grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "IRGC38698" from the experiment "Genome-wide patterns of nucleotide polymorphism in domesticated rice".

E.g., Germplasm "IRGC9542", RA4969, Basmati 1, Marker/locus RM22.

Items 51 to 75 of 103.       Previous | of 5 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
NPE 844 IRGC38698 japonica   RA4948 STS066 CGAGGATGCTTCTAAAGCTGGTACGCATTCTTCTGCATAATCCAGAAAAG
CCTCCTCACTTCAATTTTTTAGCAATGTCTATAACACGGGATGTGAAAAA
ATAGCATTTTCGATGAATTATCAAATATCAAAATTCATATTTAAAAGCAT
TAAGGTAGAGAACTTATTCCATTTTTCGTTGCCAAGAATAGAATTGTTAT
TAATTTGACTGTCTGCAAATGCATTTAGAAAGCAGTAAATAAATTTATTT
TTGTCTGTTATTCTATTCAAACTTTATACCTTGCTGCACTGTACACTAGT
ACATCATCTTTGATTTTAGCGTGTCTTTGTTTTTTCTCTTCGAGATTATT
GGAGCTTACAAGATTGCTTTGTCTCTGCTTTACAGAGCATAAGTCTGGTC
AACAGATGGGGTATCAGGCTGCATATCCTCCATGGGCAATGCATCCTCCA
CCTTACCATATGCAAGGAATGCCTTACTATCCTGGGCCGTACTACCCTCC
ATATCCTCCAGTGGATGACCCC
View all "STS066" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS083 CGCAGAGGTTCGACGGCATCGACGTCCACGACCGATACGCCAACCGCAAC
ACCGTCTTCTTCGACGTGAGCTCTCTCCCACACAAACTAGATGAATATAT
ACAATCTTGAAAAATCCAGAGCAAATCACGATCGATCGAGCAATGTGACT
GAAATTTTGTGTGGTACG--------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
-----------------------------------------TTCTTGGTG
AGATCATCAGATCAACATGAAGGGGCTTGATGGGATCCAGGGCCCGGTGT
ACGTCGGGACAGGGTGCGTGTTCAGGCGGCAGGCGCTGTACGGATACAAC
CCACCCAAGGGACCCAAGAGGCCCAAGATGGTGACCTGCGACTGCTGCCC
TTGCTTCGGGAGGAAGAAGCGGAAGCACGGCAAGGACGGCCTCCCGGAGG
CCGTCGCCGCCGACGGCGGTGAGCTCCCAAATTCAGAGCTAAGAA-GAAA
TTATGGTGTGAGAAAATTTTCAGCTGATGGAATAATGTAAGTTTGTGTGT
GGTGGATCAGGG
View all "STS083" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS058 CTCACAGTATCTGACATAGCATCCCACATCCAGGTCCAGATTTCTATTTG
TAGACTAATCACACTCTTATTGTACTACATATAGTTCACTTTCACATCTA
TGATCTGTTCACTGAACCTCTCAGCTAGGCTGTAGTATTATGAACGATGA
TATTTCATCACATTTCATTAATAGCTCCTGTCCTTACTCCTTACCCATGT
AGCCATGTTTATGGGTTTTTCTTGAATGTAGCACGAGATTGAGTATGGAG
GTGACAATGCATTAACTTCACCGAGATCGCAACACGCATTCCAGAATCTC
CAAGCTCCAATGCACATCCCCAACACAAGCACGCAGCAGCCGCCATCTTG
TTCAATCACACCATCAAACCCTTCCAAGGACTCTATGATATTTTCGAAAG
CGCTATCCAGCCCTGTCCGGCAAAACCTGCAACTGTACCATGTACAGCAA
TGCGGTGACACAGGATGCTTTGCAGATGGCATTTTTTGCCCTGGAAACGG
TGACTCGGATCCTGCAGCATCAAATGATTCGTCGGT
View all "STS058" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS077 CTGGTGAAGCAACAGAACAGATTATTAGGCAAGTAGAGAAGATGACTAGA
AATATTGAGCGCGCTTCTCGTGCTAGCAAGGTAATGCCTGTACTGCTGTA
TGCATATATATTGCAGCATTAATAAATTTGGTATTTGCTTTTTTAGTTTT
CCTTGGTTGTGCACGTTCCTTTGAGGAATGTTAAAGTGTTCTTTTATTTA
TAGGATGAACCTTCAACGTTGGATATGCCTTACGGAGATGTTAGTCGGAA
ATATCCTGCTGCCAGATCAAGTGATGCTTTTGCTACAGCTGATGGCGTAG
CTAAAAGAGCAAGATTTGATACCTCTGCTGCTTTAAACCCACCATTTCAG
GGAGCATCTGATTATTCTAATATGCAGGTTGACAATGAAGCGAATGTGGA
TCATTCCTCTGATCCAGCTCTCTTGAATTGTGATATGTCTCCTGTTGAGA
AGATGATTGAAATGA
View all "STS077" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS047 GACGCCGGGCTGTACATGATCCTGCGCATTGGGCCGTTCGTCGCCGCAGA
ATGGACCTTCGGGTTTGCCTCTTCGTTATACTGATGCAGTGTCACGATTG
GTTGTAGTTGTGCAGAATTATGGTGATTCGATTTCTCTGGGTTGATGGGT
TTATCCGTTTATGTGTGCGTGGATGTACAGGGGCGTGCCGGTGTGGCTGC
ATTACGCGCCCGGGACGGTGTTCCGGACGAACAATGAGCCGTTCAAGGTG
TGGCGGGCTTGTGAATTTCGTGGCGTTTTATTTGGGGAGTTTGCAAGTTT
GGTGATGGTTATACTGACATTTACTTACGCAGTCTCACATGAAGAGATTC
ACGACGTACATTGTGGATATGATGAAGAAAGAACAATTCTTCGCTTCGCA
GGGTGGGCACATCATCCTAGCTCAGGTCTGGACATTGTCATACTAATCCT
AATTGGGGCGCTGAAACATCAATCTGTTTCTATCAACTTTGAGATAGGTG
TACTTCACAATTGACGGCAGAATTGGTGCACTGTAGGTTGAAAATGAATA
View all "STS047" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS011 GACTTCAGTTTATCACCTTTGCTAGCAGCACAATCAATGACAAAATATAA
CTCAGCTGCACCAACTACTACTGGACCAGCAATCTCCATGCAAGAGGTAA
TTTAACTACGCTGGTTCACTTTCTCATGGTGTTTTCTCTGGATTCATATT
TCATAGAAGTATAACTTTAGGAAGAAAAAGGCTCCACATCCTTTCTTTAT
TTGAAAGATGAATTTACAAGGGTGTGATGGTGTTGGAATTTTTTATTTTG
TGTGCATATACAGTTAATCATTCAGCAACAAGTAATCTCTAGTTCTCTAA
TTTTCTTCACACACATGTACATATTTGTTTCAGACTCTGAAGCCAGGAGT
TTTCTCCAACGCTCAATCTACCCAAAATCTTCCAAGTACTAGTATAGCAA
CGGGGCCTCCTCTCCCTCAGCAATTAGTCCACCCTTACTCTCAGCCTACT
GTACCACTGGCGCCTTTTGCGAATATGATTGGTTATCCGTATTTGGCACA
GAACTACCCTGCTGCTTACCTACCATCAG
View all "STS011" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS121 GACTTCCGAAAAGGCCGGCGCCTCCGAGATTTGGCCGGAAATTGACGGAA
TCACAAAAGGTAAGCTCAAGATAGTTCTGTCTGCTTCTCAGAGCTTATGC
TGCCTGCAATCGTCTGCTCTTTCCAACTTTTAAGCCTCAACCTGCAAAGT
TGTGAATTGTCACAGGCTAGAGCAACACACATTTGCCTTGATTGTGGATA
CATATACTTCCTTCCCAAGCCTTTCGAAGAACAGGTAAGATTCACTTCAA
TTCTTTCACAGAGAATCAGTCTTTTGGCACTCACAGCCCGCAAAATCAGG
TGTATCCAACAATTCAACTAGTGCTTTTTATCCATTTCAGCCTGATGAAT
ATGGCTGCCCACAATGCAACGCACCAAAGAAGCGGTTCGCGAAATATGAT
GCAGAAACCGGGAGGGCGATTGGTGGTGCGCTACCACCTATTACAGTGAT
CGTCAGTTTGATAATCGGCAT
View all "STS121" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS101 GAGATGTCAGAGAAGCCAACGTTGGCATCGCCCCTGAGCTTGCCGGCGTG
ATCGCCGACGAGGTCGACATCATCGTCAACTCAGCAGCAAACACCACTTT
CGACGAGAGGTTTTGTCATTCTCTGAACTGCAGTGTTGCTCCAAAGATGA
GTTCTTAATTGGATCACTTCATGTATAATAAGCATATGAATTGATCACTG
TTGCTGCATTTGGTTCGATTTTGCAGGTACGATGTTGCAATGGACATCAA
CACCGTAGGGCCATTCAGGATAATGAGCTTCGCGCAGCGGTTTCGGAGGC
TGAAGCTGTTCTTGCAAGTGTCAACAGGTCAGAAATGCATGTCAAATGAA
AAGCTCTTGTGCTGAAAACTTGCACTGAAATT-ACCTCCAAAAACCTTAG
ATATATCTCTCTACTGTGGATTTTGAATTTCATGTTTGGCAATCAGCATA
TGTGAACGGACAGAGGCA
View all "STS101" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS023 GAGCAACTCAGGGTATAGATAATCTGAAAACAAACCACTTGAATCCCATG
ATGAAAACCATTTCACACTTCGAGTTTACTGATGATCTGTTCACTTCTGC
AGAAAGAACATTTTGATATCAGGAAAGGTAAAGCGCCCGAAGATGCCATC
GACTGGAATGATTTCAAGTCCATGACCTTCACTCGAGCTGTAAGTTTGAT
GATGATAAACTCAGAAAGCAGCCACAGTAACAGTGTAGTCTGATCATGAT
GAACTCATGGGCACTTTTACTATGCAGGTTATCTTCGAGACATTAAGATT
AGCTACAGTTGTGAATGGGCTGCTGAGGAAAACTACCCAAGATGTTGAAA
TGAATGGTGAGATATGCATGATATATACGCTGCTGCAATTAGCATCTTTT
TGATAAATCTTTGGATAGCCCTAATGCAGTGCTTATTTGTTTCTTCCAGG
GTATGTTATCCCAAAAGGTTGGAGAATATATGTTTACACAAGGGAAATAA
ATTA
View all "STS023" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS016 GAGCGGAGTTACCATCAATGGGAAGCGAGCGGTCGTGGTTGGCCGCAGCA
ACATTGTCGGGCTACCTGTATCCCTGCTTCTTCTGAAGGCGGATGCGACC
GTATCCATTGTTCACTCCCGGACCCCAAACCCTGAAAGTATTGTCCGTGA
AGCAGACATTGTCATTGCAGCGGCTGGCCAGGCTATGATGGTACATTGTT
CTACCACCAAATTATGACATGGTTCATCACAAT--------CCA----CT
GCCCAGTTCTAACTGCAGATTTCTTGGTTGCCAGATCAAAGGAGACTGGA
TCAAACCAGGCGCTGCTGTCATCGACGTTGGGACGAACTCCATCAGTGAC
CCAACCAGGAAATCGGGGTACAGACTCGTCGGCGATGTGGATTTCGCAGA
GGTGAGCAAGGTTGCTGGTCACCTGACTCCAGTCCCAGGTGGCGTTGGCC
CCATGACGGTGGCGATGTTGCTGAAGAACACGG
View all "STS016" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS123 GATGCATCATACACATTTGGCATAATTGGTTCGTCTTTTGTTTT-CTCAA
GTATTTTTTT-GTTAACAGCATGTGTCATCGAATTACTTTGGATCTCTGC
AACATCTCTTCTAGGATTTTACCTAGGTTGCATGAGTCATATAAGATAGA
TCTCAACAAGATTATACTATCAGAAGGACTGGAAACACATCCTCTGTTCT
TGTCAAACATCCTAGCTTTAGGATAAGGGAATACATGAAC----------
--------GGAAAAAATGGGGATCAATGACTTCATGGAAAGAACCACTAT
GTCAAGATATGGTTATAGTG---------TCCGAGCTTGTTGATACTAAA
GTCTTCTGGCTGTGCTTTGCTAGGTGATCTGGGGCAGACATTTAATTCCC
TCTCAACCCTTCAACATTATGAGAAAAGCGAAGGTCAAACTGTTTTATTT
GTTGGGGATTTGTCATATGCTGATAGATATCAACATAATGATGGTGTTCG
TTGGGATTC
View all "STS123" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS068 GCCACGCGGACGGGGCTCAGGCCGTCGTCGTCGCGCGGCAACCGCGCCCC
GACGTCGTTCCGGTACGCCAACGTCAGCACCGGCGATCTCCCGGCGAGCG
TCGACTGGCGCGGCAAGGGCGCCGTCAACCCCGTCAAGGACCAAGGCGAT
TGCGGTAAGCGTGCGTGGTGTTCGTCCCATTTTGCGTGAGGTGGCGTTCG
CCGCCATGGCGAGCTGAGAGCGTTGTGCTGCGTCGTGCGTGCGTGTGCAG
GGTGTTGCTGGGCGTTCTCGGCGGTGGCGGCCATGGAGGGAGCCGTGAAG
CTGGCCACGGGGAAGCTGGTGTCGCTGTCGGAGCAGCAGCTGGTGTCGTG
CGACGTCAAGGGCGAGGACCAGGGCTGCGAGGGCGGGCTCATGGACGACG
CGTTCGACTTCATCATCAAGAACGGCGGCCTCGCCGCGGAGTCCGACTAC
CCGTACACGGCGAGCGACGACAAGTGCGCCACC
View all "STS068" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS082 GCCGGATGTTCATCATCAACGCCGGTCAAGGATTCAGGCTTCTCTGGAAC
ACCGTCAAGTCCTTCCTCGATCCCAAGACCACAGCCAAGATCCATGTAAT
CCAATCCATCCACAATCTTTTCGATGTCAATGTCACATCGATCATT-CGT
AATTAAGCTACATTTGATCAATTTGCAACTAAACATTACATAATGTTTGC
ATTTATGTGCCCTGTTTTAACCAGGTCCTAGGCAACAAGTACCAGAGCAA
GCTGCTGGAAGTGATTGATCCCAGGTCTGAGCATGAACCTTCTAGAGTTG
TTCGTTCCTGCTTCTATGCAAATGCAAATGGAATCACCTTGAATATTTAT
ATTAAATCTGCTA--ATATCATTATTAAAAAGAACAAGATTGAGCAGCGT
GTTGAGCTCACTCCCTGTTATTTCGAGACAGC
View all "STS082" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS045 GCTTGTGGTCCTTACCTCTGTTAAGAGGCAGAACTCGGGTGGATGGGCCT
TTCTGCAGCCATTCACGATCAAGATGTGGACCGTCACTGGACTGTTCTTT
CTTATCATAGGGACAGTAGTTTGGATGCTTGAACATAGAATCAATGATGA
ATTCCGTGGCCCTCCTGCGAAACAGCTTATTACTGTGTTCTGGTAAGGCT
ATAATTTCGTCAGTTTGTATTTATCGC-GTGTACAATTCCTGCAAATATC
ATTCCATGTTTTCTGTCACCATTATCCAGATTCTTGGACGATGAACTGGT
TTTATTTGCCTGACACTTCATGTTCTACTTACTTTGCAGGTTCAGTTTCT
CAACTCTGTTTTTCGCACACAGTGAGTGAAACG-ACAGCTTGTCACATTC
TCGACATTTTCAATAACCATGATGGAATTTTCCAGCTCATAGGAGCTACT
CTTTCTTCTATGTTTATACAGGAGAGGACACCAGGAGCACTCTCGGCC
View all "STS045" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS036 GGCCCCCACCGACAACCTCACCGTCCTCCGCCAAAAGTTCGCCGCCCTCA
ACCTCAACGACGTCGACCTCGTCGCCCTCTCAGGTACTCGTATCACTTCT
CCGGCGAACTCAATTTCG-----GTTCTGCCGTCATGCCCGCCGGAGCTG
ACGACGACGACAATAATGCGAAATGCAGGTGGGCACACGTTCGGGAGGGT
GCAGTGCCAGTTCGTGACGGACAGGCTGTACAACTTCAGCAACACGGGGA
GGCCGGACCCCACCATGGACGCCGCCTACCGGAGCTTCCTGTCGCAGCGG
TGCCCGCCCAACGGGCCGCCGGCGGCGCTCAACGACCTGGACCCGACGAC
GCCGGACACCTTCGACAACCACTACTACACCAACATCGAGGTCAACCGCG
GCTTCCTCCAGTCGGACCAGGAGCTCAAGTCGGCGCCGGAGGCGACCGGG
ACGACGGCGCCCATCGTCGACCGCTTCGCCACCAGCCAGGCCGCCTTCTT
CCGCAGCTTCGCGCAGTCCATGATCAACATGGGCAACCTCTC
View all "STS036" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS032 GGCCTCTGGTGTCCCCATCAAGTTGATGAGTGTGCAGAGTGATGATCTTC
TCACCAAGGTGCAGATACAAGATTTCAATTTCATGCATTACACATGGACA
CATAATCTCACACAAGATTCGACTTGGTTTGATTCTACATGGTTTTAATC
TTCACTCTCCATAATGTACAGATATCGAGAGTTGGAGACGCCACATCTGC
AACTGTCAATTCAGGGTTGTTGCCTGATCTGTCAAATGCAACCTTGGAGG
ATTACCAAGGCTATAACACTGAGGTGGTGAAGGCAGCCCGACTTTGGTAC
AGCTCCATAGGAGGAGAAATGCCACTGGAGATCACTCCTAAAGTAGGTGA
CACAAAACTAGGATTTGCAATCAGCCGTACTGAGGAGGTAAGCTTTCTGT
CGCCACTTCCAGAATATCGACAATATTATGCTTCATCAATTAAGAACAAA
AGAGTTATACATCAAACATTCCATGACACAATGTTTCTTTCAGGGTTTTA
TCTACATATCTTCAGTGTT
View all "STS032" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS092 GGGTGGCATGGCCCGTATCCTGAACGCAAAACATTTTGAGAGGTTGAGTG
GCTATCTGGAGGATAATAGGGTGGCAGCTTCTGTAGTGCACGGTGGTTAC
ATGGACCCCAAGAAACTGTAAGTTCTGAAAACC-----------------
-----------TGTTGGCCAAGCGTCTGCACACAATTGGTCCCGCACGAT
TTCATTCCCAATTGCTTGCAGGAATATTGAGCCAACCTTACTGCTAAATC
CTCCTGCTGATTCTGATGTCATGACCGAGGAGGTATTTGGCCCGATTCTC
CCAATCATCACGGTACGCACTGACAACGATTGCATAGT-TTCTGGGTGGA
TGATTTCACATACATCTGCAACCTACGACTGAACCAATTTGATCATCCGT
TTGCAGGTAAAGAAGATCGAGGATTGCATCGCGTATTTAAAGTCCAAGCC
GAAACCGATTGCGATGTACGCCTTCACCAA
View all "STS092" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS103 GGTTAATACCTGGCTTCAAAGGCAAGGGCATTTCAACATACTACATAAGA
AGCATTCTGTAAGTACTCTAGCCCAAACTGGCATGTAAAGAAAGTTAAGT
TCAGTAATCAACCTAACCTGGAATGCAGGTTACCTTGCCAGATCAATTCA
TCGAAGGGCTGTCAAGTGCTTGTTTGCAAGGACGAGCACAGATTGTTCCA
GATCCGGAAGTGCTGTCCAAAGACAGCAGTTCCTTAATTTTCTATTTGGA
TGGAGCACATAGCCCAGAAAGTATGGAAATTTGTGCGAAGTGGTTTTCCT
GTGTTACAAGAAAGGATGAACAACAACCAGGCCCTTTGGATCAGCTACAT
ATTGGCACCAATTCTAGGAAGGTATGCCTTGCAGTTGCAGTGAGCCAGTG
AGAGGTCTCTC--------------------TGTGTGTGTGTGTGTGTGT
GTGTGTGTGTGTG------------------------GCTCATATCATTG
TTCTTTCTTTCTTATGAGCACTCTTTGTTTGTGATCCTTGCAG
View all "STS103" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS079 GGTTCAGTATATCTCCATTTGGGAACAATGCTCCTGCTACTGAGGTGGAT
AAATCACTCTTCAATGTAAAAGTGATCACAGGCCCAAAGAAATCTACAGA
GCAAAAGCTTTCAAATGGGTCTCCACAAAATGTAGTGCACCTGGACATAT
TCAAAGGTAATTCCCCTGAGCTTTTGACTTGGATCATTCAGTTGTAGTTG
AACATATAATAGAATGAGGCGTTTTGGTTTGTCTTGTGAATTGGTGGGAT
AAACAGTTGGTTTTTAATGCAAGATGTAAAGTTGAAGTCTAGTAGTGTTT
GTTTTGCAATTTGCAACGCTCATTTTTGATGCTATCTTATCTTCTGCCTC
TGCGCTCTTTATTTTGTTACAGGAACAAAAGGAGGGGATGTGTGTGAGGA
TGAAGGGATGGTGAAAGATTGCCATCCATTCAGAAAGGGGAGGGATGAAA
TATCTCTAAAACCCATAGAAGTGAGGAAGAAAGTTGGGGGTGGACAGTCA
TGCTCGGATGCAGAGATCGA
View all "STS079" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS009 GGTTGTTGACTATTCCTTTGGAGGTTATAGCTACATTAAGTGTGAGGCAG
TCCTAGAAGAGAACAAAATATGTGGGCATATTGGGCACCTTGATTGTGCT
CTCCGTACTTTTATGGCTGGAACAGTTGGAGGATGTATTGACTTGGACAT
GCAGTATTGTTGCAGACGTTGTGATAACAAAACGAACTTGATGCTGCACG
TAGAAAAATTCTTGGAAATATGCCAATCTCTTCAATCAAGGGATGACATT
GAACCTATCCTGAATACTGGCTTATGCCTAGTGCGTGGTTCAAGACAAAC
AAGAGCAAAAAGCTTGGAGAGCATTATGAGATCAGCAATGGCAAAGGTAT
GGTCAGTTTTATTTTTTT-AGCCACTTGTGGAAACTTCCATTTTGGTCAC
CATTTATCTTCTTTTTGATCTCTTATAAGTAGTTTGTGGCTATGCACTGA
TGGTTTACAACTATATGCAGCTAAAGTGTGGGGTTGATCTTGCTGAAGTT
View all "STS009" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS104 GTACTAACAAATTACTACATAACCATCATCATTCTTTTTCCTAACATACA
AAGATGATAAGTCATATTTTTGT-GTACCAGTTCTTTGATCACGCAATTG
GTATCAATGTTCCAAGGTCCCGGTTCCTACCAGTGAAGGCAACATCAGAT
TTGCAGCTAGTACAGGTCTGTATGACACTCTGAGTAAACTTTTTAGGGTA
ACACTCATT----C----TAACTTAACTGTTTCACCCTTGCAGTCTGATC
TATATACCTTGGTTGATGGCTTTGTTACACGCAACCCGGCCAGAACAAAC
CCATCGAATCCCTCAATTGAACTGGGTCCAGAGTTCAAGAAGGTATAGTT
CCTTCCAACATTATTTCCTCATGCAAAAGCTTTAATTTAGTTCATGAGTT
CAAATGAAATTAACTGATCCTTCTTCGCGTAATGGCAGGTCGGGTGTTTC
CTTGGTCGCTTCAAGTCAATCCCC
View all "STS104" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS027 GTGAACACCGGTTTCCTTTCCTTGTTAAGGTACAAGGACCCAAGACTATG
ATACTAGTTGTAATTATTCTTTTCAAATTTCCTGTAAGGCTGTAACTGTT
ACAACCCTGGCAGGTTAACAATTGGAATAGGTTCAATTGCAACAGTGGAG
GAACTCTTGTTGAGAAGTGCTGCCATTTTTTTGATTTGATGAGATTGTTT
GCAGCTGCAAACCCTGTTCGTGTGATGGCTTCTGGAGCCATTGATGTCAA
CCACAAGGATGAAATTTATGATGGGAAGGTCAGGTTAATTGACTACAAGA
TCGCTGATTTATAAGCTGGATGGCATTTTCACTCATGTGATTATTTATAA
GCTTATAAAGGCTATATTTATAAGCTGCAGCGCATTTTTTGTGCTTATCG
GGTTATGGTGGTCTCAGTTTAAACAGCAGTCCCTGATTTTAACTTCTTTC
TCAATGCAGGTTCCAGATATTATAGACAATGCATATGTAATAGTAGAATT
TGATAATG
View all "STS027" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS028 GTGAACACCGGTTTCCTTTCCTTGTTAAGGTACAAGGACCCAAGACTATG
ATACTAGTTGTAATTATTCTTTTCAAATTTCCTGTAAGGCTGTAACTGTT
ACAACCCTGGCAGGTTAACAATTGGAATAGGTTCAATTGCAACAGTGGAG
GAACTCTTGTTGAGAAGTGCTGCCATTTTTTTGATTTGATGAGATTGTTT
GCAGCTGCAAACCCTGTTCGTGTGATGGCTTCTGGAGCCATTGATGTCAA
CCACAAGGATGAAATTTATGATGGGAAGGTCAGGTTAATTGACTACAAGA
TCGCTGATTTATAAGCTGGATGGCATTTTCACTCATGTGATTATTTATAA
GCTTATAAAGGCTATATTTATAAGCTGCAGCGCATTTTTTGTGCTTATCG
GGTTATGGTGGTCTCAGTTTAAACAGCAGTCCCTGATTTTAACTTCTTTC
TCAATGCAGGTTCCAGATATTATAGACAATGCATATGTAATAGTAGAATT
TGATAATG
View all "STS028" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS018 GTGTATTTTGCTCATTGCACGTCAGAGATGATATTCATTACTCATTTGCT
CACAGAACAACCTGAGAAACTTGCTGGCCCTCTGCTGGCTGATACTTATG
TTACTCTCCTGAAAGGTCGCAATGCGTGGTATGGGCAAATGCTAGCGAAG
GGAGAACTGAGCCCTGACATGGGCGACAGCATCAAGGGGAAGGGGATGAT
TCAGGTTATCTCATAAAACTACTCATTATTTTCCCCGAAAGTTATATGAA
TTTTGAGCGTATTTTTGAAGAATGCTGGAAGTCAAAACTTGCAAAAGATA
TCACATCATCCTGGATATAACCTGTTCACTTTTCACTCTACAGGGTATCT
CTGCTGTTGGTGCATTTTTTGAGCTTCTCAGTCAACCCAGCTTAAGTGTG
CAACACCCAGAGGAAAATAAGCAAGTTGCAC
View all "STS018" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS035 NNNNNNNNNAGGATGGCAAGCTCTTCGTCGATGTCCTCAAGGAGGGTGGT
GTCCTCCCGGGCATCAAGGTGGACAAGGGCACCATCGAGGTTGCCGGCAC
CGAGAAGGAGACCACCACCCAGGGCCATGATGACCTTGGCAAGAGATGCG
CCAAGTACTACGAGGCTGGTGCCCGCTTCGCCAAGTGGCGTGCCGTCCTC
AAGATCGGCCCCAACGAGCCGTCGCAGCTCGCCATTGATCTGAATGCGCA
GGGCCTCGCTCGCTACGCCATCATCTGCCAGGAGAACGGGCTGGTGCCGA
TCGTCGAGCCCGAGATCCTTGTTGATGGCCCTCACGACATCGACCGCTGC
GCCTACGTCTCGGAGGTGGTCCTCGCTGCGTGCTACAAGGCCCTCAACGA
GCACCATGTCCTCCTCGAGGGTACCCTCCTCAAGCCCAACATGGTCACCC
CAGGCTCTGACGCCAAGAAGGTGTCTCCCGA
View all "STS035" genotypes
[ Download ]