grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "IRGC9091" from the experiment "Genome-wide patterns of nucleotide polymorphism in domesticated rice".

E.g., Germplasm "IRGC9542", RA4969, Basmati 1, Marker/locus RM22.

Items 26 to 50 of 103.       Previous | of 5 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
JC1 IRGC9091     RA4917 STS085 CCATTATGGTGTTGGAATTAAAGGGAAGGAACCCTCAGATTGTGGTGGGT
AAGAGATGGTGGTAGTGGAATCATATCAAAGTGTGGTGCTATTGACTAGA
GAAAAGTTGATGCAGGAAGGAAAAAA--CTGGAGATTGTGGCGGAGGGTT
GGGTTTGGTTTGGCTTTGGCCAGGGATAATAAATGATGGAGCTGTAGCCT
GTAGAATTAGGCCTTGTTTAGTTCCTAAAACAAAAACTTTTCACCCATCA
CATCAAATATTTGGATACATGCGTGGAGTATTAATTATGGACAAAAAGAA
AAACCAATTACACAGTTTACGTGTAAATTGTGAGATGAATCTTTTAAGCC
TAATTGCGCCATGATTTGACAATGTGGTGCTACAGTAAACATTTGCTAAT
GACGGATTAATTAGGCTTAATAAATTTGTCTCGCAGTTTCCTAGCAGAAT
CTGTAATTTGTTTTGTTATTAGACTACGTTTAATACTTCAAATGTATATC
CGTATATCCGATGTGACAACCAAACCCGAAAATTTTC
View all "STS085" genotypes
JC1 IRGC9091     RA4917 STS123 GATGCATCATACACATTTGGCATAATTGGTTCGTCTTTTGTTTT-CTCAA
GTATTTTTTT-GTTAACAGCATGTGTCATCGAATTACTTTGGATCTCTGC
AACATCTCTTCTAGGATTTTACCTAGGTTGCATGAGTCATATAAGATAGA
TCTCAACAAGATTATACTATCAGAAGGACTGGAAACACATCCTCTGTTCT
TGTCAAACATCCTAGCTTTAGGATAAGGGAATACATGAAC----------
--------GGAAAAAATGGGGATCAATGACTTCATGGAAAGAACCACTAT
GTCAAGATATGGTTATAGTG---------TCCGAGCTTGTTGATACTAAA
GTCTTCTGGCTGTGCTTTGCTAGGTGATCTGGGGCAGACATTTAATTCCC
TCTCAACCCTTCAACATTATGAGAAAAGCGAAGGTCAAACTGTTTTATTT
GTTGGGGATTTGTCATATGCTGATAGATATCAACATAATGATGGTGTTCG
TTGGGATTC
View all "STS123" genotypes
JC1 IRGC9091     RA4917 STS033 TATCTGAGAGGTTGGATGTGTGTGATTTTTGCTTTGTTTTCTGTTACATT
GTTCATGAATTAGGTCTAACTAGCTTTCATGTGGTATTTGGAATGTCAGG
TTTATGGGGATCAGAGCTGCCATGGTCACCAATTGCCCCCTTGTTAGTTC
TTTTGCAGCAAATCTTGGTTTTCATGTATCCGGGACTGAAGATTTAGTTG
CACAATCTGGATCTTCCGCTGCTTCTAAGGAGGCTGGAATTATTTCCCAG
GCGTTAAGTCTGCTTGGATTTTCAGAGGGGAATGTTCAGGAGACATCTGA
ATTTGATCTGGTGTTTCTGCATGTTGCCATGGAGAATACAAACAGCAAGT
TGGGAAAATTGGGAATGAAGACTGATCTAAATCGGCTTGATAAATTAGTT
GGTGCAATCATGGAAGCGGCGCCCATAAGTTCAGCTATCGCCTCCCGTAT
TCTTGTATCTGTGATGTTGA
View all "STS033" genotypes
JC1 IRGC9091     RA4917 STS092 GGGTGGCATGGCCCGTATCCTGAACGCAAAACATTTTGAGAGGTTGAGTG
GCTATCTGGAGGATAATAGGGTGGCAGCTTCTGTAGTGCACGGTGGTTAC
ATGGACCCCAAGAAACTGTAAGTTCTGAAAACC-----------------
-----------TGTTGGCCAAGCGTCTGCACACAATTGGTCCCGCACGAT
TTCATTCCCAATTGCTTGCAGGAATATTGAGCCAACCTTACTGCTAAATC
CTCCTGCTGATTCTGATGTCATGACCGAGGAGGTATTTGGCCCGATTCTC
CCAATCATCACGGTACGCACTGACAACGATTGCATAGT-TTCTGGGTGGA
TGATTTCACATACATCTGCAACCTACGACTGAACCAATTTGATCATCCGT
TTGCAGGTAAAGAAGATCGAGGATTGCATCGCGTATTTAAAGTCCAAGCC
GAAACCGATTGCGATGTACGCCTTCACCAA
View all "STS092" genotypes
JC1 IRGC9091     RA4917 STS004 TTATATAGGTATGTAGCAAAAAGAAGCAAAAAATAATAGACTACTTTTAT
CACTTATGTGTTAATGTAAATTCTATTTAATAAAATGGCATGTTTTTTGT
TTTTGGAAAACATGCGAATCTCTTGTTGTTTAAACAGTTGTGAAGTCTTA
TCAGTACACATCTTTGACAAGCGTGATGCTCTTGGATTGCTGGTCAATTC
CTTGTGTGATTATTCTTACATGGATATTTTTGAAGACCAAGTATGGGCTC
AGGAAGTTCATCGGTGTTGGAGTTTGCGTGGCTGGACTTATATTAGTAGT
ATTTTCAGATGTCCATGCCTCTGATCGAGCTAGTAAGGACATAACTTCTC
ATGATGCAATTTGTACTAGTTACAGCAATATATACTTTTTATGTTTTTCT
TTTCACAAATTCTGATCAGTGATCAGAATATAAGTACAGTTTCTGAAATG
TATTGCAGAAGGAC
View all "STS004" genotypes
JC1 IRGC9091     RA4917 STS006 CCCCACCTGCCCCGGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAATGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTATACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTACCAGCTCAGTGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATCGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "STS006" genotypes
JC1 IRGC9091     RA4917 STS053 CCGAGCGCATGAGGGATTGCTTAAGAAATCTTAAGCAGCAGAACAAGGTA
GCATGTAGTTTTAACTTGAAATCATCTTCTATGTTACTCATATTTGTCAG
GCAGATTGACACATATCCTTCATTGCAT----GTGAATACAGATGCAACT
GTAAAGACTTGAGAATTCTATTGTTTGTTGAAACTATACCAAAAATTGTG
TTCTCCCTGTAGTTTTAGAGTGGAATCATTCAATGCTGATATAATCATAT
TATATGTTTGGTATTCAATTTGACCCAATTATGGGCCGTTTTTGCAACAG
GATGACGATGCTAAAGTGAAGAGGGCTTTTCAAACACTCCTTACCTACAT
TGGCAATGTAGCTAAAAATCCTGACGAGGAGAAATTCAGGAAGATCAGAC
TGTCCAACGCTACATTTCAGGTGAAAATAATTACTGTACATATTGACCTG
GTAAAATGATCCGCTGTTATCCTTTCAAGAACAACACGCGACTGATAATC
TGTTTCGGTACAATGCAGGAGAGGGTTGG
View all "STS053" genotypes
JC1 IRGC9091     RA4917 STS119 TCGCCAACCCCGGCGACGCCCTGCTCATCCCTACCCCTTACTACCCCGGG
TAAGCCACTGTTCCATTGCCATTGCCAT------GCATCTAGCTAGCTTG
GGATCGATCGAGCAGAGTGGCAGGCTGAGCTGACATCCATGGCGTGCAGG
TTTGACAGGGACTTGAGGTGGAGGACGGGGGTGAACATCGTGCCGGTGCG
GTGCGACAGCGCGAACGGGTTCCAGGTCACGGTCGCCGCGCTCCAGGCGG
CGTACGACGAGGCCGCCGCGGCGGGGATGCGCGCCCGCGCCGTCCTGATC
ACCAACCCCTCCAACCCGCTCGGCACCACGGTCAGGCGCAAGGTGCTCGA
CGACATCCTCGACTTCGTGTCGCGCAACGACATCCACCTCATCTCCGACG
AGATCTACTCCGGCTCCGTCTTCGCCGCGCCGGACCTCGTCAGCGTGGCG
GAGCTCGTCGAGGCGCGCGACGGCGACGGCATCGCCGGCCGCGT
View all "STS119" genotypes
JC1 IRGC9091     RA4917 STS038 TCCAGCGCCTTTCAAGCCCCCATCCGGGGGTAGCACTAGTGATATCGTCG
AAGCTTCTGGCACAGCAAAACCTGGGGAAGTTGTTTCTGCCGCAGAGAGC
AATGTTGCTTCCAATGTGAACAGCACCATCTCTAGGCCTGTGCCCCCACG
GCCTTGGCAGCAGCAAGGATACGGAAATTCTTATGGAGGTAATCATTAAT
TCTGTAATCGCATAATCAGATACACTTAGTGGCTCAGAATCTTAACCTCT
CGATCAAAATGCAGGTTATGGCTCCAGTATGTATAGTTCGCTTGGTGGGT
TTGGTGGACCTTATAGTAGCGGCGGACTTTACGGAAATAACATGTATTCA
AGTTATGGAGGAGGTTATGGGGGTATGTATGGAAGTTCTGGAATGTACGG
TGGGTCCATGTATAATAGCGGGATGGGAGGTCCCTATGGTGGCTATGGTA
TGGGCATGGGTGCTTACAACCAAGGTCCAAATTCATTTGGGCCACCAGCA
CCACCCC
View all "STS038" genotypes
JC1 IRGC9091     RA4917 STS035 AGAAGACCAAGGATGGCAAGCTCTTCGTCGATGTCCTCAAGGAGGGTGGT
GTCCTCCCGGGCATCAAGGTGGACAAGGGCACCATCGAGGTTGCCGGCAC
CGAGAAGGAGACCACCACCCAGGGCCATGATGACCTTGGCAAGAGATGCG
CCAAGTACTACGAGGCTGGTGCCCGCTTCGCCAAGTGGCGCGCCGTCCTC
AAGATCGGCCCCAACGAGCCGTCGCAGCTCGCCATTGATCTGAATGCGCA
GGGCCTCGCTCGCTACGCCATCATCTGCCAGGAGAACGGGCTGGTGCCGA
TCGTCGAGCCCGAGATCCTTGTTGATGGCCCTCACGACATCGACCGCTGC
GCCTACGTCTCGGAGGTGGTCCTCGCTGCGTGCTACAAGGCCCTCAACGA
GCACCATGTCCTCCTCGAGGGTACCCTCCTCAAGCCCAACATGGTCACCC
CAGGCTCTGACGCCAAGAAGGTGTCTCCCGA
View all "STS035" genotypes
JC1 IRGC9091     RA4917 STS003 TTCTGGGAATAAAGAAGACAACACCAGCTATCGCATCAGCCATGCCAAAC
TTGAGCCCTGGACTCATCTTCATCATTGCGGCTTGTTTCAGGTATAGTAG
TAGCTGCTTATAGATGAAGCTGCAATTGATGACCTACCTAAGATATATAC
ATTTACCTGAATTATTACATATACTTAAGGTTGGAGAAGTTTGACAAGGG
ATGCAAGTACACAAGAGCCAAGATACTGGGAACGTTGGTGTGCTTGGTGG
GAGCTATGGCCATGAGCTTCTTGCAGAGTCCCGTTTCGTCTTCTCCACAA
CTCACAACAACTAGTTACTATGACTGGATCCTTGGTTGCTTCTACCTTTT
CCTGGCAGTAGTTGTTCTCTCTATCTACACGGTGCTCCAGGTAATCATCA
ATTACTACTAATTCACTCACTCTACATACATGCATG----TAGTTTCATT
GTTAGCTAGCTGCTCATGGATTACTGAAACTTGCAACAATATATACTCAT
GGTATTATTCAGGCAGCGACGTTGGTGAGCTTCCCTGC
View all "STS003" genotypes
JC1 IRGC9091     RA4917 STS046 TCGGAGCAAGGGGCGGCGAGGTTCGCGGCGATCCACAAGGTGTTCGGCGC
CAGCAACGCCTCCAAGCTCCTCTCCCACCTCCCCGTCGCCGACCGCTGCG
AGGCCGTCGTCACCATCACCTACGAGGCCCAGGCCAGGCTCCGCGACCCC
GTCTATGGCTGCGTCGCCCAAATCTTCGCCCTCCAGCAGCAGGTACTATT
TCATTTCATGGATGAGAATGAGATGATCTCGTCGCTGCTCGATCGATCGA
TCGATCGATCGCCTCTCGGATTTGTGACTGATTCGTTCGATGCTACATAC
AGGTCGCGATCCTGCAAGCGCAGCTGATGCAGGCGAGGGCGCAGCTGGCG
TGCGGCATCCAGAGCAGCTCGCACTCTCCGGTGAGCTGGCCGGACAGCGG
CAGCATCAGCGCGCTACTCCGGCAGGACATGGCGAGAAGGCCGCCCGGCG
GCGCCCTCGACGACTGCTTCGGCGGCGGCGGCGCGCTGCTGCCGGAGCTC
ATGGCGGCCG
View all "STS046" genotypes
JC1 IRGC9091     RA4917 STS057 CCACTGAGCTACAGGGGAGCGGATATATTTGTGCTGGCATTCTCACTGAT
CAGCAGAGCAAGCTATGAGAATGTTCTCAAGAAGGTAGGTACTATACTCC
ATTTAGTTCAGTTTGGACTCAAAATGTCTGAACATCTGACAACATGAGGA
TAGTGACCACAGATACTGTACCAAGAACTTTACCTTTCCTTCTGACAATG
ACATTTTTAGACCACCTTTGACCAATATTCTTCACATTTTTCTTCTTTAC
AGATATATACTATATGTGCATATGATTTTCACTGGAATATTCTGAGCTAA
TGTTATCTTTTTCTGTTTCTGATCATGCAGTGGATGCCGGAGCTTCGCCG
GTTCGCACCGAATGTTCCAATTGTTCTTGTTGGGACCAAGTTAGGTTTGT
ACCGGATGCAACATTAACTCAACAAAGCTCAGTGCCACTTCCTTTTGCAG
GCTTGTTTCAATGCTCTTAGGTTTTAACCGTGCTTGCTTCCAATTGTTCA
GATCT
View all "STS057" genotypes
JC1 IRGC9091     RA4917 STS066 CGAGGATGCTTCTAAAGCTGGTACGCATTCTTCTGCATAATCCAGAAAAG
CCTCCTCACTTCAATTCTTTAGCAATGTCTATAACACGGGATGTGAAAAA
ATAGCATTTTCGATGAATTATCAAATATCAAAATTCATATTTAAAAGCAT
TAAGGTAGAGAACTTATTCCATTTTTCGTTGCCAAGAATATAATTGTTAT
TAATTTGACTGTCTGCAAATGCATTTAGAAAGCAGTAAATAAATTTATTT
TTGTCTGTTATTCTATTCAAACTTTATACCTTGCTGCACTGTACACTAGT
ACATCATCTTTGATTTTAGCATGTCTTTGTTTTTTCTCTTCGAGATTATT
GGAGCTTACAAGATTGCTTTGTCTCTGCTTTACAGAGCATAAGTCTGGTC
AACAGATGGGGTATCAGGCTGCATATCCTCCATGGGCAATGCATCCTCCA
CCTTACCATATGCAAGGAATGCCTTACTATCCTGGGCCGTACTACCCTCC
ATATCCTCCAGTGGATGACCCC
View all "STS066" genotypes
JC1 IRGC9091     RA4917 STS031 ATTGCCCAGCCAAAGGTTAGAACTTGTTTATCAGTTTGCATTTTGTTTGG
TATCAACTGTCATTATTAGTGGAAAATATTCACCTTTGATTTTTGCAGGG
TGTCCTTCTTTACGGGCCTCCGGGTACAGGAAAAACGCTACTAGCTCGGG
CAGTTGCTCATCACACCGACTGTACCTTTATTAGGGTGTCAGGTTCCGAG
TTGGTTCAGAAGTATATTGGAGAGGGTTCCAGAATGGTTCGTGAACTATT
TGTGATGGCCAGGTAAACATTTTCTGTTGATGATACATTGAAATTTACCA
TATATTCAATGGGATCTGAAAATCCTTCATTGGGAAGGATGCTTGCATTG
CTTTACACTATTCAGTAGGCTGACGTCTTTGGTTTGAATTTTGACAGAGA
GCATGCACCATCCATAATCTTTATGGATGAAATAGACTCCATTGGATCTG
CTAGAATGCAGTCAGGATCTGGGGGT
View all "STS031" genotypes
JC1 IRGC9091     RA4917 STS002 ATTTGCTAACCAACTCACTCAAGGTTACAACAAGAAACTGAAGAGGATGA
TCTACAAGCTGAACCAGGAGATGGGGCCTGAGAGTAGATTTGTTTACGCA
AACACGTACGAGATCGTGATGGAAATCATTCAGCAGTACCGTCAATACGG
TGAGCTTTCTTCCTTGCTGCAGCTACCTCTTGCGAAAACCACCTGCGAAT
GCTGTGCTGCAGTCTGCAGAGCATTAGAAAATGCAGAATATTTCAGTCTT
GCATTTGTCTTCAGGTTTTGAGAATGCGCTGGACCCATGCTGCGGAGGCA
GCTTCCCTCCATTTCTCTGCATCGGCATCGCTAACTCAACCTCCACCTTA
TGCAATGACCGGTCCAAGTACGTCTTCTGGGACGCGTTCCACCCGACCGA
AGCCGTCAACTTCATCGTCGCCGGCAAGCTTCTCGACGGCAACTCCGCCG
TTGCTTCTC
View all "STS002" genotypes
JC1 IRGC9091     RA4917 STS113 CCCCGCCGAGGCCGGCGCCGGCCGCGAGGGCTCCGGTTGTAGCGGAGGCG
GCGGGTTCCGGGAACGGAGCGGCGGCGCATGCGGCGGCTGGCCTCTCGCG
TTGCTCCAGCACGGCGTCGTCCGTGGACGCGGCGGCTCAGGACAGGAGCC
TCGCGTGCCGCTCCGACGTCGCGGAGGTGAGGGAATCGAAACCCTAGAAT
TCGAATTCGAAAAATGATCCCAGATCTCTAATCACCGGTTGCTGAAGCGT
GCGTGCTTTTTGGTGATGTTCTACAGGCAGGCAGCGAGCATGTCCCGGAG
GGCTCCGCGAGCGACTCGGCGAGCGGCCGTGACCGCGAGAGGTGGGAGAA
TTCTCCCTCATTTCCGGCAAATTCTTCTGAATTATGCGTTCTGACATGCC
CCTGACGCCGAATCACCCTCGATTTTTCAAAATTTTCAAATTCCAGGAGA
GAAACAACTCCATCAAGCTTTCTCCCCGGAGAGGTGAGCGATCTGGAGTC
GGATCTGGCTGGAGGACAGAAGCGCAGCCGT
View all "STS113" genotypes
JC1 IRGC9091     RA4917 STS062 AGCTGTTTTGCCTTTTGAAAAACTACGAGTTCTTCTCTTAGGTATTTTTT
GTGATCTGGCTTCCCTTATCTATTCCATAACAAAATATCGAATCTAAGAT
ATTTTCTGTAATATCTGGCTTCCGTTATCTATTTGGGAAAATTGATCATG
CGCCATGAAATGTTTTCCATAATATTTTCTGTTTAAGAACTGCCTTTAAT
TCAAGTAAGTTCAAAATGACTTGCTAATGATCACTTTCAAATGCCTCAGG
ATCTAACCAGATAGATGAGGTCCTTTCTGTGGATTCACTTAACCTCTTTC
CGAGTTTAACAGTAAGCAAGTTTCTTTCTAATGGTTTGTGTTTATTATTC
TGAAATTTAGTATTGATGTTCAATTCCTTTTCTATGAGGTTTGAACAGTT
AGAACTGCAAGATTTTGATACACTGCGATTCTTAGATTTACAAGAATGTT
ATGATGTACACCACACTGTATTTTTATTAGTTATGGCTTAGCACGCCAAT
ACTAATATCTACTTTTCTAAAGGATGTCAGGCTTT
View all "STS062" genotypes
JC1 IRGC9091     RA4917 STS117 AGGAAGAAGATCAGAGTCTTGGTACGTT---CATCAGAAGAATGCTATAG
AGAGAATGGAAGTGATTCAGCTTAGCTTACTGTTTTTGTGTTTGTTT-TG
TTCAGATGCTGACACTGTCAACGGAGAGGTTCATGAATATTCAGAGGGAG
GCCCCTGCGGAGTTCCAGCAGTATCTGGTCCAGGTCACCAAGTACCAGGC
TGCACAGAATTGCAAGGTAGTACGTACGTAAAATATAATTGAACTGGTCG
GTGTATGCAACTCAATCATGATGTCTT------------ACGACGGCGAT
GTCGGTCGTCGCAGACGTGGATCGTGGGGAAGTGGCTGTCGCCGAGGGAG
CAGCGGTGGGCGCCGGCGGGGACGCACTTCCACCAGTTCGTGGTGCCGCC
GATCATCGGGTTCCGGCGGGACTGCACGTACGGGAAGCTCGCCGCGATGA
GGCTGCCGGAGGACGTGGAGGGGCTGGGGACGTGCGAGTACACCATGGGC
CGCGGCGTCGTGCACGCGTGCCACGCCGGCGGCGTC
View all "STS117" genotypes
JC1 IRGC9091     RA4917 STS083 CGCAGAGGTTCGACGGCATCGACGTCCACGACCGATACGCCAACCGCAAC
ACCGTCTTCTTCGACGTGAGCTCTCTCCCACACAAACTAGATGAATATAT
ACAATCTTGAAAAATCCAGAGCAAATCACGATCGATCGAGCAATGTGACT
GAAATTTTGTGTGGTACG--------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
-----------------------------------------TTCTTGGTG
AGATCATCAGATCAACATGAAGGGGCTTGATGGGATCCAGGGCCCGGTGT
ACGTCGGGACAGGGTGCGTGTTCAGGCGGCAGGCGCTGTACGGATACAAC
CCACCCAAGGGACCCAAGAGGCCCAAGATGGTGACCTGCGACTGCTGCCC
TTGCTTCGGGAGGAAGAAGCGGAAGCACGGCAAGGACGGCCTCCCGGAGG
CCGTCGCCGCCGACGGCGGTGAGCTCCCAAATTCAGAGCTAAGAA-GAAA
TTATGGTGTGAGAAAATTTTCAGCTGATGGAATAATGTAAGTTTGTGTGT
GGTGGATCAGGG
View all "STS083" genotypes
JC1 IRGC9091     RA4917 STS089 AAGCTGTGAAGGTGGTCGACATTGTGGACACCTTCCGTCTTCAGGTTGCT
CTCACTTCCATTACCTTGGCTCTTGTATATGATACTATCTGCACTTTATT
TTTGTGCTTAAATTCCATGTGTGTTTGGCAGGAGCAACCTCCTTTTGACA
AGAAGCAGTTTGTGACCTTCATGAAGCGCTACATCAAGAACCTCTCCGCC
AAGCTGGATGCGGAAAAGCAAGAGGAATTCAAGAAGAACATTGAGGGTGC
CACCAAGTACTTGCTTGGAAAGCTCAAGGACCTTCAGTTGTAAGTTCACT
A--ATTGCTTGCCACAGGTCCAGGAAATAGTAACATATGTGATGCCATGA
ACATGTCTCACCATTAGTGCCTACAAATTCCAGTTTAAATGATTTGCTAT
GTTCTATCACATTAAATTCTTGAAGCAAT---------------------
-------------------------AAGACTTGTATTCAAACCTGCTTCT
TATGCTGTCTCTTATGATCTGTTTCAGCTTTGT
View all "STS089" genotypes
JC1 IRGC9091     RA4917 STS086 ATTGAGGATCCGTTTGACCAGGATGACTGGGAACACTATGCTAAGATGAC
CGCTGAAATTGGAGAGCAAGTGCAGATTGTCGGTGATGACCTCCTTGTCA
CCAACCCAACCGTGAGTGCATAGTTTTCTATTACTTCTAACTATGATCTC
TCTTTCAGTGTGGTTGATAATTAATATTAATATATGTTACGCAGAGGGTG
GCAAAGGCAATTCAGGAAAAGTCATGCAATGCTCTTCTGCTGAAGGTATG
GTTCTATTGATTCTTTCCTTCACGTTTAATAGTTTATCTTCCATGTGCGA
ATATATCACCCTTATCTTTCAACAGGTTAACCAAATTGGATCTGTCACTG
AGAGTATTGAGGCCGTGAAGATGTCAAAGCGTGCTGGCTGGGGTGTGATG
ACCAGCCACAGGAGGTATACTGATATGCTTACCTGTCTTTATTCCTGGTG
GACCTGGTCTGACTACCAACAATTTATATATTGACTTGTG
View all "STS086" genotypes
JC1 IRGC9091     RA4917 STS021 TGGTTCCAGTCACTATGACATTGAGGTGGCACCCCGCCGGTTGGAAAGCT
TGATAATTTCTAGCGGTGAGGTCATCTACTCACTCGAGTTCTCATACGTT
GACCACAGTGGGCAGCAGCACACATCAGGCACATGGGGCGGCTATGGCCC
AAATAAAGGGAACAAACGTACTCAGGTGACTATGAATCTTATTATTCAAT
TCTTGCATTTTTCTTCTAGATAAAATGATTGGTATACATTCATTATCTCT
GC-------TAGTGAAATTTATAATAGGTTTATTAGTAGTGTTATGTTAT
TTTGGAACTTCTCTTGCAGATTCAGCTTGGTCTTATAGAGTATGTAACAG
AGGTTTGTGGGACAATCGGACCATTTGATAGGGCACCCGCTGGTGTTATT
ACATCGCTTACGTTTATCACTAACAAGGGAAGCTACGGACCTTTTGGAGA
AGTAAGAGGGACTCCTTTCCACATCCCAGTGCAGGACAATGGCAGCATTG
TTGGTTTTTTTGCGCGTGC
View all "STS021" genotypes
JC1 IRGC9091     RA4917 STS125 ACGGTGGCGATATTTGGTCTAGGAGCTGTAGGCCTTGCTGTGAGTGTCTG
AACTCACCTTGAATGTTCTCAATTACAATGAGAGATCCATCTAATTACTC
TACATATTGTCTGATTAGGCCGCAGAAGGTGCAAGGATTGCAGGAGCGTC
AAGGATCATTGGCATTGACCTGAACGCCAACAGATTTGAAGAAGGTAAAA
TCCTCTTGATTTACCAGATCATCAGTTTGTTTGATGGTCTTTTAAAGTCA
TCTTATATATTTTGTATATCTTCAGCTAGGAAATTTGGTTGCACTGAATT
TGTGAACCCAAAGGACCATGACAAGCCAGTTCAGCAGGTATGTATGTTCC
CTTACATCAGGAAAAGGAAAATCTGTATCACTTGATTGTACTGATACAGT
GTGTTATGGTAATTTAGGTACTTGCTGAGATGACCAATGGCGGAGTTGAC
CGCAG
View all "STS125" genotypes
JC1 IRGC9091     RA4917 STS022 TGTTGGATCATTATTACAAGAGTGCTGTTTGGCACTGAATAAATTGCATC
CCTAGTTGAACATAAGAGTCAATCTTTGCTTTTCCTCCAGTTAAGCGAGC
TAAGAAGTACGTATATCATACCTGAGCCTGCCTTTTCTTTGCTCTTATGA
AGCTTGCTGGAAAAAACTCACACCATATTATTGAGGCAACTTTCAAAGCA
TTTGCTAGAGCCCTTCGACAAGCAACAGAATATGACTTGCGCCGACGCGG
CACTGTCCCCAGGTTCGTTTTAGCTTATTGCAAATAGCGTTTAGGAAATT
CTATGTTGTGCCCAACTACACTGTTGATGCCTGATTCAAAAACTTCACAC
CTGCTAAGCATATGGTTTATCTCTGACCTTTGCTGATATTGAAACATTAA
CGTATCTTTCTTGACTTGATCGCAGCTCAAAAGGTGTGTTGTCAAGGTCA
TAGTGTTGCAGGTTTGGAAAACAAGGGGTGCATGCTACTGTTCCTTGTAG
ATTGCAATATTCAAAGGAAACAAATGGAATGGCCTCTACAGCT
View all "STS022" genotypes
[ Download ]