grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "IRGC8191" from the experiment "Genome-wide patterns of nucleotide polymorphism in domesticated rice".

E.g., Germplasm "IRGC9542", RA4969, Basmati 1, Marker/locus RM22.

Items 1 to 25 of 103.       of 5 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
Mansaku IRGC8191 Japonica   RA5016 STS093 TTACTCTTCTCCTTCCATTGTTCTGGCCGCAAGGGGTCATAATGGAGGCA
GGGTCATATTTGATGATTATCGTGAAGCGTATTATTGGCTTCGTCAGAAC
ACTCCTTCTGATGCAAAGATTATGTCATGGTGGGATTATGGATACCAAAT
CACAGCTATGGGGAACAGAACTGTTATTGTTGATAACAACACATGGAATA
ATACACATATAGCTACAGTTGGGCGTGCAATGTCATCCTATGAAGATGAA
GCGTATGAGATAATGCAGTCACTGGATGTGAATTATGTGCTTGTCATATT
TGGTGGTGTTACTGGTTATTCTTCAGATGACATTAACAAGTAAGTTTATC
CACTGAATCTAGAGCAAATTTTAATAAATCGATGTTATTGGTTTTATTCG
AATTAGTATTGAACATTTTTTCA-AAAACTGAACTACAAAATGGATTCTT
ACTTAGCTGCTTATTTCCAGGTTCTTATGGATGGTGC
View all "STS093" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS018 GTGTATTTTGCTCATTGCACGTCAGAGATGATATTCATTACTCATTTGCT
CACAGAACAACCTGAGAAACTTGCTGGCCCTCTGCTGGCTGATACTTATG
TTACTCTCCTGAAAGGTCGCAATGCGTGGTATGGGCAAATGCTAGCGAAG
GGAGAACTGAGCCCTGACATGGGCGACAGCATCAAGGGGAAGGGGATGAT
TCAGGTTATCTCATAAAACTACTCATTATTTTCCCCGAAAGTTATATGAA
TTTTGAGCGTATTTTTGAAGAATGCTGGAAGTCAAAACTTGCAAAAGATA
TCACATCATCCTGGATATAACCTGTTCACTTTTCACTCTACAGGGTATCT
CTGCTGTTGGTGCATTTTTTGAGCTTCTCAGTCAACCCAGCTTAAGTGTG
CAACACCCAGAGGAAAATAAGCAAGTTGCAC
View all "STS018" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS017 NNTTTCTTTCTGCTAAACTTTGCAAGACTCGTCCCCTGGTAGTAGTAGCA
GCTATGGAGGTCTCGAAGGAAGCCCCTTCTGCTGACTTTGCCAATCGCCA
GCCTTCCAAAGGTTGTTGCTGAGAACTCCATCTTATTAAATTGATTGATA
TGCCTCTGCGGGTTGCACTGTCTCCAGTTCTAAATTTAATATAACTTTTG
TCCTTGCATGATTCTGTTAGGGGTTCTTGAGACATGGTGCAATGCCGATG
CAGTGTGTTTTGATGTTGATAGCACGGTCTGCTTGGATGAGGGTATTGAT
GAACTCGCTGATTTCTGTGGGGCTGGGAAGGCTGTTGCTGAGTGGACTGC
AAAGTAAATAACATGTTATGAACATTAGTTTTGAAGTGTGTTTGTTGCTT
AGTGCATAAAATTCATTCAGGATGCTCATTGGTTTAATATTCTTAGGGCA
ATGACAGGAAC
View all "STS017" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS108 TCGTGTAGCTGCTTCCAAAATAGGCACTCTTCTTGGGGCACATGTCGAGC
AGTGGAATACAGCTGAGTGTTGGCTTCAGCTGTATGAACGCTGGTCATCA
GTGGATGATATTGGTTCCCTTTCAGTGATTTACCGGATGCTTGAGTCAGA
TGCAGCAAAAGGTGTTTTGTATTTCAGACAATCTTTGCTGCTCCTTAGGT
TAGTTATACTAGCACCTCACTCTGTTGATTCCCTTGTGGCCATTTTGGTC
TCAACTCTCAACATAACTATAGATGATGCTTAATATTTTTTT-GTTTACA
GGTTGAACTGTCCTGAGGCTGCAATGCGCAGTTTGCAATTGGCACGGCAA
CATGCAGCAACTGAGCATGAACGGCTAGTGTATGAGGGGTGGCTTTTGTA
CGATACTGGGCATTGTGAGGAGGCCCTACAAAAAGCAGAGGAATCTATTT
CTATTCAAAGGTCATTTGAGGCTTTCTTTCTGAAA
View all "STS108" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS122 ACGGCTTCATGAACTTCATGCACCGCGACGAGGAGGTCGACTACTTCCCA
TCCCGCTACGATCCTGCCAAGCACGCCCCCCGCTACCCCATCCCCTCCGC
CACCCTCACCGGCCGCCGCGAGAAGGTAATTCTGTTGATTGATTTGCGTT
TGGGTTTTACATTTCACTATATTTTCTTTCTTAATTACTACTTCCCCCGT
TTCAGATTATAAGATGTTTTAATTTTAGTCAATCTCAAACTATAAGTTTA
ACTAAGTTTATAGATAAATATAGTAATAATTACAACACCAAATTAGTTTC
ATTAAATCATTAAATCTATAGTTCAATATATTTATTATGAGTTAAAAATG
TTACTATTTTTTATATAAACTTAGTCAAATTTAAAACAGTTTAATTTTGA
CCAAAGTTAAAACGATTTATAATCTAAAACAGGAGAAGTAGTAATAGCTA
GTCAATTTATTAACTGGTTTTGATCGATCGGGTTGC-GAGTGCAGGTGGT
GAT
View all "STS122" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS052 AGTACGACGCAACGGCCGCACCACAAGGTGCAGACTACCACAAGTGCAGA
GAAGAAGTAGTGAAGTTACTGAAGGTGAATGCGCCCTGCGAAACCAAGAA
CTGCAGCTTCAATGGCGTCTGGAACGGTGGTGGCGGAGCAGGGCAGGATG
ACCTCTACGTTGCGTCCGCCTTCTACTACATAGCCTCCCATGTACGTCGT
GATTACTTAATTAATTAGCCAACTAAATTATTTAACTTCTCAGGCATGCT
TCAGACTGGCTACTAGCTAACTAGTTATGTAAATATATACCCCTAAATAT
GTGCATTTAATTGTTTGTGTAATTATGTTACATATACAAATTAATACTTT
TACCTGATAATTTTATCTCCAATGCATACATTTTGATCGGACCGGGATAA
AGGTTGGGTTCATCAACAGCGATGCACCCAGTGCGAAGTCAACCCCTGCA
ACGTTTAAGGCTGTTGCAGAAAAGGTTTGTAAACTGAGTGTCAAAGAAGC
AAAAGTAGAATACCCC
View all "STS052" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS009 GGTTGTTGACTATTCCTTTGGAGGTTATAGCTACATTAAGTGTGAGGCAG
TCCTAGAAGAGAACAAAATATGTGGGCATATTGGGCACCTTGATTGTGCT
CTCCGTACTTTTATGGCTGGAACAGTTGGAGGATGTATTGACTTGGACAT
GCAGTATTGTTGCAGACGTTGTGATAACAAAACGAACTTGATGCTGCACG
TAGAAAAATTCTTGGAAATATGCCAATCTCTTCAATCAAGGGATGACATT
GAACCTATCCTGAATACTGGCTTATGCCTAGTGCGTGGTTCAAGACAAAC
AAGAGCAAAAAGCTTGGAGAGCATTATGAGATCAGCAATGGCAAAGGTAT
GGTCAGTTTTATTTTTTT-AGCCACTTGTGGAAACTTCCATTTTGGTCAC
CATTTATCTTCTTTTTGATCTCTTATAAGTAGTTTGTGGCTATGCACTGA
TGGTTTACAACTATATGCAGCTAAAGTGTGGGGTTGATCTTGCTGAAGTT
View all "STS009" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS120 AAACAAGTTGGTGTTTTGACAGGTCATTTAGATGGGATTACATTTATTGA
TAGCCGTGGAGATGGGCATTATTTTATTTCAAATTGCAAGGATCAAACTA
TTAAACTATGGGACATCAGGAAAATGTCGTCCACTGTGAAAGAGTAAATA
CAGCTCTTGCTTTTGCATGATTATTCCTCTAAACCAAACCACTTTTT--A
TGCTTGAATCTTAAACGCAACATATTGTAAGCAAGTAGGAAATGCTAAAA
TCAAAATCTGCCTTTGACTAGATCTGCTTGGCCTGATTTGTCCAAGATCT
TGTCTACATGCCTGACCCAAAGTCCAAAATATAAAATAGGCTAAAGTTAT
TCGACAGAAATACTATTTTTACTTGTAGTTTGTTTTTGCAGCTGCACACC
AAAAGCATATGAATGGGATTACAGATGGATGACATATCCCTCAGAAGCCC
GATATTTCAA
View all "STS120" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS099 AAAACTTTTACAGATCTCTTCGATTACTTCCCCTTGACAGCATTGGTGTG
TATTCAGCATTTTCATATGTATATGCCAACATCCTTCCCACATTATCTAG
TGAATCTGACAGAAGCTGTTCATTTGTTCTGTAGGTTGAGTCAGAAATAT
TTTGCCTGCATGGTGGATTATCGCCATCCATTGAGACACTTGATAACATA
CGTAACTTCGATCGTGTCCAAGAAGTTCCCCATGAAGGGCCCATGTGTGA
TCTTCTGTGGTCTGATCCAGACGATCGATGTGGTTGGGGTATTTCTCCTC
GAGGTGCTGGATACACCTTCGGGCAGGTAACATTTTATATAAGAAAAAGA
AT--CTCTATATTTAGCTGTGCACCTCATGTTCATCGACTTATCAATTCT
ATCATTTCAGGATATATCAGAGCAGTTCAACCATACCAATAATTTAAGAC
TTATTGCTAGAGCTCACCAGTT
View all "STS099" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS109 CGACGTCGAGGACGCTGGTGCTCGCCAACTCCGCGCCGGTGCTCGCCGGG
CAGCGCCGGTACGCCGTCAACGGCGTGTCGTTCGTCGTCCCCGACACGCC
GCTCAAGCTCGTGGACAACTACAACATCGCCAATGTCATCGGCTGGGACA
GCGTCCCGGCGAGGCCCGACGGCGCGGCGCCGCGGTCGGGGACGCCGGTG
GTGAGGCTCAACCTGCACGAGTTCATCGAGGTGGTGTTCCAGAACACGGA
GAACGAGCTGCAGTCTTGGCATCTCGATGGATATGACTTCTGGGTTGTTG
GGTAAGCTACATTCCCATCAACCACTGAAACTTTCAGAT-TTTCAGTTGC
ATCAATTCTCAGATGAACATCAACATGAGAAAGATCTGTTCATTCACCTT
TGATGATTTCTTTCTCTGATAAATGGATTCAGGTATGGCAATGGTCAGTG
GACTGAGAATCAGCGGACAACCTACAACTTGGTTGNNNN
View all "STS109" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS101 GAGATGTCAGAGAAGCCAACGTTGGCATCGCCCCTGAGCTTGCCGGCGTG
ATCGCCGACGAGGTCGACATCATCGTCAACTCAGCAGCAAACACCACTTT
CGACGAGAGGTTTTGTCATTCTCTGAACTGCAGTGTTGCTCCAAAGATGA
GTTCTTAATTGGATCACTTCATGTATAATAAGCATATGAATTGATCACTG
TTGCTGCATTTGGTTCGATTTTGCAGGTACGATGTTGCAATGGACATCAA
CACCGTAGGGCCATTCAGGATAATGAGCTTCGCGCAGCGGTTTCGGAGGC
TGAAGCTGTTCTTGCAAGTGTCAACAGGTCAGAAATGCATGTCAAATGAA
AAGCTCTTGTGCTGAAAACTTGCACTGAAATT-ACCTCCAAAAACCTTAG
ATATATCTCTCTACTGTGGATTTTGAATTTCATGTTTGGCAATCAGCATA
TGTGAACGGACAGAGGCA
View all "STS101" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS089 AAGCTGTGAAGGTGGTCGACATTGTGGACACCTTCCGTCTTCAGGTTGCT
CTCACTTCCATTACCTTGGCTCTTGTATATGATACTATCTGCACTTTATT
TTTGTGCTTAAATTCCATGTGTGTTTGGCAGGAGCAACCTCCTTTTGACA
AGAAGCAGTTTGTGACCTTCATGAAGCGCTACATCAAGAACCTCTCCGCC
AAGCTGGATGCGGAAAAGCAAGAGGAATTCAAGAAGAACATTGAGGGTGC
CACCAAGTACTTGCTTGGAAAGCTCAAGGACCTTCAGTTGTAAGTTCACT
A--ATTGCTTGCCACAGGTCCAGGAAATAGTAACATATGTGATGCCATGA
ACATGTCTCACCATTAGTGCCTACAAATTCCAGTTTAAATGATTTGCTAT
GTTCTATCACATTAAATTCTTGAAGCAAT---------------------
-------------------------AAGACTTGTATTCAAACCTGCTTCT
TATGCTGTCTCTTATGATCTGTTTCAGCTTTGT
View all "STS089" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS048 AGTTGCTGTAAGCAAAAAAGCCATGATTTTAGCCTATTTTTGGCTATTCC
TGGGTAAGGATCCCTCTCTAGTATTTCCTTTTCACAGCATGCACCCACAA
CATAAGTCAACTATGTGCTATCAACCTGAACATTACCATCTGGGCTGGCC
TGTTGTGTATTTTAGCAAAACCAAGCATGA---ATGCATGAATCGTATGC
TGTACTGCTGTGTAGGTGCAAAACTGGAAAGCACACAACTGAGAAACCAA
TCACAAAAGCAGTTCCTACTAAACCATCAAAGGCAGTTCCAGTCCAGACT
TCGAAGCAGAGTGTGGGAGCTGACACTTGCTCAAGGTGCCGTCAAGGTTT
CTTTTGCTCTGACCATGGTGAGTTTCTGTCTATAAGCATAATGCTTGGAT
ACAACTGATTGATCCCCTATTTGGGTGTAAC-------------------
-AGCTGATTGTTTCGTTATTATTTTAACGACTGACATCCCTATGCATTTT
TATGTGTTGATAGAATAAATCGTAACTTTTAATTTAACAGATTATGCACT
GCTATTT
View all "STS048" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS058 CTCACAGTATCTGACATAGCATCCCACATCCAGGTCCAGATTTCTATTTG
TAGACTAATCACACTCTTATTGTACTACATATAGTTCACTTTCACATCTA
TGATCTGTTCACTGAACCTCTCAGCTAGGCTGTAGTATTATGAACGATGA
TATTTCATCACATTTCATTAATAGCTCCTGTCCTTACTCCTTACCCATGT
AGCCATGTTTATGGGTTTTTCTTGAATGTAGCACGAGATTGAGTATGGAG
GTGACAATGCATTAACTTCACCGAGATCGCAACACGCATTCCAGAATCTC
CAAGCTCCAATGCACATCCCCAACACAAGCACGCAGCAGCCGCCATCTTG
TTCAATCACACCATCAAACCCTTCCAAGGACTCTATGATATTTTCGAAAG
CGCTATCCAGCCCTGTCCGGCAAAACCTGCAACTGTACCATGTACAGCAA
TGCGGTGACACAGGATGCTTTGCAGATGGCATTTTTTGCCCTGGAAACGG
TGACTCGGATCCTGCAGCATCAAATGATTCGTCGGT
View all "STS058" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS087 CCTCCAGCTTCAAAGGAAGTCGTTGCGAATCTACCAGTTGTAACCGTGAC
AGAAGAAATCATAGCTAGATTGGGCAAAGAGACTCAGTGTGCTGTTTGCC
GGGAGAGCTTGCTGGTGGACGACAAGATGCAGGAGCTACCGTGCAAGCAT
CTTTTCCACCCTCCATGCCTCAAGCCATGGCTGGTAATGTCCACATAACC
CCTTTGAATCATCTGAAAGTAGCCTCGACGCATCGTTACAACTCGGTGTA
GCTGAACATTATACCCATCATGGTTGTGTTGTGTTGCACGCAGGACGAGA
ACAACTCCTGCCCGATCTGCCGGCACGAGCTGAGGACGGACGACCATGTG
TACGAGAGCCGGAAGGAGCGGGAGCGAGAAGAGGAGGAAGACAGGAAGGG
CGCCGCGA
View all "STS087" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS036 GGCCCCCACCGACAACCTCACCGTCCTCCGCCAAAAGTTCGCCGCCCTCA
ACCTCAACGACGTCGACCTCGTCGCCCTCTCAGGTACTCGTATCACTTCT
CCGGCGAACTCAATTTCA-----GTTCTGCCGTCATGCCCGCCGGAGCTG
ACGACGACGACAATAATGCGAAATGCAGGTGGGCACACGTTCGGGAGGGT
GCAGTGCCAGTTCGTGACGGACAGGCTGTACAACTTCAGCAACACGGGGA
GGCCGGACCCCACCATGGACGCCGCCTACCGGAGCTTCCTGTCGCAGCGG
TGCCCGCCCAACGGGCCGCCGGCGGCGCTCAACGACCTGGACCCGACGAC
GCCGGACACCTTCGACAACCACTACTACACCAACATCGAGGTCAACCGCG
GCTTCCTCCAGTCGGACCAGGAGCTCAAGTCGGCGCCGGAGGCGACCGGG
ACGACGGCGCCCATCGTCGACCGCTTCGCCACCAGCCAGGCCGCCTTCTT
CCGCAGCTTCGCGCAGTCCATGATCAACATGGGCAACCTCTC
View all "STS036" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS024 TTCTTTTATAAGGTAATTCTAATTTTGTCCTGAAATGCATTAATTATTTA
CTCTACTTGTATTGCTAGCTAGCTAGCTAACAACATCATCGTGCTCTTCT
TGTTAGCTTTTCTCAAATGGCATGAAAGAATCTGATCAGAGGCATGCTAC
TCTTAGAATAACTGCTTCAGGTAATTCTGTAGTTCATTGTTCATTGTTTG
TTTCTGTTTGACAAAAACTATAATTTCTGCACTATCCTATGACTGTCTGT
AACGTTTTTCTTTATATTGCTGATATGATCAGTTTTGGTGGAACTTAAAG
CTTATATCGATCTGATATTTAATAGTCCTGAATATTTATTCAAATTGATA
TTCTAGAATTCAATGTTGTGCATTTTCCTATATCATCTCTCAAGAATTAT
CAAGAAGTGTATGCTTCATTTGAAACTTTTCCAAATGAGAATAAGGGAGA
TTTTTCTGCTATTTGATTTTCTTGTAAACAGAT--AGCTTTTATCTGATC
ATTGTATGTCTATCTGAAACAGA
View all "STS024" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS085 CCATTATGGTGTTGGAATTAAAGGGAAGGAACCCTCAGATTGTGGTGGGT
AAGAGATGGTGGTAGTGGAATCATATCAAAGTGTGGTGCTATTGACTAGA
GAAAAGTTGATGCAGGAAGGAAAAAA--CTGGAGATTGTGGCGGAGGGTT
GGGTTTGGTTTGGCTTTGGCCGGGGATAATAAATGATGGAGCTGTAGCCT
GTAGAATTAGGCCTTGTTTAGTTCCCAAAACAAAAACTTTTCACCCATCA
CATCAAATATTTGGACACATGCGTGGAGTATTAATTATGGACAAAAAGAA
AAACCAATTACACAGTTTACGTGTAAATTGTGAGATGAATCTTTTAAGCC
TAATTGCGCCATGATTTGACAATGTGGTGCTACAGTAAACATTTGCTAAT
GACAGATTAATTAGGCTTAATAAATTTGTCTCGCAGTTTCCTAGCGGAAT
CTGTAATTTGTTTTGTTATTAGATTACGTTTAATACTTCAAATGTATATC
CGTATATCCGATGTGACAACCAAACCCGAAAATATTC
View all "STS085" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS008 TTAAGCGGGCAATTGCAACGAGCATTTGTCACAGGTACACGCTTCCTCTA
CATGTATATTTTGTGTGTCTTATATCTAGTATTTCAGTTACACCTTACAC
CATGACCCATCAATCTTTTATCCCAGGTGTACCTTCATTGAAACGGTCTG
AGCTGGAAGCAGCATGTGAGGATTTCAGCAATATAATTGGTTCTACATCT
AGTTGCATGTTGTACAAGGGAACTTTATCAAGTGGAGTTGAAATAGCAGT
TTTGACAAGTTCAACAGAATCCGGGAAGGAATGGTCAAAAGAATGCGAGT
CACAGTACAGAAAAAAGGTAACATGTGCTCATAACTTTTAGGATATCCCC
TAAAATACAAATATGTTTTCTGTGGTGCAAATGACTTTTCTCAGAAATGT
GCGTATGCTTTTTCTCATCTTTACTGTGCGAATGGCTGAAATGGTTATGA
TTTCAGATCACAAATTTATCCAAAGTTAGCCATAAGAACTTTATGAATCT
GCTCGGCTATTGTGAAGAAGAG
View all "STS008" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS116 TGAAATATCATATATGCTTGCTGTAATGGCACTGCCTGAATTAAATGGTG
GAATAGCAAATGAGCATCAATCTATTGTCAGCATAGTAGAAACATCTGCA
GATTTGGAATCTACTTGTTCAAGCTCCCTTGTTGGGTAAGATGGTTTAAC
AGTAGCTTATAATTATATATTTTGAGATGTTATGTAGTTATTCTGTTGTA
TTTTGGAAGTTAAAAGACAATGAAATTGTTTATTTTGCAGGTATCTCTTA
TACCATGATGATCTTAGACCTTCAATACTAAGGCTAATCAATAATATTAT
TGGCTATTGGAAAGATAGTGAAGCAAGGATTAAAGTTGTGTCATTTTGTC
ATATGCTGATCCAACTTGCTATTTCTACGCACAATGATAAACTTATATCT
TTTGTTCAAGATAATTTAATTCCAATGGTTGTCCGATGCTTAATATTTGA
GCCAATATCAAACAATAATGATCTTCTTCTT
View all "STS116" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS092 GGGTGGCATGGCCCGTATCCTGAACGCAAAACATTTTGAGAGGTTGAGTG
GCTATCTGGAGGATAATAGGGTGGCAGCTTCTGTAGTGCACGGTGGTTAC
ATGGACCCCAAGAAACTGTAAGTTCTGAAAACC-----------------
-----------TGTTGGCCAAGCGTCTGCACACAATTGGTCCCGCACGAT
TTCATTCCCAATTGCTTGCAGGAATATTGAGCCAACCTTACTGCTAAATC
CTCCTGCTGATTCTGATGTCATGACCGAGGAGGTATTTGGCCCGATTCTC
CCAATCATCACGGTACGCACTGACAACGATTGCATAGT-TTCTGGGTGGA
TGATTTCACATACATCTGCAACCTACGACTGAACCAATTTGATCATCCGT
TTGCAGGTAAAGAAGATCGAGGATTGCATCGCGTATTTAAAGTCCAAGCC
GAAACCGATTGCGATGTACGCCTTCACCAA
View all "STS092" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS057 CCACTGAGCTACAGGGGAGCGGATATATTTGTGCTGGCATTCTCACTGAT
CAGCAGAGCAAGCTATGAGAATGTTCTCAAGAAGGTAGGTACTATACTCC
ATTTAGTTCAGTTTGGACTCAAAATGTCTGAACATCTGACAACATGAGGA
TAGTGACCACAGATACTGTACCAAGAACTTTACCTTTCCTTCTGACAATG
ACATTTTTAGACCACCTTTGACCAATATTCTTCACATTTTTCTTCTTTAC
AGATATATACTATATGTGCATATGATTTTCACTGGAATATTCTGAGCTAA
TGTTATCTTTTTCTGTTTCTGATCATGCAGTGGATGCCGGAGCTTCGCCG
GTTCGCACCGAATGTTCCAATTGTTCTTGTTGGGACCAAGTTAGGTTTGT
ACCGGATGCAACATTAACTCAACAAAGCTCAGTGCCACTTCCTTTTGCAG
GCTTGTTTCAATGCTCTTAGGTTTTAACCGTGCTTGCTTCCAATTGTTCA
GATCT
View all "STS057" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS077 CTGGTGAAGCAACAGAACAGATTATTAGGCAAGTAGAGAAGATGACTAGA
AATATTGAGCGCGCTTCTCGTGCTAGCAAGGTAATGCCTGTACTGCTGTA
TGCATATATATTGCAGCATTAATAAATTTGGTATTTGCTTTTTTAGTTTT
CCTTGGTTGTGCACGTTCCTTTGAGGAATGTTAAAGTGTTCTTTTATTTA
TAGGATGAACCTTCAACGTTGGATATGCCTTACGGAGATGTTAGTCGGAA
ATATCCTGCTGCCAGATCAAGTGATGCTTTTGCTACAGCTGATGGCGTAG
CTAAAAGAGCAAGATTTGATACCTCTGCTGCTTTAAACCCACCATTTCAG
GGAGCATCTGATTATTCTAATATGCAGGTTGACAATGAAGCGAATGTGGA
TCATTCCTCTGATCCAGCTCTCTTGAATTGTGATATGTCTCCTGTTGAGA
AGATGATTGAAATGA
View all "STS077" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS054 TTTTGTTACATTTTCGGATCCATCTGTTATTGACAAGGTTCTGCAAGATG
AACACACTATAGATGGAAGAACAGTAAGCCTTCTATGTATCACTTCACCA
AAGTATGCAAAGCTTGCTGTAGAGTCTGTTCTCATTTGTCTGTCATACAT
TTTGATCTATCAAGGTTGAAGTTAAAAGGACTGTCCCGAGGGAGGAAATG
TCGTCGAAAGATGGTCCTAAAACGAGAAAAATCTTTGTTGGTGGTATTCC
ACCATCTCTTACTGAAGGTAGCCAGCAGAACTAAGTTGTTTCCTTTTTAC
AAGCAAAAATATATTTGTATTCTAGAAAACAATGGCTTGAATACTCTAAA
TAATGTTATGTCTTGATAAATATGATTGTCATGAAACTTCCAGATAAATT
GAAGGAGCATTTCTCTTCATATGGGAAGGTAGTTGAGCATCAGATAATGC
TTGACCATGGCACTGGGCGGTCACGAGGCTTTGGCTTTGTCACATTTGAA
AATGAGGACGCT
View all "STS054" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS104 GTACTAACAAATTACTACATAACCATCATCATTCTTTTTCCTAACATACA
AAGATGATAAGTCATATTTTTGT-GTACCAGTTCTTTGATCACGCAATTG
GTATCAATGTTCCAAGGTCCCGGTTCCTACCAGTGAAGGCAACATCAGAT
TTGCAGCTAGTACAGGTCTGTATGACACTCTGAGTAAACTTTTTAGGGTA
ACACTCATT----C----TAACTTAACTGTTTCACCCTTGCAGTCTGATC
TATATACCTTGGTTGATGGCTTTGTTACACGCAACCCGGCCAGAACAAAC
CCATCGAATCCCTCAATTGAACTGGGTCCAGAGTTCAAGAAGGTATAGTT
CCTTCCAACATTATTTCCTCATGCAAAAGCTTTAATTTAGTTCATGAGTT
CAAATGAAATTAACTGATCCTTCTTCGCGTAATGGCAGGTCGGGTGTTTC
CTTGGTCGCTTCAAGTCAATCCCC
View all "STS104" genotypes
[ Download ]