAGCAACGGAAGCAGCC
ACCGTCGTCGTCGACGTCGTCGGAGCCCAACGCCACCACCTCGCCGCTCG
CCTCTCCCCGCGCCGCCGCCAACGTCGTCTCGCCGCTCGCATCACCCCAC
GCCGCCGGCGACATCTCGCCGCTCGCCGCCTCTCCCGGCCGCGCGGTATG
TAATTAAACTAATTAAACATGCATCGATATAT--------TCTTGGACTG
AATTAATCAATTAATATAATTAATTCTCTCATGCAGCAGCAGGAGATGAG
TAGTAGTCGTTGCACGTTGG
View all "STS110" genotypes
JC1 IRGC9091     RA4917 STS105 TCCGAGCTCCCACACACATTATCTCCACTATCTCGGATGACAGAGGTTAG
ATTGGTGGCAATGTGTTTTTCCACATATTCTCCATGTTCAATCTTTGTCA
TACTATCCCTACCAGGAAGTAATATAGGTGCATTTTTGTGATACAGGCGA
GGAACCCTGCTATGCTGGTGTCCCCATGTCTACAATTATTGAACAGGGTT
ATGGAGTTGGTGACGTTATTTCGCTTTTGTGGTTCAAGCGCAGTCTTCCT
CGTTACTGCACTCAGTTTATTGAGGTAAACAATTGGTAAAATATGATATG
GATAATCTATTTTTTGAATGATAGTCATTTAGTCTTCATTTGATCCTAGA
AGGATTTCATGTGTCTTGACAGATGTGCATCATGCTTTGTGCTGATCATG
GTCCTTGTGTATCCGGTGCTCACAATTCTATAGTTACTGCTAGGGCTGGA
AAGG
View all "STS105" genotypes
JC1 IRGC9091     RA4917 STS059 TACAGTGAATTTGATCCATTACACCTCTCCTCTGACCTCTGCAGATTCAA
CCTCTGGTCATACTGAGCTATCTTTGCCAGAGGAAATTAATTCACATGGT
GGCATATCAGCTTCTAGTGGTGAGACATGCTTGGATCCTGAACATTTATT
GGATGTAAATGTGCTTCATTACCAGCTTTATGTTCAGAAAATTTTGTCCG
AAAGTTTAGCTTCTACTAGTTTTTAGTTTCTCATTCTTTTCCATATTGTC
ATGTCATAATTTTTGTAGGCTGTTCCCTTCTCTACATGTCTTACTAATTT
TATCTTGGATTGTTCATTACGCAGAGACTGGCAATCATGATTCCAGCCTG
GAGGAGTTTTGGGCTAATCTTTTAGAGTCATCTATAAAAAACGACCCAAA
AGTTGTTACTTCTGCCTGCGGTGGGATTTTTGACAAAGCTATGACAATTG
ATATTACTGTTGTAGAGTTATAATCCTGCTTATTGTATAAAACAGGTGGT
T
View all "STS059" genotypes
JC1 IRGC9091     RA4917 STS010 CACCAAGGTGAGCGTTGGTTGCTTAGCTAATGATATTAGCTTCCTTAATG
-----GCGTTGTTTAGATTGTATTAACGTTTAACTAATCACGCAATGTGT
TCATGGATGGATGCAGGTGAAGATCCTGAGGAGGGAGTCCTACTGGTACA
ACGGCACTGGCTCCGTCGTCACCGTTGATCAGGTACGTACA---------
--------------------AATCTCATAGCCTTCACATGAATCAGTTCA
ATTCTCCTAGTACTCCAATCGATAATCAAAAGGAAGAAATACTTTTAAGC
AATGAATAATAATCAATTAATGGTTGAATTGAATTGACTGGATGCAGGAT
CCCAACACTCGCTACCCGGTGGTGGTTCGGTTCGCCAAGGTGAACTACGC
CGGCGTGTCGACCAACAACTACGCC
View all "STS010" genotypes
JC1 IRGC9091     RA4917 STS015 TTATAATGCCAGACGGCCTATGAAACAAAGGTACTTTTTCTTATGAGGCC
CGAAAGTTTTAGTTTATAGTTAGCTATATGATCCACCTTTGTTAATGCAG
TACAATGCAACATACATGTTCTATATTTTGCAGGTATCACTACAACGTTG
CAGATTCAAGGCTTGTACAACACATTGACAAAGGGAATGAAGATGGTCTG
TTTATCAGTTGCATAACATCTTGCTCAAATCTGTGGGCTCTAATCATGGA
TGCTGGCACTGGGTTCACTTCCCAGGTTTATGAACTTTCACCACATTTTC
TTCACAAGGTGAGTAGCTTGCTCCTTGTTTAACTGGTGGAAAATCTTAGC
AAACTAATCACATAACTTTTCAAGGCAAAGTTACATATAAGGAAGCTCTT
GTATACATTGTCAAATGTGATTCCATGGTTTTCTGGTCATT
View all "STS015" genotypes
JC1 IRGC9091     RA4917 STS045 GCTTGTGGTCCTTACCTCTGTTAAGAGGCAGAACTCGGGTGGATGGGCCT
TTCTGCAGCCATTCACGATCAAGATGTGGACCGTCACTGGACTGTTCTTT
CTTATCATAGGGACAGTAGTTTGGATGCTTGAACATAGAATCAATGATGA
ATTCCGTGGCCCTCCTGCGAAACAGCTTATTACTGTGTTCTGGTAAGGCT
ATAATTTCGTCAGTTTGTATTTATCGC-GTGTACAATTCCTGCAAATATC
ATTCCATGTTTTCTGTCACCATTATCCAGATTCTTGGACGATGAACTGGT
TTTATTTGCCTGACACTTCATGTTCTACTTACTTTGCAGGTTCAGTTTCT
CAACTCTGTTTTTCGCACACAGTGAGTGAAACG-ACAGCTTGTCACATTC
TCGACATTTTCAATAACCATGATGGAATTTTCCAGCTCATAGGAGCTACT
CTTTCTTCTATGTTTATACAGGAGAGGACACCAGGAGCACTCTCGGCC
View all "STS045" genotypes
JC1 IRGC9091     RA4917 STS003 TTCTGGGAATAAAGAAGACAACACCAGCTATCGCATCAGCCATGCCAAAC
TTGAGCCCTGGACTCATCTTCATCATTGCGGCTTGTTTCAGGTATAGTAG
TAGCTGCTTATAGATGAAGCTGCAATTGATGACCTACCTAAGATATATAC
ATTTACCTGAATTATTACATATACTTAAGGTTGGAGAAGTTTGACAAGGG
ATGCAAGTACACAAGAGCCAAGATACTGGGAACGTTGGTGTGCTTGGTGG
GAGCTATGGCCATGAGCTTCTTGCAGAGTCCCGTTTCGTCTTCTCCACAA
CTCACAACAACTAGTTACTATGACTGGATCCTTGGTTGCTTCTACCTTTT
CCTGGCAGTAGTTGTTCTCTCTATCTACACGGTGCTCCAGGTAATCATCA
ATTACTACTAATTCACTCACTCTACATACATGCATG----TAGTTTCATT
GTTAGCTAGCTGCTCATGGATTACTGAAACTTGCAACAATATATACTCAT
GGTATTATTCAGGCAGCGACGTTGGTGAGCTTCCCTGC
View all "STS003" genotypes
JC1 IRGC9091     RA4917 STS073 AGTTATTGTGGATTCCTCTGATCCAATAGGTGATTTGTTAATCATGTGTG
AGTTTTTGTGTTTGTCATTGATCTATATCATCAAAATAATCCTGCCTAAC
CACTTATCCAGGACCGGCTCAAGAGCTTTTCGAGAAGCCTTTCTTCCAGT
CAGTTGCCAGAGCTTTGCGTCCTGGTGGTGTTGTATGTACCCAGGCAGAG
AGCATATGGTTGCATATGCATATTATTGAAGATATTGTAGCTAATTGTCG
CCAAGTTTTTAAAGGCTCAGTGAATTATGCTTGGACAACAGTACCAACAT
ACCCTAGGTATGCTAACTGATTATTTACATGTGGCTGAATTGATATTTCC
TTAGTTCCTAAGCTAACCATGCTTCCAATGCAGTGGTGTTATT
View all "STS073" genotypes
JC1 IRGC9091     RA4917 STS017 CATTTCTTTCTGCTAAACTTTGCAAGACTCGTCCCCTGGTAGTAGCAGCA
GCTATGGAGGTCTCGAAGGAAGCCCCTTCTGCTGACTTTGCCAATCGCCA
GCCTTCCAAAGGTTGTTGCTGAGAACTCCATCTTATTAAATTGATTGATA
TGCCTCTGCGGGTTGCACTGTCTCCAGTTCTAAATTTAATATAACTTTTG
TCCTTGCATGATTCTGTTAGGGGTTCTTGAGACATGGTGCAATGCCGATG
CAGTGTGTTTTGATGTTGATAGCACGGTCTGCTTGGATGAGGGTATTGAT
GAACTCGCTGATTTCTGTGGGGCTGGGAAGGCTGTTGCTGAGTGGACTGC
AAAGTAAATAACATGTTATGAACATTAGTTTTGAAGTGTGTTTGTTGCTT
AGTGCATAAAATTCATTCAGGATGCTCATTGGTTTAATATTCTTAGGGCA
ATGACAGGAAC
View all "STS017" genotypes
JC1 IRGC9091     RA4917 STS063 TGGTATTTCATCTACTTTATCTGCCTACGAAACTCTGTTGCTCAGAGGAT
ATGATGTGGGCTCAGTTATTTTGGAAGATCGTGGCTTGTCGAATGACAGA
TTCCTGCTCTCATACTTGAGAAAGAGGTGATTAATGCCTTTCTGTTCTTT
GTCAAATCACTCTGAAAGTGTGCAGGAGCATAGAAGCATCTCTTTTATTT
TAATTATATTATCCTGTTAATAATAATTATTTCAGTCTTTCATTTGGATA
TATGATAAACCTACTGCAACTTGCTTGTATTGTTTCTGTATTTCAATGTA
TGACTGATTTGTGCTATTTCTGTTATTTAGGGTACCTGTGCATGTCCTGC
CACCAATTCCTGAGGATCCCAAAGACGACCTAACTGATTGGTTTTCTGAG
TCATCCTCAGCTTTTAGTTCACTTAAAGATAGTCTGCAATCTTTTCATTC
ACGAAGAGTTCAAAGGCTAAACAGTATGCAGAGAAAATCAAAGTATTTGT
TGTGG
View all "STS063" genotypes
JC1 IRGC9091     RA4917 STS056 TCATTATTATTGCTTCGTTCGAACTTCCAGTGGAATGTGGCACAACCTTG
ATGATAACCAGGTCTAGCATGATATTTGCCATTACGTGAAGCTTTACTGT
TTCATTTTTAGTTGATAGTTGATAGTCATATCACAACCTTCCATTAGCTG
CTTAATTGGCTATTTTATTTTAATCTTGCGCTTGGCCATATGTATGTGAG
GGAGTACAGTGACTCTAGTGCATGGTGGATGCTACTTTATTCCTCTCGCT
AATTCAGCAGACTTTAGCTTCCCTTGTACTGATCCTTGTGGACAACTTCA
GGTACGCCAAGTCCGTGAGGCAGATGTATTGAGACAGAAAGCATATATGT
TATTTTATGTACGTGACAGAGTTGGGAATCCGACTCCACGCAAGGATAAT
ATCACTGCTAATATGCCAGCCAGGAGAACAATACCTGAAAAGATCTCAGG
TCTGAGTGATATGATCCAGAGCGGCGTAATTGAAGCAAAATTGAATGGTT
CCT
View all "STS056" genotypes
JC1 IRGC9091     RA4917 STS093 TTACTCTTCTCCTTCCATTGTTCTGGCCGCAAGGGGTCATAATGGAGGCA
GGGTCATATTTGATGATTATCGTGAAGCGTATTATTGGCTTCGTCAGAAC
ACTCCTTCTGATGCAAAGATTATGTCATGGTGGGATTATGGATACCAAAT
CACAGCTATGGGGAACAGAACTGTTATTGTTGATAACAACACATGGAATA
ATACACATATAGCTACAGTTGGGCGTGCAATGTCATCCTATGAAGATGAA
GCGTATGAGATAATGCAGTCACTGGATGTGAATTATGTGCTTGTCGTATT
TGGTGGTGTTACTGGTTATTCTTCAGATGACATTAACAAGTAAGTTTATC
CACTGAATCTAGAGCAAATTTTAATAAATCGATGTTATTGGTTTTATTCG
AATTAGTATTGAACATTTTTTCA-AAAACTGAACTACAAAATGGATTCTT
ACTTAGCTGCTTATTTCCAGGTTCTTATGGATGGTGC
View all "STS093" genotypes
[ Download ]