grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "IRGC38698" from the experiment "Genome-wide patterns of nucleotide polymorphism in domesticated rice".

E.g., Germplasm "IRGC9542", RA4969, Basmati 1, Marker/locus RM22.

Items 26 to 50 of 103.       Previous | of 5 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
NPE 844 IRGC38698 japonica   RA4948 STS118 ATCCTCCTCTGTCGATGATTCAGTGACATCTGTAGATTTCTTCCTAGGAG
AGGTCTGGCATTCTTTTCATGCAAAATCTATTGCACCATCTGCCAAATGA
ACATGAATTTACCGATGTTATGCTTCTTACATAAAT-TGTTTGGTCGTTA
TGATGCAGGCCCTTGATTCCTTCAAGGCTGAAAGTGAGTCTGAGCTTAAC
TTGTCAGCTGGAGACATTGTTATTGTCCGGAAGGTAATATACCTCTGCTG
TCCATGTTTTGTAATCTTCAATTGAGTTGCCGATATTGTTCCGATGTTTC
TAAATACAAGTTCCTGGCAGCTAACATATCATAATTGAGCTGTCAGTAAT
CTAATGTGGTCTTGTCCGAACACAGATATCAACCAATGGTTGGGCAGAAG
GCGAATGCAAGGGAAAAGCAGGATGGTTCCCACATGGTTATATCGAAAGA
CGAGAG
View all "STS118" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS034 ATGAGTACCACAGGTACAGACACGAACGCATTAAGCCCATTCATCTCATG
GCAATCCTCTGTAATGATCTGCTTAACATCTTCTGTTCATTTCTGACAGT
TTTGTCCATGGAAGACTGCCCTACGAGAACATCAAGCCGGACCCTGTCCT
GAAGCACATTCTCAAGAACCTGCGCATCCGCAAACTCGTGAGTTCCTCCA
GACCAGAATCGAAA-CC-AATCTCACATGTCTCATGTAATCGTGTTTTGG
TTCTGAACTGGCACGCGTCGTTGCAGATATTCACCAACGGCGACAAGGAC
CACGCCGTGAGAGCCCTCAAGAGGCTGGGGCTGGAGGACTGCTTCGAGGG
GATCATCTGCTTCGAGACCCTCAACCCGCCGTGCCCGTCGCCGCCGTGCG
ACGGGGAGGCCAGCATCTTCGACATCGCCGGACACTTCTCCATGCCCGGC
GCCGCCGCCGACGAGCTTCCCAGGACACCCGTCCTCTGCAAGCCCAACGT
CGACGCCATGGAGGAGGCCCTCAGGATCG
View all "STS034" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS086 ATTGAGGATCCGTTTGACCAGGATGACTGGGAACACTATGCTAAGATGAC
CGCTGAAATTGGAGAGCAAGTGCAGATTGTCGGTGATGACCTCCTTGTCA
CCAACCCAACCGTGAGTGCATAGTTTTCTATTACTTCTAAATATGATCTC
TCTTTCAGTGTGGTTGATAATTAATATTAATATATGTTATGCAGAGGGTG
GCAAAGGCAATCCAGGAGAAGTCATGCAATGCTCTTCTGCTGAAGGTATG
GTTCTATTGATTCTTTCCTTCACGTTTAATAGTTTATCTTCCATGTGCGA
ATATATCACCCTTGTCTTTCGACAGGTTAACCAAATTGGATCTGTCACTG
AGAGTATTGAGGCCGTGAAGATGTCAAAGCGTGCTGGCTGGGGTGTGATG
ACCAGCCACAGGAGGTATACTGATATGCTTACCTGTCTTTATTCCTGGTG
GACCTGGTCTGACTACCAACCATTTGTATATTGACTTGTG
View all "STS086" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS031 ATTGCCCAGCCAAAGGTTAGAACTTGTTTATCAGTTTGCATTTTGTTTGG
TATCAACTGTCATTATTAGTGGAAAATATTCACCTTTGATTTTTGCAGGG
TGTCCTTCTTTACGGGCCTCCGGGTACAGGAAAAACGCTACTAGCTCGGG
CAGTTGCTCATCACACCGACTGTACCTTTATTAGGGTGTCAGGTTCCGAG
TTGGTTCAGAAGTATATTGGAGAGGGTTCCAGAATGGTTCGTGAACTATT
TGTGATGGCCAGGTAAACATTTTCTGTTGATGATACATTGAAATTTACCA
TATATTCAATGGGATCTGAAAATCCTTCATTGGGAAGGATGCTTGCATTG
CTTTACACTATTCAGTAGGCTGACGTCTTTGGTTTGAATTTTGACAGAGA
GCATGCACCATCCATAATCTTTATGGATGAAATAGACTCCATTGGATCTG
CTAGAATGCAGTCAGGATCTGGGGGT
View all "STS031" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS072 ATTGGTACGTTTGGGCATGGTGATTTAGATCTGTCTCAAGTTATTGTCCA
ATTATTTGAGTTGTTTCTTTTCTCTTCACAGTGTTGCTCTCTTCTTTTAA
TATGTTCTTCCATGTAAAAAACGATTAATAATAAAATGTCACTACCGAAC
TAAAAGATACAACCTCAAAATGATGGTTTTGTCATTTAAGAAAAACTAAA
GACTTGTTTTCTACCTATAACTGAATTATATTAAGATTCTCCGCCGGGCA
ACTGAATTATATTAAGGGTTTAGAGAAATATATTTTTCCCTCAATTTTCA
TTTTTATTTTAGAGAATGTCTCCCTTTGGCTAGTCACTCTAACATTTATG
TGCCTGTGTAATTTTGTGAACAGGTTTTACTTGGGTCAATGGCTGCTCTT
T
View all "STS072" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS002 ATTTGCTAACCAACTCACTCAAGGTTACAACAAGAAACTGAAGAGGATGA
TCTACAAGCTGAACCAGGAGATGGGGCCTGAGAGTAGATTTGTTTACGCA
AACACGTACGAGATCGTGATGGAAATCATTCAGCAGTACCGTCAATACGG
TGAGCTTTCTTCCTTGCTGCAGCTACCTCTTGCGAAAACCACCTGCGAAT
GCTGTGCTGCAGTCTGCAGAGCATTAGAAAATGCAGAATATTTCAGTCTT
GCATTTGTCTTCAGGTTTTGAGAATGCGCTGGACCCATGCTGCGGAGGCA
GCTTCCCTCCATTTCTCTGCATCAGCATCGCTAACTCAACCTCCACCTTA
TGCAATGACCGGTCCAAGTACGTCTTCTGGGACGCGTTCCACCCGACCGA
AGCCGTCAACTTCATCGTCGCCGGCAAGCTTCTCGACGGCAACTCCGCCG
TTGCTTCTC
View all "STS002" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS112 CAAAGAACTTTCAGATGGGTGTCTCCAACAAGACTCCTGAGTATCTCAAG
ATGAATCCTATTGGGAAGGTTTGAGCAAAACCACCTCTGAATTTTGGTAC
ATTTGCACAGAATCTGATTTGGACACGTTTCCTTTCAGGTCCCTATTCTA
GAGACTCCTGATGGTCCTGTTTTTGAAAGCAATGCGATTGCACGATATGG
TAAGTGATACATAGCAAGGATTCCGTTCTTTTAATCCTTTTCTCTCTATT
GCTTGATTTAGTTCTAAGTTCCTCTCATTTTCCTGAAGTTACTCGCTCGA
AGTCTGACAACCCACTCTATGGGTCTTCACTGATTGAATATGTGAGTGAT
CTTTCATAAATATTTAGGATCATTCTTGATTATTTTCCAGCTCCTAGAAT
TTTGTGTTTCTTTCAGGTTGATCTTTCATAGACATTTAGGATCATTCTTG
ATTATTTTACCAGCTCCTTGAATTTCTTGTTTCTTTCAGG
View all "STS112" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS010 CACCAAGGTGAGCGTTGGTTGCTTAGCTAATGATATTAGCTTCCTTAATT
-----GCGTTGTTTAGATTGTATTAACGTTTAACTAATCACGCAATGTGT
TCATGGATGGATGCAGGTGAAGATCCTGAGGAGGGAGTCCTACTGGTACA
ACGGCACTGGCTCCGTCGTCACCGTTGATCAGGTACGTACA---------
--------------------AATCTCATAGCCTTCACATGAATCAGTTCA
ATTCTCCTAGTACTCCAATCGATAATCAAAAGGAAGAAATACTTTTAAGC
AATGAATAATAATCAATTAATGGTTGAATTGAATTGACTGGATGCAGGAT
CCCAACACTCGCTACCCGGTGGTGGTTCGGTTCGCCAAGGTGAACTACGC
CGGCGTGTCGACCAACAACTACGCC
View all "STS010" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS107 CATCAGACGCCTTTTACAGGCTTAGCAACACCAGGGAGCAAATCCAGTCG
TATGTTTTTGATGGTAAGGTTCCTGTATGCTGTGAACATTCATGCATCCG
ATGCATTTGCAGTTCATACTCTTCTGATTACCTTCTCTATGTTTTGCCTC
TATTGTTCAATGCTAACAGAACTTTCTTCCTC--G--CAGTGATCAGGGC
TAGTGTTCCAAAGATGAACTTGGATGATGCATTTGAGCAGAAGAATGAGA
TCGCAAAAGCTGTGGAAGATGAGCTTGAAAAGGTTTGTGTTCAATAATTG
GTGGTCATCTAGAGCATAGTGGAGTTTTATACTGACCTAGTATATACTCT
GTAGGCAATGTCAATGTATGGTTATGAGATTGTGCAAACTCTTATTGTTG
ATATTGAA
View all "STS107" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS017 CATTTCTTTCTGCTAAACTTTGCAAGACTCGTCCCCTGGTAGTAGCAGCA
GCTATGGAGGTCTCGAAGGAAGCCCCTTCTGCTGACTTTGCCAATCGCCA
GCCTTCCAAAGGTTGTTGCTGAGAACTCCATCTTATTAAATTGATTGATA
TGCCTCTGCGGGTTGCACTGTCTCCAGTTCTAAATTTAATATAACTTTTG
TCCTTGCATGATTCTGTTAGGGGTTCTTGAGACATGGTGCAATGCCGATG
CAGTGTGTTTTGATGTTGATAGCACGGTCTGCTTGGATGAGGGTATTGAT
GAACTCGCTGATTTCTGTGGGGCTGGGAAGGCTGTTGCTGAGTGGACTGC
AAAGTAAATAACATGTTATGAACATTAGTTTTGAAGTGTGTTTGTTGCTT
AGTGCATAAAATTCATTCAGGATGCTCATTGGTTTAATATTCTTAGGGCA
ATGACAGGAAC
View all "STS017" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS111 CCAACCAGCTCGACCAAACCTCCAGGGTACGTACGTGCGTAATCAATCTC
GAGATTAATTAATTGATGGACTCCA-----TCGGTCGAACACCTAACGTG
CAATGTTTCTTCTGCAGCGTTTCCGGCTAGCCGGCGGGCAGGCGAGGAGC
GAGGGGAGGCAGAGGTACGGTGAGGGCGAGTCGTCGGAGTCGGAGACGGA
ACGCGGCGGCGAGGAGTCGTACAACATCCTGAGCGGCTTCGACACCGAGC
TGCTCGCCGAGTCGATGCGCGTCAGCCCGGACATCGCGCGCAAGCTGCAG
GGCCGCAGCGACAAGCGCGGCAACATCGTGCGCGTCCGCCGCGGCGGCCT
CCGCATGCTCCGCCCGGCGACGGAGCGGGTGACCGACGAGGAGATGATGA
GGGGCGCCAACGCCGCCGCCGCCGCC------GGGAACGGGATCGACGAG
GCCGTCTGCTTGATGAAGCTCCGCGAGAACGTCGCCGACC
View all "STS111" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS057 CCACTGAGCTACAGGGGAGCGGATATATTTGTGCTGGCATTCTCACTGAT
CAGCAGAGCAAGCTATGAGAATGTTCTCAAGAAGGTAGGTACTATACTCC
ATTTAGTTCAGTTTGGACTCAAAATGTCTGAACATCTGACAACATGAGGA
TAGTGACCACAGATACTGTACCAAGAACTTTACCTTTCCTTCTGACAATG
ACATTTTTAGACCACCTTTGACCAATATTCTTCACATTTTTCTTCTTTAC
AGATATATACTATATGTGCATATGATTTTCACTGGAATATTCTGAGCTAA
TGTTATCTTTTTCTGTTTCTGATCATGCAGTGGATGCCGGAGCTTCGCCG
GTTCGCACCGAATGTTCCAATTGTTCTTGTTGGGACCAAGTTAGGTTTGT
ACCGGATGCAACATTAACTCAACAAAGCTCAGTGCCACTTCCTTTTGCAG
GCTTGTTTCAATGCTCTTAGGTTTTAACCGTGCTTGCTTCCAATTGTTCA
GATCT
View all "STS057" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS085 CCATTATGGTGTTGGAATTAAAGGGAAGGAACCCTCAGATTGTGGTGGGT
AAGAGATGGTGGTAGTGGAATCATATCAAAGTGTGGTGCTATTGACTAGA
GAAAAGTTGATGCAGGAAGGAAAAAA--CTGGAGATTGTGGCGGAGGGTT
GGGTTTGGTTTGGCTTTGGCCAGGGATAATAAATGATGGAGCTGTAGCCT
GTAGAATTAGGCCTTGTTTAGTTCCCAAAACAAAAACTTTTCACCCATCA
CATCAAATATTTGGACACATGCGTGGAGTATTAATTATGGAGAAAAAGAA
AAACCAATTACACAGTTTACGTGTAAATTGTGAGATGAATCTTTTAAGCC
TAATTGCGCCATGATTTGACAATGTGGTGCTACAGTAAACATTTGCTAAT
GACGGATTAATTAGGCTTAATAAATTTGTCTCGCAGTTTCCTAGCAGAAT
CTGTAATTTGTTTTGTTATTAGACTACGTTTAATACTTCAAATGTATATC
CGTATATCCGATGTGACAACCAAACCCGAAAATTTTC
View all "STS085" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS037 CCCACGAATTCATGAAAAATTCCCAGGTTCAGAATCTATACTTTCATTAT
CTAAATTTAGAAACCAACTGCTGTATAAGACTATAAGATTCAACATAAAT
TGCATAATCTTTCTTGAAGGTTGTAAGGAATCATCCTGGTGACCAAAGTT
ACTGGCATCGCCATAGATCAAAGGGTTCTTGGACTCTTTCCTCTGCAGAC
AATGGGTGGGCTGTGTCTGACACTACAGCAGAAGCACTGAAGGTCATTAT
GTTCTTTGTTCTTTTCCTGGTTACTAATGTAGGCAAATGAGGTATAAAAC
TAGTGTCATATTAATCCAGTCCTAATCGGTGACAGCACATCGAAGAAGCT
CATGCATATAAAAAATATTGGCCTTGATATATTCCCAATTCTGCATAATT
TCTATTATGTCTACCCTAGAAATCTTACATAATTTCATTTCCAGGCTGTA
TTGTTGCTGACAAAGATATCTAGTAGCATGGTTGGGGATCCCATTGAAAG
AGAAAG
View all "STS037" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS006 CCCCACCTGCCCCGGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAATGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTATACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTACCAGCTCAGTGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATCGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "STS006" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS113 CCCCGCCGAGGCCGGCGCCGGCCGCGAGGGCTCCGGTTGTAGCGGAGGCG
GCGGGTTCCGGGAACGGAGCGGCGGCGCATGCGGCGGCTGGCCTCTCGCG
TTGCTCCAGCACGGCGTCGTCCGTGGACGCGGCGGCTCAGGACAGGAGCC
TCGCGTGCCGCTCCGACGTCGCGGAGGTGAGGGAATCGAAACCCTAGAAT
TCGAATTCGAAAAATGATCCCAGATCTCTAATCACCGGTTGCTGAAGCGT
GCGTGCTTTTTGGTGATGTTCTACAGGCAGGCAGCGAGCATGTCCCGGAG
GGCTCCGCGAGCGACTCGGCGAGCGGCCGTGACCGCGAGAGGTGGGAGAA
TTCTCCCTCATTTCCGGCAAATTCTTCTGAATTATGCGTTCTGACATGCC
CCTGACGCCGAATCACCCTCGATTTTTCAAAATTTTCAAATTCCAGGAGA
GAAACAACTCCATCAAGCTTTCTCCCCGGAGAGGTGAGCGATCTGGAGTC
GGATCTGGCTGGAGGACAGAAGCGCAGCCGT
View all "STS113" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS053 CCGAGCGCATGAGGGATTGCTTAAGAAATCTTAAGCAGCAGAACAAGGTA
GCATGTAGTTTTAACTTGAAATCATCTTCAATGTTACTCATATTTGTCAG
GCAGATTGACACATATCCTTCATTGCAT----GTGAATACAGATGCAACT
GTAAAGACTTGAGAATTCTATTGTTTGTTGAAACTATACCAAAAATTGTG
TTCTCCCTGTAGTTTTAGAGTGGAATCATTCAATGCTGATATAATCATAT
TATATGTTTGGTATTCAATTTGACCCAATTATGGGCCGTTTTTGCAACAG
GATGACGATGCTAAAGTGAAGAGGGCTTTTCAAACACTCCTTACCTACAT
TGGCAATGTAGCTAAAAATCCTGACGAGGAGAAATTCAGGAAGATCAGAC
TGTCCAACGCTACATTTCAGGTGAAAATAATTACTGTACATATTGACCTG
GTAAAATGATCCGCTGTTATCCTTTCAAGAACAACACGCGACTGATAATC
TGTTTCGGTACAATGCAGGAGAGGGTTGG
View all "STS053" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS001 CCGCCGAGGAGATGGTCGTCCTCTCCGGCGCCCACACCGTCGGCCGCTCC
TTCTGCTCCTCCTTCCTCGCCCGCATCTGGAACAACACCACCCCCATCGT
ACGTACATAG----------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
ATCGATCGCCGGCGACGGCGACGGCGACCTCGCG----------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
---------------------------GCCATT-GACCATTTCGCCATTG
ACGTACGGCTCACATG---GCGGCGGCCGGTGTGTTCGATCGTGTGCAGG
TGGACACGGGGCTGAGCCCGGGGTACGCGGCGCTGCTGAGGGCGCTGTGC
CCGTCGAACGCG------TCGGCGACGGCGACGACGGCGATCGACGTGAG
CACGCCGGCGACGCTGGACAACAACTACTACAAGCTGCTGCCGCTCAACC
TGGGGCTCTTCTTCTCCGACAACCAGCTGCGGGTGAACGCGACGCTGGGC
GCGTCGGTGAGCAGCTTCGCGGCGAACGAGACGCTGTGGAAGGAGAAGTT
CGTCGCCGC
View all "STS001" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS014 CCGGAGGAGGACGAGAAGCTGTTCAACCACATCAGCCGCTATGGCGTCGG
CTGCTGGAGCTCCGTCCCAAAGCTCGCCGGTACGCCCATCGATCAGTGTA
TGCATTAGTAACCAAAAT----GGCAAACTGACAAGCTAAGCTAAACTTG
GGTTAATTA--ATCACTTCTTTTCTCCTGAATAATAATGCTAATTGCTTA
CATCAATGTGTTTATAGTATTTCAGTTTATTATTTCATCAATTTCTGTCC
TGCTGCATAATGCTCACT------ATAGAAATGTGTTTATATC-------
----------------------------------------GTAATTTAGT
TGCTATACCTCTCTCTTTGTATCTC------ACTCTCTGACAGTGTGTGA
ATAATATAATGTGTGTTGCTGAGTTGCTGTGTACAGGATTGGAGAGGTGT
GGCAAGAGTTGCAGGCTGAGATGGATCAACTACCTGAGGCCTGATCTCAA
GAGAGGCAGCTTCTCCCAGCAGGAGGAGGAGCTCATCATCAG
View all "STS014" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS029 CCGGCGAGGGTGCCCCGGCGGCTGACCGCCGCCGAGCTCCTGCCGGTGAC
CCCGACTCCCCCCGCCGCCGAGAGGAGAACCACCCGGAAGCGCAAGTCCG
ACGTCGACTTCGAGGCGGAGTTCGAGCTTTTCGAG------------GAC
GACGACGACGACGATGAGTTCGAGCTTTCCGACGATGGCGACGAGAGTTT
GGCCGTGTCATGTGTGTCGTCCCCCAAGTCGAAGGCAGTACCTTCGTTTT
CTTGTACGATGAGATGGAGAAATCTTGCCTGCTTTCTTGAAGGATTTTCA
CCTGACGGCAACCTGAACTTTACACGATTTCTTCTCCTGCTGTTGATTTC
ATCGATCGCCGGCGGCAGTTTCGTCGGATGTCTCCTCGAGCTCCAGGCCG
CGGCGGCGCGTGGCGGCGGCGGCGGCCGGTCGTCGGAAGGCGAGCAAGAA
GAG---------CAAGTACAGGGGCGTCCGGCGCCGGCCGTCGGGGAGGT
TCGCGGC
View all "STS029" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS087 CCTCCAGCTTCAAAGGAAGTCGTTGCGAATCTACCAGTTGTAACCGTGAC
AGAAGAAATCATAGCTAGATTGGGCAAAGAGACTCAGTGTGCTGTTTGCC
GGGAGAGCTTGCTGGTGGACGACAAGATGCAGGAGCTACCGTGCAAGCAT
CTTTTCCACCCTCCATGCCTCAAGCCATGGCTGGTAATGTCCACATAACC
CCTTTGAATCATCTGAAAGTAGCCTCGACGCATCGTTACAACTCGGTGTA
GCTGAACATTATACCCATCATGGTTGTGTTGTGTTGCACGCAGGACGAGA
ACAACTCCTGCCCGATCTGCCGGCACGAGCTGAGGACGGACGACCATGTG
TACGAGAGCCGGAAGGAGCGGGAGCGAGAAGAGGAGGAAGACAGGAAGGG
CGCCGCGA
View all "STS087" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS080 CCTTTCTTATGCTTTCTCGGCACTTTTTAGGAAATTGAGTACATTTTATT
CTCTGTAAAACTAGGATAGCAGACAGCTTTTTCGATTCATTTTGTTGTCA
ATTTTCTGAAGGATGTTTCCTTTTCAGGCATTGACACCCCACATGCAAAC
ACTGGTGAAAGATATATCAAGTCCAAAGGCTGGGAGTTTGTTGGGACCTG
CTTTGGGTGATCAGCAACAAGGGAACTTCTCCATTCATCTTTGGAAAACT
GCTTTCCAAGATGCCTTCAGCAGAATATGTCCTCTTCGTGCTGGTGGACA
TGAGTGTGGATGCTTACCAGTGTTGGCAAAACTGGTATGTTTAATCATTG
ATATTTAATTTGAGAAGAATAATCATTTTTGTGAAGTTTATGCATGAGTT
GTTTTATTATTGTCAGGTGATGGAGCACTGTGTAGCTCGTTTAGACGTT
View all "STS080" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS051 CCTTTCTTGACAGATGCTTTGACAAAGTTTCAGGTAAAGCTTTCCATGAA
CAAAAATACAATCTGTTTATGGTTTCATTGATCAGAGGTAATGGAAATGT
TCTACAAATATTGTTACACACTATTGACCTGGGGTCAGGGGATATTTTAC
CATCTCCTTTATGGAGGACAACCGAACCTTACAATAAACAAAGAAAAGTG
TAACTGAAGAAGTTCATTTGTTTTACAATGTATTCTTCCATCATCTCAAT
TGAAATATGCTATGCTTGTTCTTGGATGAAAAGAGAAATGTCCATTAGCC
ATATGATAAGTTATTTGCTGCTTTTGGTTGGTGTCTGAACATATTATATG
CTTTCGACTTATTAAGACAACTGCTTTTGTTTGTGATTTTCTTCTTGTCC
TTGTTGGTCCAAACTGCCAGTACTTAAA-CACGCACTGCATCCTGCATGA
ATGTTTTCTTATGAGATAACTTGATTTCATTATTTTGTAGGACCCTGCAG
AGGCTGACAAGTTAATGAAAAT
View all "STS051" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS055 CGACATGGCACTGCATTTCTGTGAGCGTTACAAGTCAGTTCTTTGCATCT
TATGTGAATGGGCTTGATATGTTATATAATTCTCTCTTCTTCTTTTTT--
GCAACTTCTTATTTACATCTCAAAACTGAAAATATTATAAATACTCTACT
CAACTGAAATCCTCAGATGGAAGTTCTAATGTTGATGTTGAAAGGTGTCT
CAAAGTTGGGTCACTGTAATGATTATGATTAGGTTCTGTTTTACAGTAGT
ACTTACCATTCTATTTATTTGCAGGCTAATGGTTCTTAGAATCAGTTCAA
AATTTGAACTGAGAAGATTTTGCCGTACTACAGGGTCCATTGCACTTGTA
AGTTCTGATCTCAAGCTTTTGTTCAATTGCACAGTAGTATGTATATGCTG
ATGCATGTGCTCTTTCAAAAACAGTTGAAACTCAGCCGACCAAATGCGGA
TGAATTAGGA
View all "STS055" genotypes
NPE 844 IRGC38698 japonica   RA4948 STS109 CGACGTCGAGGACGCTGGTGCTCGCCAACTCCGCGCCGGTGCTCGCCGGG
CAGCGCCGGTACGCCGTCAACGGCGTGTCGTTCGTCGTCCCCGACACGCC
GCTCAAGCTCGTGGACAACTACAACATCGCCAATGTCATCGGCTGGGACA
GCGTCCCGGCGAGGCCCGACGGCGCGGCGCCGCGGTCGGGGACGCCGGTG
GTGAGGCTCAACCTGCACGAGTTCATCGAGGTGGTGTTCCAGAACACGGA
GAACGAGCTGCAGTCTTGGCATCTCGATGGATATGACTTCTGGGTTGTTG
GGTAAGCTACATTCCCATCAACCACTGAAACTTTCAGAT-TTTCAGTTGC
ATCAATTCTCAGATGAACATCAACATGAGAAAGATCTGTTCATTCACCTT
TGATGATTTCTTTCTCTGATAAATGGATTCAGGTATGGCAATGGTCAGTG
GACTGAGAATCAGCGGACAACCTACAACTTGGTTGATGC
View all "STS109" genotypes
[ Download ]