grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "IRGC26872" from the experiment "Genome-wide patterns of nucleotide polymorphism in domesticated rice".

E.g., Germplasm "IRGC9542", RA4969, Basmati 1, Marker/locus RM22.

Items 26 to 50 of 103.       Previous | of 5 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
Binulawan IRGC26872 indica   RA4871 STS048 AGTTGCTGTAAGCAAAAAAGCCATGATTTTAGCCTATTTTTGGCTATTCC
TGGGTAAGGATCCCTCTCTAGTATTTCCTTTTCACAGCATGCACCCACAA
CATAAGTCAAC--------------CTGAACATTACCATCTGGGCTGGCC
TGTTGTGTATTTTAGCAAAACCAAGCATGA---ATGCATGAATCGTATGC
TGTACTGCTGTGTAGGTGCAAAACTGGAAAGCACACAACTGAGAAACCAA
TCACAAAAGCAGTTCCTACTGAACCATCAAAGGCAGTTCCAGTCCAGACT
TCGAAGCAGAGTGTGGGAGCTGACACTTGCTCAAGGTGCCGTCAAGGTTT
CTTTTGCTCTGACCATGGTGAGTTTCTGTCTATAAGCATAATGCTTGGAT
ACAACTGATTGATCCCCTATTTGGGTGTAAC-------------------
-AGCTGATTGTTTCGTTATTATTTTAACGACTGACATCCCTATGCATTTT
TATGTGTTGATAGAATAAATCGTAACTTTTAATTTAACAGATTATGCACT
GCTATTT
View all "STS048" genotypes
Binulawan IRGC26872 indica   RA4871 STS071 ATATTGATGCATCTGGCAGGAAGAGCACGGTCAGGACTTGTCCCCAGCTC
CTAAATTTCTCAATGTTTCAG-TCGAAATTTTTGCTAGTTATTCTTCATG
GTGGTGGCTAGATTTTAAAAAGAAAGCACCATAGGTTTCAAACTTTAAAA
CTTGCAAGAATAATTGCCCCATATTTGTCCAAGTTTCAGTGACAATTTCG
CAGGTTTTGTTCATTCAAAGATTCCATCTGTCAGACTATGCA-------C
TGAATAAACTGACAGATTTTTGTGATGGATGCAGGGGAAGGGTGTGTACC
AATTCGTTGACAAGTACGGCGCAAACGTCGACGGCTACAGGTAACCAAGA
TGAGATATAAAATTAATCTTAAAAGAGTACTTTTACGGTGGTATCTACTT
GT-----TTTAGCAAAAATTGTTTGG
View all "STS071" genotypes
Binulawan IRGC26872 indica   RA4871 STS118 ATCCTCCTCTGTCGATGATTCAGTGACATCTGTAGATTTCTTCCTAGGAG
AGGTCTGGCATTCTTTTCATGCAAAATCTATTGCACCATCTGCCAAATGA
ACATGAATTTACCGATGTTATGCTTCTTACATAAAT-TGTTTGGTCGTTA
TGATGCAGGCCCTTGATTCCTTCAAGGCTGAAAGTGAGTCTGAGCTTAAC
TTGTCAGCTGGAGACATTGTTATTGTCCGGAAGGTAATATACCTCTGCTG
TCCATGTTTTGTAATCTTCAATTGAGTTGCCGATATTGTTCCGATGTTTC
TAAATACAAGTTCCTGGCAGCTAACATATCATAATTGAGCTGTCAGTAAT
CTAATGTGGTCTTGTCCGAACACAGATATCAACCAATGGTTGGGCAGAAG
GCGAATGCAAGGGAAAAGCAGGATGGTTCCCACATGGTTATATCGAAAGA
CGAGAG
View all "STS118" genotypes
Binulawan IRGC26872 indica   RA4871 STS034 ATGAGTACCACAGGTACAGACACGAACGCATTAAGCCCATTCATCTCATG
GCAATCCTCTGTAATGATCTGCTTAACATCTTCTGTTCATTTCTGACAGC
TTTGTCCATGGAAGACTGCCCTACGAGAACATCAAGCCGGACCCTGTCCT
GAAGCACATTCTCAAGAACCTGCGCATCCGCAAACTCGTGAGTTCCTCCA
GACCAGAATCGAAA-CC-AATCTCACATGTCTCATGTAATCGTGTTTTGG
TTCTGAACTGGCACGCGTCCTTGCAGATATTCACCAACGGCGACAAGGAC
CACGCCGTGAGAGCCCTCAAGAGGCTGGGGCTGGAGGACTGCTTCGAGGG
GATCATCTGCTTCGAGACCCTCAACCCGCCGTGCCCGTCGCCGCCGTGCG
ACGGGGAGGCCAGCATCTTCGACATCGCCGGACACTTCTCCATGCCCGGC
GCCGCCGCCGACGAGCTTCCCAGGACACCCGTCCTCTGCAAGCCCAACGT
CGACGCCATGGAGGAGGCCCTCAGGATCG
View all "STS034" genotypes
Binulawan IRGC26872 indica   RA4871 STS086 ATTGAGGATCCGTTTGACCAGGATGACTGGGAACACTATGCTAAGATGAC
CGCTGAAATTGGAGAGCAAGTGCAGATTGTCGGTGATGACCTCCTTGTCA
CCAACCCAACAGTGAGTGCATAGTTTTCTATTACTTCTAAATATGATCTC
TCTTTCAGTGTGGTTGATAATTAATATTAATATATGTTATGCAGAGGGTG
GCAAAGGCAATCCAGGAGAAGTCATGCAATGCTCTTCTGCTGAAGGTATG
GTTCTATTGATTCTTTCCTTCACGTTTAATAGTTTATCTTCCATGTGCGA
ATATATCACCCTTGTCTTTCAACAGGTTAACCAAATTGGATCTGTCACTG
AGAGTATTGAGGCCGTGAAGATGTCAAAGCGTGCTGGCTGGGGTGTGATG
ACCAGCCACAGGAGGTATACTGATATGCTTACCTGTCTTTATTCCTGGTG
GACCTGGTCTGACTACCAACCATTTGTATATTGACTTGTG
View all "STS086" genotypes
Binulawan IRGC26872 indica   RA4871 STS031 ATTGCCCAGCCAAAGGTTAGAACTTGTTTACCAGTTTGCATTTTGTTTGG
TATCAACTGTCATTATTAGTGGAAAATATTCACCTTTGATTTTTACAGGG
TGTCCTTCTTTACGGGCCTCCGGGTACAGGAAAAACGCTACTAGCTCGGG
CAGTTGCTCATCACACCGACTGTACCTTTATTAGGGTGTCAGGTTCCGAG
TTGGTTCAGAAGTATATTGGAGAGGGTTCCAGAATGGTTCGTGAACTATT
TGTGATGGCCAGGTAAACATTTTCTGTTGATGATACATTGAAATTTACCA
TATATTCAATGGGATCTGAAAATCCTTCATTGGGAAGGATGCTTGCATTG
CTTTACACTATTCAGTAGGCTGACGTCTTTGGTTTGAATTTTGACAGAGA
GCATGCACCATCCATAATCTTTATGGATGAAATAGACTCCATTGGATCTG
CTAGAATGCAGTCAGGATCTGGGGGT
View all "STS031" genotypes
Binulawan IRGC26872 indica   RA4871 STS072 ATTGGTATGTTTGGGCATGGTGATTTAGATCTGTCTT--GTTATTGTCCG
ATTATTTGAGTTGTTTCTTTTCTCTTCACAGTGTTGCTCTCTTCTTTTAA
TATGTTCTTCCATGTAAAAAACGATTAATAATAAA-TGTCACTACAGAAC
TAAAAGGTACAACCTCAAAATGATGGTTTTGTCATTTAAGAAAAACTAAA
GACTTGTTTTCTACCTATAACTGAATTATATTAAGATTCTCCGCCGGGCA
ACTGAATTATATTAAGGGTTTAGAGAAATATATTTTTCCCTCAATTTTCA
TTTTTATTTTAGAGAATGTCTCCCTTTGGCTAGTCACTCTAACATTTATG
TGCCTGTGTAATTTTGTGAACAGGTTTTACTTGGGTCAATGGCTGCTCTT
T
View all "STS072" genotypes
Binulawan IRGC26872 indica   RA4871 STS002 ATTTGCTAACCAACTCACTCAAGGTTACAACAAGAAACTGAAGAGGATGA
TCTACAAGCTGAACCAGGAGATGGGGCCTGAGAGTAGATTTGTTTACGCA
AACACGTACGAGATCGTGATGGAAATCATTCAGCAGTACCGTCAATACGG
TGAGCTTTCTTCCTTGCTGCAGCTACCTCTTGCGAAAACCACCTGCGAAT
GCTGTGCTGCAGTCTGCAGAGCATTAGAAAATGCAGAATATTTCAGTCTT
GCATTTGTCTTCAGGTTTTGAGAATGCGCTGGACCCATGCTGCGGAGGCA
GCTACCCTCCATTTCTCTGCATCGGCATCGCTAACTCAACCTCCACCTTA
TGCAATGACCGGTCCAAGTACGTCTTCTGGGACGCGTTCCACCCGACCGA
AGCCGTCAACTTCATCGTCGCCGGCAAGCTTCTCGACGGCAACTCCGCCG
TTGCTTCTC
View all "STS002" genotypes
Binulawan IRGC26872 indica   RA4871 STS112 CAAAGAACTTTCAGATGGGTGTCTCCAACAAGACTCCTGAGTATCTCAAG
ATGAATCCTATTGGGAAGGTTTGAGCAAAACCACCTCTGAATTTTGGTAC
ATTTGCACAGAATCTGATTTGGACACGTTTCCTTTCAGGTCCCTATTCTA
GAGACTCCTGATGGTCCTGTTTTTGAAAGCAATGTGATTGCACGATATGG
TAAGTGATACATAGCAAGGATTCCGTTCTTTTAATCCTTTTCTCTCTATT
GCTTGATTTAGTTCTAAGTTCCTCTCATTTTCCTGAAGTTACTCGCTCGA
AGTCTGACAACCCACTCTATGGGTCTTCACTGATTGAATATGTGAGTGAT
CTTTCATAAATATTTAGGATCATTCTTGATTATTTTCCAGCTCCTAGAAT
TTTGTGTTTCTTTCAGGTTGATCTTTCATAGACATTTAGGATCATTCTTG
ATTATTTTACCAGCTCCTTGAATTTCTTGTTTCTTTCAGG
View all "STS112" genotypes
Binulawan IRGC26872 indica   RA4871 STS107 CATCAGACGCCTTTTACAGGCTTAGCAACACCAGGGAGCAAATCCAGTCA
TATGTTTTTGATGGTAAGGTTCCTGTATGCTTTGAACATTCATGCATCCG
TTGCATTTGCAGCTTATACTCTTCTGATTACCAGCTTAATTTTTT-CCTC
TATTGTTAAATGCTAACAGAACTTTCTTCCTCATGTTCAGTGATCAGGGC
TAGTGTTCCAAAGATGAACTTGGATGATGCATTTGAGCAGAAGAATGAGA
TCGCAAAAGCTGTGGAAGATGAGCTTGAAAAGGTTTGTGTTCAATAATTG
GTGGTCATCTAGAGTATAATGGAGTTTTATACTGACCTAGTATATATTCT
GTAGGCAATGTCAACGTATGGTTATGAGATTGTGCAAACTCTGATTGTTG
ATATCGAA
View all "STS107" genotypes
Binulawan IRGC26872 indica   RA4871 STS017 CATTTCTTTCTGCTAAACTTTGCAAGACTCGTCCCCTGGTAGTAGCAGCA
GCTATGGAGGTCTCGAAGGAAGCCCCTTCTGCTGACTTTGCCAATCGCCA
GCCTTCCAAAGGTTGTTGCTGAGAACTCCATCTTATTAAATTGATTGATA
TGCCTCTGCGGGTTGCACTGTTTCCAGTTCTAAATTTAATATAACTTTTG
TCCTTGCATGATTCTGTTAGGGGTTCTTGAGACATGGTGCAATGCCGATG
CAGTGTGTTTTGATGTTGATAGCACGGTCTGCTTGGATGAGGGTATTGAT
GAACTCGCTGATTTCTGTGGGGCTGGGAAGGCTGTTGCTGAGTGGACTGC
AAAGTAAATAACATGTTATGAACATTAGTTTTGAAGTGTGTTTGTTGCTT
AGTGCATAAAATTCATTCAGGATGCTCATTGGTTTAATATTCTTAGGGCA
ATGACAGGAAC
View all "STS017" genotypes
Binulawan IRGC26872 indica   RA4871 STS111 CCAACCAGCTCGACCAAACCTCCAGGGTACGTACGTGCGTAATCAATCTC
GAGATTAATTAATTGATGGACTCCA-----TCGGTCGAACACCTAACGTG
CAATGTTTCTTCTGCAGCGTTTCCGGCTAGCCGGCGGGCAGGCGAGGAGC
GAGGGGAGGCAGAGGTACGGCGAGGGCGAGTCGTCGGAGTCGGAGACGGA
ACGCGGCGGCGAGGAGTCGTACAACATCCTGAGCGGCTTCGACACCGAGC
TGCTCGCCGAGTCGATGCGCGTCAGCCCGGACATCGCGCGCAAGCTGCAG
GGCCGCAGCGACAAGCGCGGCAACATCGTGCGCGTCCGCCGCGGCGGCCT
CCGCATGCTCCGCCCGGCGACGGAGCGGGTGACCGACGAGGAGATGATGA
GGGGCGCCAACGCCGCCGCCGCCGCC------GGGAACGGGATCGACGAG
GCCGTCTGCTTGATGAAGCTCCGCGAGAACGTCGCCGACC
View all "STS111" genotypes
Binulawan IRGC26872 indica   RA4871 STS057 CCACTGAGCTACAGGGGAGCGGATATATTTGTGCTGGCATTCTCACTGAT
CAGCAGAGCAAGCTATGAGAATGTTCTCAAGAAGGTAGGTACTATACTCC
ATTTAGTTCAGTTTGGACTCAAAATGTCTGAACATCTGACACCATGAGGA
TAGTGACCACAGATACTGTACCAAGAACTTTACCTTTCCTTGTGACAATG
ACATTTTTAGACCACCTTTGACCAATATTCTTCACATTTTTCTTCTTTAC
AGATATATACTATATGTGCATATGATTTTCACTGGAATATTCTGAGCTAA
TGTTATCTTTTTCTGTTTCTGATCATGCAGTGGATGCCGGAGCTTCGCCG
GTTCGCACCGAATGTTCCAATTGTTCTTGTTGGGACCAAGTTAGGTTTGT
ACCGGATGCAACATTAACTCAACAAAGCTCAGTGCCACTTCCTTTTGCAG
GCTTGTTTCAATGCTCTTAGGTTTTAACCGTGCTTGCTTCCAATTGTTCA
GATCT
View all "STS057" genotypes
Binulawan IRGC26872 indica   RA4871 STS085 CCATTATGGTGTTGGAATTAAAGGGAAGGAACCCTCAGATTGTGGTGGGT
AAGAGATGGTGGTAGTGGAATCATATCAAAGTGTGGTGCTATTGACTAGA
GAAAAGTTGATGCAGGAAGGAAAAAA--CTGGAGATTGTGGCGGAGGGTT
GGGTTTGGTTTGGCTTTGGCCAGGGATAATAAATGATGGAGCTGTAGCCT
GTAGAATTAGGCCTTGTTTAGTTCCCAAAACAAAAACTTTTCACCCATCA
CATCAAATATTTGGACACATGCGTGGAGTATTAATTATGGACAAAAAGAA
AAACCAATTACACAGTTTACGTGTAAATTGTGAGATGAATCTTTTAAGCC
TAATTGCGCCATGATTTGACAATGTGGTGCTACAGTAAACATTTGCTAAT
GACGGATTAATTAGGCTTAATAAATTTGTCTCGCAGTTTCCTAGCAGAAT
CTGTAATTTGTTTTGTTATTAGACTACGTTTAATACTTCAAATGTATATC
CGTATATCCGATGTGACAACCAAACCCGAAAATTTTC
View all "STS085" genotypes
Binulawan IRGC26872 indica   RA4871 STS056 CCATTATTATTGCTTCGTTCGAACTTCCAGTGGAATGTGGCACAACCTTG
ATGATAACCAGGTCTAGCATGATATTTGCCATTACGTGAAGCTTTACTGT
TTCATTTTTAGTTGATAGTTGATAGTCATATCACAACCTTCCATTAGCTG
CTTAATTGGCTATTTTATTTTAATCTTGCGCTTGGCCATATGTATGTGAG
GGAGTACAGTGACTCTAGTGCATGGTGGATGCTACTTTATTCCTCTCGCT
AATTCAGCAGACTTTAGCTTCCCTTGTACTGATCCTTGTGGACAACTTCA
GGTACGCCAAGTCCGTGAGGCAGATGTATTGAGACAGAAAGCATATATGT
TATTTTATGTACGTGACAGAGTTGGGAATCCGACTCCACGCAAGGATAAT
ATCACTGCTAATATGCCAGCCAGGAGAACAATACCTGAAAAGATCTCAGG
TCTGAGTGATATGATCCAGAGCGGCGTAATTGAAGCAAAATTGAACGGTT
CCT
View all "STS056" genotypes
Binulawan IRGC26872 indica   RA4871 STS037 CCCACGAATTCATGAAAAATTCCCAGGTTCAGAATCTATACTTTCATTAT
CTAAATTTAGAAACCAACTGCTGTATAAGACTATAAGATTCAACATAAAT
TGCATAATCTTTCTTGAAGGTTGTAAGGAATCATCCTGGTGACCAAAGTT
ACTGGCATCGCCATAGATCAAAGGGTTCTTGGACTCTTTCCTCTGCAGAC
AATGGGTGGGCTGTGTCTGACACTACAGCAGAAGCACTGAAGGTCATTAT
GTTCTTTGTTCTTTTCCTGGTTACTAATGTAGGCAAATGAGGTATAAAAC
TAGTGTCATATTAATCCAGTCCTAATCGGTGACAGCACATCGAAGAAGCT
CATGCATATAAAAAATATTGGCCTTGATATATTCCCAATTCTGCATAATT
TCTATTATGTCTACCCTAGAAATCTTACATAATTTCATTTCCAGGCTGTA
TTGTTGCTGACAAAGATATCTAGTAGCATGGTTGGGGATCCCATTGAAAG
AGAAAG
View all "STS037" genotypes
Binulawan IRGC26872 indica   RA4871 STS006 CCCCACCTGCCCCTGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAGTGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTGTACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTAGCAGCTCAATGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATTGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "STS006" genotypes
Binulawan IRGC26872 indica   RA4871 STS113 CCCCGCCGAGGCCGGCGCCGGCCGCGAGGGCTCCGGTTGTAGCGGAGGCG
GCGGGTTCCGGGAACGGAGCGGCGGCGCATGCGGCGGCTGGCCTCTCGCG
TTGCTCCAGCACGGCGTCGTCCGTGGACGCGGCGGCTCAGGACAGGAGCC
TCGCGTGCCGCTCCGACGTCGCGGAGGTGAGGGAATCGAAACCCTAGAAT
TCGAATTCGAAAAATGATCCCAGATCTCTAATCACCGGTTGCTGAAGCGT
GCGTGCTTTTTGGTGATGTTCTACAGGCAGGCAGCGAGCATGTCCCGGAG
GGCTCCGCGAGCGACTCGGCGAGCGGCCGTGACCGCGAGAGGTGGGAGAA
TTCTCCCTCATTTCCGGCAAATTCTTCTGAATTATGCGTTCTGACATGCC
CCTGACGCCGAATCACCCTCGATTTTTCAAAATTTTCAAATTCCAGGAGA
GAAACAACTCCATCAAGCTTTCTCCCCGGCGAGGTGAGCGATCTGGAGTC
GGATCTGGCTGGAGGACAGAAGCGCAGCCGT
View all "STS113" genotypes
Binulawan IRGC26872 indica   RA4871 STS053 CCGAGCGCATGAGGGATTGCTTAAGAAATCTTAAGCAGCAGAACAAGGTA
GCATGTAGTTTTAACTTGAAATCATCTTCTATGTTACTCATATTTGTCAG
GCAGATTGACACATATCCTTCATTGCAT----GTGAATACAGATGCAACT
GTAAAGACTTGAGAATTCTATTGTTTGTTGAAACTATACCAAAAATTGTG
TTCTCCCTGTAGTTTTAGAGTGGAATCATTCAATGCTGATATAATCATAT
TATATGTTTGGTATTCAATTTGACCCAATTATGGGCCGTTTTTGCAACAG
GATGACGATGCTAAAGTGAAGAGGGCTTTTCAAACACTCCTTACCTACAT
TGGCAATGTAGCTAAAAATCCTGACGAGGAGAAATTCAGGAAGATCAGAC
TGTCCAACGCTACATTTCAGGTGAAAATAATTACTGTACATATTGACCTG
GTAAAATGATCCGCTGTTATCCTTTCAAGAACAACACGCGACTGATAATC
TGTTTCGGTACAATGCAGGAGAGGGTTGG
View all "STS053" genotypes
Binulawan IRGC26872 indica   RA4871 STS001 CCGCCGAGGAGATGGTCGTCCTCTCCGGCGCCCACACCGTCGGCCGCTCC
TTCTGCTCCTCCTTCCTCGCCCGCATCTGGAACAACACCACCCCCATCGT
ACGTACATAG----------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
CTCG----CCGGCGACGGCGACGGCGAACTCGATCGTCATTTGACAGGGT
TTTAAATCTCCCGCTATAGCTGCCGCTATTTCCCGCTATAGCTGTTTGGG
AAGGGTTCTAGCTATTTGCTGTTATGTACAATTTAGCCACTATAGCTCCA
TTTAGCCCACTATAGCTCCTGCTATAGCTGTTTGAGAAGCTAACCGCTAA
ATGTTTTAGCCCGCTATTTAAAACATTGCCATTTGACCATTTCACCATTG
ACG-GCGGCTCACATG---GCGGCGGCCGGTGTGTTCGATCGTGTGCAGG
TGGACACGGGGCTGAGCCCGGGGTACGCGGCGCTGCTGAGGGCGCTGTGC
CCGTCGAACGCG------TCGGCGACGGCGACGACGGCGATCGACGTGAG
CACGCCGGCGACGCTGGACAACAACTACTACAAGCTGCTGCCGCTCAACC
TGGGGCTCTTCTTCTCCGACAACCAGTTGCGGGTGAACGCGACGCTGGGC
GCGTCGGCGAGCAGCTTCGCGGCGAACGAGACGCTGTGGAAGGAGAAGTT
CGTCGCAGC
View all "STS001" genotypes
Binulawan IRGC26872 indica   RA4871 STS014 CCGGAGGAGGACGAGAAGCTGTTCAACCACATCAGCCGCTATGGCGTCGG
CTGCTGGAGCTCCGTCCCAAAGCTCGCCGGTACGCCCATCGATCAGTGTA
TGCATTAGTAACCAAAAT----GGCAAACTGACAAGCTAAGCTAAACTTG
GGTTAATTA--ATCACTTCTTTTCTCCTGAATAATAATGCTAATTTCTTA
CATCAATGTGTTTATAGTATTTCAGTTTATTATTTCATCAATTTCTGTCC
TGCTGCATAATGCTCACT------ATAGAAATGTGTTTATATC-------
----------------------------------------GTAATTTAGT
TGCTATACCTCTCTCTTTGTATCTCTC----ACTCTCTGACAGTGTGTGA
ATAATATAATGTGTGTTGCTGAGTTGCTGTGTACAGGATTGGAGAGGTGT
GGCAAGAGTTGCAGGCTGAGATGGATCAACTACCTGAGGCCTGATCTCAA
GAGAGGCAGCTTCTCCCAGCAGGAGGAGGAGCTCATCATCAG
View all "STS014" genotypes
Binulawan IRGC26872 indica   RA4871 STS029 CCGGCGAGGGTGCCCCGGCGGCTGACCGCCGCCGAGCTCCTGCCGGTGAC
CCCGACTCCCCCCGCCGCCGAGAGGAGAACCACCCGGAAGCGCAAGTCCG
ACGTCGACTTCGAGGCGGAGTTCGAGCTTTTCGAG------------GAC
GACGACGACGACGATGAGTTCGAGCTTTCCGACGATGGCGACGAGAGTTT
GGCCGTGTCATGTGTGTCGTCCCCCAAGTCGAAGGCAGTACCTTCGTTTT
CTTGTACGATGAGATGGAGAAATCTTGCCTGCTTTCTTGAAGGATTTTCA
CCTGACGGCAACCTGAACTTTACACGATTTCTTCTCCTGCTGTTGATTTC
ATCGATCGCCGGCGGCAGTTTCGTCGGATGTCTCCTCGAGCTCCAGGCCG
CGGCGGCGCGTGGCGGCGGCGGCGGCCGGTCGTCGGAAGGCGAGCAAGAA
GAG---------CAAGTACAGGGGCGTCCGGCGCCGGCCGTCGGGGAGGT
TCGCGGC
View all "STS029" genotypes
Binulawan IRGC26872 indica   RA4871 STS087 CCTCCAGCTTCAAAGGAAGTCGTTGCGAATCTACCAGTTGTAACCGTGAC
AGAAGAAATCATAGCTAGATTGGGCAAAGAGACTCAGTGTGCTGTTTGCC
GGGAGAGCTTGCTGGTGGACGACAAGATGCAGGAGCTACCGTGCAAGCAT
CTTTTCCACCCTCCATGCCTCAAGCCATGGCTGGTAATGTCCACATAACC
CCTTTGAATCATCTGAAAGTAGCCTCGACGCATCGTTACAACTCGGTGTA
GCTGAACATTATACCCATCATGGTTGTGTTGTGTTGCACGCAGGACGAGA
ACAACTCCTGCCCGATCTGCCGGCACGAGCTGAGGACGGACGACCATGTG
TACGAGAGCCGGAAGGAGCGGGAGCGAGAAGAGGAGGAAGACAGGAAGGG
CGCCGCGA
View all "STS087" genotypes
Binulawan IRGC26872 indica   RA4871 STS080 CCTTTCTTATGCTTTCTCGGCACTTTTTAGGAAATTGAGTACATTTTATT
CTCCGTAAAACTAGGATAGCAGACAGCTTTTTCGATTCATTTTGTTGTCA
ATTTTCTGAAGGATGTTTCCTTTTCAGGCATTGACACCCCACATGCAAAC
ACTGGTGAAAGATATATCAAGTCCAAAGGCTGGGAGTTTGTTGGGACCTG
CTTTGGGTGATCAGCAACAAGGGAACTTCTCCATTCATCTTTGGAAAACT
GCTTTCCAAGATGCCTTCAGCAGAATATGTCCTCTTCGTGCTGGTGGACA
TGAGTGTGGATGCTTACCAGTGTTGGCAAAACTGGTATGTTTAATCATTG
ATATTTAATTTGAGAAGAATAATCATTTTTGTGAAGTTTATGCATGAGTT
GTTTTATTATTGTCAGGTGATGGAGCACTGTGTAGCTCGTTTAGACGTT
View all "STS080" genotypes
Binulawan IRGC26872 indica   RA4871 STS051 CCTTTCTTGACAGATGCTTTGACAAAGTTTCAGGTAAAGCTTTCCATGAA
CAAAAATACAATCTGTTTATGGTTTCATTGATCAGAGGTAATAGAAATGT
TCTACAAATATTGTTACACACTATTGACCTGGGGTCAGGGGATATTTTAC
CATCTCCTTTATGGAGGACAACCGAACCTTACAATAAACAAAAAAAAGTG
TAACTGAAGAAGTTCATTTGTTTTACAATGTATTCTTCCATCATCTCAAT
TGAAATATGCTATGCTTGTTCTTGGATGAAAAGAGAAATGTCCATTAGCC
ATATGATAAGTTATTTGCTGCTTTTGGTTGGTGTCTGAACATATTATATG
CTTTCGACTTATTAAGACAACTGCTTTTGTTTGTGATTTTCTTCTTGTCC
TTGTTGGTCCAAACTGCCAGTACTTAAA-CACGCACTGCATCCTGCATGA
ATGTTTTCTTATGAGATAACTTGATTTCATTATTTTGTAGGACCCTGCAG
AGGCTGACAAGTTAATGAAAAT
View all "STS051" genotypes
[ Download ]