grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "IRGC38698" from the experiment "Genome-wide patterns of nucleotide polymorphism in domesticated rice".

E.g., Germplasm "IRGC9542", RA4969, Basmati 1, Marker/locus RM22.

Items 76 to 100 of 103.       Previous | of 5 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
NPE 844 IRGC38698 japonica   RA4948 STS089 AAGCTGTGAAGGTGGTCGACATTGTGGACACCTTCCGTCTTCAGGTTGCT
CTCACTTCCATTACCTTGGCTCTTGTATATGATACTATCTGCACTTTATT
TTTGTGCTTAAATTCCATGTGTGTTTGGCAGGAGCAACCTCCTTTTGACA
AGAAGCAGTTTGTGACCTTCATGAAGCGCTACATCAAGAACCTCTCCGCC
AAGCTGGATGCGGAAAAGCAAGAGGAATTCAAGAAGAACATTGAGGGTGC
CACCAAGTACTTGCTTGGAAAGCTCAAGGACCTTCAGTTGTAAGTTCACT
A--ATTGCTTGCCACAGGTCCAGGAAATAGTAACATATGTGATGCCATGA
ACATGTCTCACCATTAGTGCCTACAAATTCCAGTTTAAATGATTTGCTAT
GTTCTATCACATTAAATTCTTGAAGCAAT---------------------
-------------------------AAGACTTGTATTCAAACCTGCTTCT
TATGCTGTCTCTTATGATCTGTTTCAGCTTTGT
View all "STS089" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS090 TACAGGGGGTAAGTTCTTCGACTAACCGATAAATGGTACTCCTATTTTAT
TTCTTTGAACCTCTTGAAATTATGGGAACTTGTAGATAGTTTTGGCTGAT
GGAACAGAGGTGCTCACATCAGTTGTTTTATCAAATGCAACTCCATATAG
AACATTTGTGGTAAGAGCTACTCAGAATATATAACAATGTGAAGATATA-
--CCTGTTCCAATTTTGTAGACACAATGAAACAAATATTTGTACACTAAT
ATATGGTTTCCTTTTCAGGACCTAGTGCCTGCCAATGTTCTTCCAGACAA
CTTCCTCTCTGCTATAAAAACTGCAGATTATAGCTCTGTAAGAACGTACT
TTGAAGCATAACATAATAAATAAGTGTTATAATATTGATTGATAACAATG
TAATATGATTCTGTGGAGAGCAGGCAACAACGAAAATTAATGTGGCTGTT
GACAGGCTGCCACAGTTTTCCTG
View all "STS090" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS092 GGGTGGCATGGCCCGTATCCTGAACGCAAAACATTTTGAGAGGTTGAGTG
GCTATCTGGAGGATAATAGGGTGGCAGCTTCTGTAGTGCACGGTGGTTAC
ATGGACCCCAAGAAACTGTAAGTTCTGAAAACC-----------------
-----------TGTTGGCCAAGCGTCTGCACACAATTGGTCCCGCACGAT
TTCATTCCCAATTGCTTGCAGGAATATTGAGCCAACCTTACTGCTAAATC
CTCCTGCTGATTCTGATGTCATGACCGAGGAGGTATTTGGCCCGATTCTC
CCAATCATCACGGTACGCACTGACAACGATTGCATAGT-TTCTGGGTGGA
TGATTTCACATACATCTGCAACCTACGACTGAACCAATTTGATCATCCGT
TTGCAGGTAAAGAAGATCGAGGATTGCATCGCGTATTTAAAGTCCAAGCC
GAAACCGATTGCGATGTACGCCTTCACCAA
View all "STS092" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS094 ACAAGTTGAGGGTGGAGATCGGGAATTTGCCCGAGGAGAAAATGGGGAAT
GTGCTACAGATTGTGCAGAAGAGGAATACCGATCCGGCGCTAATGGGAGA
GGTCGTTGAGCTTGATTTCGACGAAATGGATGTCGAGACGCTGTGGGAGC
TCGATCGATTTGTGGTCAATTGCAAGAAAGCGCTCAGCAAGAGCCGGAGG
ACTGTCGCGATGAACGGTGATGCTGTTGATGCGACTGCTATTGTTCCAAT
TGAGGACGATACCCTGCAGGTGAATGTGCATCATCAGCCTGCGGTGGTTG
AAATTGGGGATTCGGTATGGCAATGTTGCAATCCTTTGTTCTGTGTAATG
ACTAATGCTTGAATTGTGTTCTCATGTTTTGTTTATGTTGCACTTTTGCA
GGAGAATGACACGCCGGAGAAGAGGGTTTCAGAGGTTGATATGGTTGATG
AGTATGTTGATATTGGCGATGAGATGCC
View all "STS094" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS093 TTACTCTTCTCCTTCCATTGTTCTGGCCGCAAGGGGTCATAATGGAGGCA
GGGTCATATTTGATGATTATCGTGAAGCGTATTATTGGCTTCGTCAGAAC
ACTCCTTCTGATGCAAAGATTATGTCATGGTGGGATTATGGATACCAAAT
CACAGCTATGGGGAACAGAACTGTTATTGTTGATAACAACACATGGAATA
ATACACATATAGCTACAGTTGGGCGTGCAATGTCATCCTATGAAGATGAA
GCGTATGAGATAATGCAGTCACTGGATGTGAATTATGTGCTTGTCATATT
TGGTGGTGTTACTGGTTATTCTTCAGATGACATTAACAAGTAAGTTTATC
CACTGAATCTAGAGCAAATTTTAATAAATCGATGTTATTGGTTTTATTCG
AATTAGTATTGAACATTTTTTCA-AAAACTGAACTACAAAATGGATTCTT
ACTTAGCTGCTTATTTCCAGGTTCTTATGGATGGTGC
View all "STS093" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS096 ACCCCCTACTTCATCTGCTCCTCCAATGGTACACAATTCCTCAGTTTTGA
TTTAATATGCTCATATTTTGATTTTTCAATATGTGACCCAAGTGAGATGT
TATCATCAACTGAATATGGCAGTTTTGTCTGCACAATAATTCTCACCCAT
GTTCTTGATTGCACTGGATTTTCTGCTTTCTTAGCTTAAATGAAACCTTG
TCTCATGTGCTTTTACATATTCCATTTTCATAACCATAAGTGCAATCTAT
AATTTCAAATTATAGGTGCAAATATAATTTAGAGTAGCTCCCGGTGCTAA
CATGGGCATATTTGCAACATTCTGTTGATCTTATGG----AAT----ATG
AATAGCTTGAATTGAATATTGTGTTCTGTTCTCAGTATAGTGCAACCAGT
GTCCCAGTCAGTGAAGACAACAATGTTGTCCATAAGGCTGAGGATGTTGT
CAGCACCATGCTTGCTAAGGGGTTCACCCTGGGGAAAGATGCCGTTGGCA
AGGCAAAAGCTTTTGATGAGAAGC
View all "STS096" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS099 AAAACTTTTACAGATCTCTTCGATTACTTCCCCTTGACAGCATTGGTGTG
TATTCAGCATTTTCATATGTATATGCCAACATCCTTCCCACATTATCTAG
TGAATCTGACAGAAGCTGTTCATTTGTTCTGTAGGTTGAGTCAGAAATAT
TTTGCCTGCATGGTGGATTATCGCCATCCATTGAGACACTTGATAACATA
CGTAACTTCGATCGTGTCCAAGAAGTTCCCCATGAAGGGCCCATGTGTGA
TCTTCTGTGGTCTGATCCAGACGATCGATGTGGTTGGGGTATTTCTCCTC
GAGGTGCTGGATACACCTTCGGGCAGGTAACATTTTATATAAGAAAAAGA
AT--CTCTATATTTAGCTGTGCACCTCATGTTCATCGACTTATCAATTCT
ATCATTTCAGGATATATCAGAGCAGTTCAACCATACCAATAATTTAAGAC
TTATTGCTAGAGCTCACCAGTT
View all "STS099" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS101 GAGATGTCAGAGAAGCCAACGTTGGCATCGCCCCTGAGCTTGCCGGCGTG
ATCGCCGACGAGGTCGACATCATCGTCAACTCAGCAGCAAACACCACTTT
CGACGAGAGGTTTTGTCATTCTCTGAACTGCAGTGTTGCTCCAAAGATGA
GTTCTTAATTGGATCACTTCATGTATAATAAGCATATGAATTGATCACTG
TTGCTGCATTTGGTTCGATTTTGCAGGTACGATGTTGCAATGGACATCAA
CACCGTAGGGCCATTCAGGATAATGAGCTTCGCGCAGCGGTTTCGGAGGC
TGAAGCTGTTCTTGCAAGTGTCAACAGGTCAGAAATGCATGTCAAATGAA
AAGCTCTTGTGCTGAAAACTTGCACTGAAATT-ACCTCCAAAAACCTTAG
ATATATCTCTCTACTGTGGATTTTGAATTTCATGTTTGGCAATCAGCATA
TGTGAACGGACAGAGGCA
View all "STS101" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS102 TGCAGTCAGTGCTGGCAACAATTATGAAATCGGTAATATGATAGCAGAGG
CTATGAGCAAGGTTGGCAGGAAGGGTGTGGTTACCCTTGAAGAAGGGAGA
AGTTCTGAGAATAATCTCTATGTTGTGGAGGGAATGCAGTTTGAACGTGG
TTATATCTCCCCGTATTTTGTAACTGACAGCGAGAAAATGTCTGCAGAAT
ATGAGAACTGCAAGGTAGCTTCAGCCTGAGCACACATACC-------CCT
GCTGTATGCTGCTTTAATCTGTTTCAGTTTCTTATTGCACTATGTTTCCA
CTATTTTTCAGCTTCTTTTGGTGGACAAAAAAATCACCAACGCAAGGGAT
CTTATCAATGTTTTGGAGGAGGCCATAAGAGGTGCATACCCAATTCTGAT
AATTGCTGAGGATATTGAGCAGGAGGCTCTTGCTACTCTTGTTGTCAACA
AGCTTAGAGGGTCATTGAAAATTGCCGCTATCAAAGCCCCTGGTTT
View all "STS102" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS103 GGTTAATACCTGGCTTCAAAGGCAAGGGCATTTCAACATACTACATAAGA
AGCATTCTGTAAGTACTCTAGCCCAAACTGGCATGTAAAGAAAGTTAAGT
TCAGTAATCAACCTAACCTGGAATGCAGGTTACCTTGCCAGATCAATTCA
TCGAAGGGCTGTCAAGTGCTTGTTTGCAAGGACGAGCACAGATTGTTCCA
GATCCGGAAGTGCTGTCCAAAGACAGCAGTTCCTTAATTTTCTATTTGGA
TGGAGCACATAGCCCAGAAAGTATGGAAATTTGTGCGAAGTGGTTTTCCT
GTGTTACAAGAAAGGATGAACAACAACCAGGCCCTTTGGATCAGCTACAT
ATTGGCACCAATTCTAGGAAGGTATGCCTTGCAGTTGCAGTGAGCCAGTG
AGAGGTCTCTC--------------------TGTGTGTGTGTGTGTGTGT
GTGTGTGTGTGTG------------------------GCTCATATCATTG
TTCTTTCTTTCTTATGAGCACTCTTTGTTTGTGATCCTTGCAG
View all "STS103" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS104 GTACTAACAAATTACTACATAACCATCATCATTCTTTTTCCTAACATACA
AAGATGATAAGTCATATTTTTGT-GTACCAGTTCTTTGATCACGCAATTG
GTATCAATGTTCCAAGGTCCCGGTTCCTACCAGTGAAGGCAACATCAGAT
TTGCAGCTAGTACAGGTCTGTATGACACTCTGAGTAAACTTTTTAGGGTA
ACACTCATT----C----TAACTTAACTGTTTCACCCTTGCAGTCTGATC
TATATACCTTGGTTGATGGCTTTGTTACACGCAACCCGGCCAGAACAAAC
CCATCGAATCCCTCAATTGAACTGGGTCCAGAGTTCAAGAAGGTATAGTT
CCTTCCAACATTATTTCCTCATGCAAAAGCTTTAATTTAGTTCATGAGTT
CAAATGAAATTAACTGATCCTTCTTCGCGTAATGGCAGGTCGGGTGTTTC
CTTGGTCGCTTCAAGTCAATCCCC
View all "STS104" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS105 TCCGAGCTCCCACACACATTATCTCCACTATCTCGGATGACAGAGGTTAG
ATTGGTGGCAATGTGTTTTTCCACATATTCTCCATGTTCAATCTTTGTCA
TACTATCCCTACCAGGAAGTAATATAGGTGCATTTTTGTGATACAGGCGA
GGAACCCTGCTATGCTGGTGTCCCCATGTCTACAATTATTGAACAGGGTT
ATGGAGTTGGTGACGTTATTTCGCTTTTGTGGTTCAAGCGCAGTCTTCCT
CGTTACTGCACTCAGTTTATTGAGGTAAACAATTGGTAAAATATGATATG
GATAATCTATTTTTTGAATGATAGTCATTTAGTCTTCATTTGATCCTAGA
AGGATTTCATGTGTCTTGACAGATGTGCATCATGCTTTGCGCTGATCATG
GTCCTTGTGTATCCGGTGCTCACAATTCTATAGTTACTGCTAGGGCTGGA
AAGG
View all "STS105" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS107 CATCAGACGCCTTTTACAGGCTTAGCAACACCAGGGAGCAAATCCAGTCG
TATGTTTTTGATGGTAAGGTTCCTGTATGCTGTGAACATTCATGCATCCG
ATGCATTTGCAGTTCATACTCTTCTGATTACCTTCTCTATGTTTTGCCTC
TATTGTTCAATGCTAACAGAACTTTCTTCCTC--G--CAGTGATCAGGGC
TAGTGTTCCAAAGATGAACTTGGATGATGCATTTGAGCAGAAGAATGAGA
TCGCAAAAGCTGTGGAAGATGAGCTTGAAAAGGTTTGTGTTCAATAATTG
GTGGTCATCTAGAGCATAGTGGAGTTTTATACTGACCTAGTATATACTCT
GTAGGCAATGTCAATGTATGGTTATGAGATTGTGCAAACTCTTATTGTTG
ATATTGAA
View all "STS107" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS108 TCGTGTAGCTGCTTCCAAAATAGGCACTCTTCTTGGGGCACATGTCGAGC
AGTGGAATACAGCTGAGTGTTGGCTTCAGCTGTATGAACGCTGGTCATCA
GTGGATGATATTGGTTCCCTTTCAGTGATTTACCGGATGCTTGAGTCAGA
TGCAGCAAAAGGTGTTTTGTATTTCAGACAATCTTTGCTGCTCCTTAGGT
TAGTTATACTAGCACCTCACTCTGTTGATTCCCTTGTGGCCATTTTGGTC
TCAACTCTCAACATAACTATAGATGATGCTTAATATTTTTTT-GTTTACA
GGTTGAACTGTCCTGAGGCTGCAATGCGCAGTTTGCAATTGGCACGGCAA
CATGCAGCAACTGAGCATGAACGGCTAGTGTATGAGGGGTGGCTTTTGTA
CGATACTGGGCATTGTGAGGAGGCCCTACAAAAAGCAGAGGAATCTATTT
CTATTCAAAGGTCATTTGAGGCTTTCTTTCTGAAA
View all "STS108" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS109 CGACGTCGAGGACGCTGGTGCTCGCCAACTCCGCGCCGGTGCTCGCCGGG
CAGCGCCGGTACGCCGTCAACGGCGTGTCGTTCGTCGTCCCCGACACGCC
GCTCAAGCTCGTGGACAACTACAACATCGCCAATGTCATCGGCTGGGACA
GCGTCCCGGCGAGGCCCGACGGCGCGGCGCCGCGGTCGGGGACGCCGGTG
GTGAGGCTCAACCTGCACGAGTTCATCGAGGTGGTGTTCCAGAACACGGA
GAACGAGCTGCAGTCTTGGCATCTCGATGGATATGACTTCTGGGTTGTTG
GGTAAGCTACATTCCCATCAACCACTGAAACTTTCAGAT-TTTCAGTTGC
ATCAATTCTCAGATGAACATCAACATGAGAAAGATCTGTTCATTCACCTT
TGATGATTTCTTTCTCTGATAAATGGATTCAGGTATGGCAATGGTCAGTG
GACTGAGAATCAGCGGACAACCTACAACTTGGTTGATGC
View all "STS109" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS110 TGATGAGAAGAAAGGTACGTGCA--ACAAATTAACAATATGATCGATCGA
CGATAACGAACTGAATGGGAAGATTATTTCCTTAGTTATATATACCCACA
CAAATAATTCAATATGTATTGATCGGTCAATCGATCTGTAATTAATTAAT
TTGATCTGTTTTTGTTGAGTATAGTTCGGCTGATGAGGAACCGCTCGCTG
ACCAGGGAGGAGGTGGACGCGTTCTGGAGGCGCCAGCAACGGAAGCAGCC
ACCGTCGTCGTCGACGTCGTCGGAGCCCAACGCCACCACCTCGCCGCTCG
CCTCTCCCCGCGCCGCCGCCAACGTCGTCTCGCCGCTCGCATCACCCCGC
GCCGCCGGCGACATCTCGCCGCTCGCCGCCTCTCCCGGCCGCGCGGTATG
TAATTAAACTAATTAAACATGCATCGATATAT--------TCTTGGACTG
AATTAATCAATTAATATAATTAATTCTCTCATGCAGCAGCAGGAGATGAG
TAGTAGTCGTTGCACGTTGG
View all "STS110" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS111 CCAACCAGCTCGACCAAACCTCCAGGGTACGTACGTGCGTAATCAATCTC
GAGATTAATTAATTGATGGACTCCA-----TCGGTCGAACACCTAACGTG
CAATGTTTCTTCTGCAGCGTTTCCGGCTAGCCGGCGGGCAGGCGAGGAGC
GAGGGGAGGCAGAGGTACGGTGAGGGCGAGTCGTCGGAGTCGGAGACGGA
ACGCGGCGGCGAGGAGTCGTACAACATCCTGAGCGGCTTCGACACCGAGC
TGCTCGCCGAGTCGATGCGCGTCAGCCCGGACATCGCGCGCAAGCTGCAG
GGCCGCAGCGACAAGCGCGGCAACATCGTGCGCGTCCGCCGCGGCGGCCT
CCGCATGCTCCGCCCGGCGACGGAGCGGGTGACCGACGAGGAGATGATGA
GGGGCGCCAACGCCGCCGCCGCCGCC------GGGAACGGGATCGACGAG
GCCGTCTGCTTGATGAAGCTCCGCGAGAACGTCGCCGACC
View all "STS111" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS112 CAAAGAACTTTCAGATGGGTGTCTCCAACAAGACTCCTGAGTATCTCAAG
ATGAATCCTATTGGGAAGGTTTGAGCAAAACCACCTCTGAATTTTGGTAC
ATTTGCACAGAATCTGATTTGGACACGTTTCCTTTCAGGTCCCTATTCTA
GAGACTCCTGATGGTCCTGTTTTTGAAAGCAATGCGATTGCACGATATGG
TAAGTGATACATAGCAAGGATTCCGTTCTTTTAATCCTTTTCTCTCTATT
GCTTGATTTAGTTCTAAGTTCCTCTCATTTTCCTGAAGTTACTCGCTCGA
AGTCTGACAACCCACTCTATGGGTCTTCACTGATTGAATATGTGAGTGAT
CTTTCATAAATATTTAGGATCATTCTTGATTATTTTCCAGCTCCTAGAAT
TTTGTGTTTCTTTCAGGTTGATCTTTCATAGACATTTAGGATCATTCTTG
ATTATTTTACCAGCTCCTTGAATTTCTTGTTTCTTTCAGG
View all "STS112" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS113 CCCCGCCGAGGCCGGCGCCGGCCGCGAGGGCTCCGGTTGTAGCGGAGGCG
GCGGGTTCCGGGAACGGAGCGGCGGCGCATGCGGCGGCTGGCCTCTCGCG
TTGCTCCAGCACGGCGTCGTCCGTGGACGCGGCGGCTCAGGACAGGAGCC
TCGCGTGCCGCTCCGACGTCGCGGAGGTGAGGGAATCGAAACCCTAGAAT
TCGAATTCGAAAAATGATCCCAGATCTCTAATCACCGGTTGCTGAAGCGT
GCGTGCTTTTTGGTGATGTTCTACAGGCAGGCAGCGAGCATGTCCCGGAG
GGCTCCGCGAGCGACTCGGCGAGCGGCCGTGACCGCGAGAGGTGGGAGAA
TTCTCCCTCATTTCCGGCAAATTCTTCTGAATTATGCGTTCTGACATGCC
CCTGACGCCGAATCACCCTCGATTTTTCAAAATTTTCAAATTCCAGGAGA
GAAACAACTCCATCAAGCTTTCTCCCCGGAGAGGTGAGCGATCTGGAGTC
GGATCTGGCTGGAGGACAGAAGCGCAGCCGT
View all "STS113" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS116 TGAAATATCATATATGCTTGCTGTAATGGCACTGCCTGAATTAAATGGTG
GAATAGCAAATGAGCATCAATCTATTGTCAGCATAGTAGAAACATCTGCA
GATTTGGAATCTACTTGTTCAAGCTCCCTTGTTGGGTAAGATGGTTTAAC
AGTAGCTTATAATTATATATTTTGAGATGTTATGTAGTTATTCTGTTGTA
TTTTGGAAGTTAAAAGACAATGAAATTGTTTATTTTGCAGGTATCTCTTA
TACCATGATGATCTTAGACCTTCAATACTAAGGCTAATCAATAATATTAT
TGGCTATTGGAAAGATAGTGAAGCAAGGATTAAAGTTGTGTCATTTTGTC
ATATGCTGATCCAACTTGCTATTTCTACGCACAATGATAAACTTATATCT
TTTGTTCAAGATAATTTAATTCCAATGGTTGTCCGATGCTTAATATTTGA
GCCAATATCAAACAATAATGATCTTCTTCTT
View all "STS116" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS117 AGGAAGAAGATCAGAGTCTTGGTACGTT---CATCAGAAGAATGCTATAG
AGAGAATGGAAGTGATTCAGCTTAGCTTACTGTTTTTGTGTTTGTTT-TG
TTCAGATGCTGACACTGTCAACGGAGAGGTTCATGAATATTCAGAGGGAG
GCCCCTGCGGAGTTCCAGCAGTATCTGGTCCAGGTCACCAAGTACCAGGC
TGCACAGAATTGCAAGGTAGTACGTACGTAAAATATAATTGAACTGGTCG
GTGTATGCAACTCAATCATGATGTCTT------------ACGACGGCGAT
GTCGGTCGTCGCAGACGTGGATCGTGGGGAAGTGGCTGTCGCCGAGGGAG
CAGCGGTGGGCGCCGGCGGGGACGCACTTCCACCAGTTCGTGGTGCCGCC
GATCATCGGGTTCCGGCGGGACTGCACGTACGGGAAGCTCGCCGCGATGA
GGCTGCCGGAGGACGTGGAGGGGCTGGGGACGTGCGAGTACACCATGGGC
CGCGGCGTCGTGCACGCGTGCCACGCCGGCGGCGTC
View all "STS117" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS118 ATCCTCCTCTGTCGATGATTCAGTGACATCTGTAGATTTCTTCCTAGGAG
AGGTCTGGCATTCTTTTCATGCAAAATCTATTGCACCATCTGCCAAATGA
ACATGAATTTACCGATGTTATGCTTCTTACATAAAT-TGTTTGGTCGTTA
TGATGCAGGCCCTTGATTCCTTCAAGGCTGAAAGTGAGTCTGAGCTTAAC
TTGTCAGCTGGAGACATTGTTATTGTCCGGAAGGTAATATACCTCTGCTG
TCCATGTTTTGTAATCTTCAATTGAGTTGCCGATATTGTTCCGATGTTTC
TAAATACAAGTTCCTGGCAGCTAACATATCATAATTGAGCTGTCAGTAAT
CTAATGTGGTCTTGTCCGAACACAGATATCAACCAATGGTTGGGCAGAAG
GCGAATGCAAGGGAAAAGCAGGATGGTTCCCACATGGTTATATCGAAAGA
CGAGAG
View all "STS118" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS119 TCGCCAACCCCGGCGACGCCCTGCTCATCCCTACCCCTTACTACCCCGGG
TAAGCCACTGTTCCATTGCCATTGCCATTGCCATGCATCTAGCTAGCTTG
GGATCGATCGAGCAGAGTGGCAGGCTGAGCTGACATCCATGGCGTGCAGG
TTTGACAGGGACTTGAGGTGGAGGACGGGGGTGAACATCGTGCCGGTGCG
GTGCGACAGCGCGAACGGGTTCCAGGTCACGGTCGCCGCGCTCCAGGCGG
CGTACGACGAGGCCGCCGCGGTGGGGATGCGCGCCCGCGCCGTCCTGATC
ACCAACCCCTCCAACCCGCTCGGCACCACGGTCAGGCGCAAGATGCTCGA
CGACATCCTCGACTTCGTGTCGCGCAACGACATCCACCTCATCTCCGACG
AGATCTACTCCGGCTCCGTCTTCGCCGCGCCGGACCTCGTCAGCGTGGCG
GAGCTCGTCGAGGCGCGCGGCGGCGACGGCATCGCCGGCCGCGT
View all "STS119" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS120 AAACAAGTTGGTGTTTTGACAGGTCATTTAGATGGGATTACATTTATTGA
TAGCCGTGGAGATGGGCATTATTTTATTTCAAATTGCAAGGATCAAACTA
TTAAACTATGGGACATCAGGAAAATGTCGTCCACTGTGAAAGAGTAAATA
CAGCTCTTGCTTTTGCATGATTATTCCTCTAAACCAAACCACTTTTT--A
TGCTTGAATCTTAAACGCAACATATTGTAAGCAAGTAGGAAATGCTAAAA
TCAAAATCTGCCTTTGACTAGATCTGCTTGGCCTGATTTGTCCAAGATCT
TGTCTACATGCCTGACCCAAAGTCCAAAATATAAAATAGGCTAAAGTTAT
TCGACAGAAATACTATTTTTACTTGTAGTTTGTTTTTGCAGCTGCACACC
AAAAGCATATGAATGGGATTACAGATGGATGACATATCCCTCAGAAGCCC
GATATTTCAA
View all "STS120" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS121 GACTTCCGAAAAGGCCGGCGCCTCCGAGATTTGGCCGGAAATTGACGGAA
TCACAAAAGGTAAGCTCAAGATAGTTCTGTCTGCTTCTCAGAGCTTATGC
TGCCTGCAATCGTCTGCTCTTTCCAACTTTTAAGCCTCAACCTGCAAAGT
TGTGAATTGTCACAGGCTAGAGCAACACACATTTGCCTTGATTGTGGATA
CATATACTTCCTTCCCAAGCCTTTCGAAGAACAGGTAAGATTCACTTCAA
TTCTTTCACAGAGAATCAGTCTTTTGGCACTCACAGCCCGCAAAATCAGG
TGTATCCAACAATTCAACTAGTGCTTTTTATCCATTTCAGCCTGATGAAT
ATGGCTGCCCACAATGCAACGCACCAAAGAAGCGGTTCGCGAAATATGAT
GCAGAAACCGGGAGGGCGATTGGTGGTGCGCTACCACCTATTACAGTGAT
CGTCAGTTTGATAATCGGCAT
View all "STS121" genotypes
[ Download ]