grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "IRGC8191" from the experiment "Genome-wide patterns of nucleotide polymorphism in domesticated rice".

E.g., Germplasm "IRGC9542", RA4969, Basmati 1, Marker/locus RM22.

Items 1 to 25 of 103.       of 5 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
Mansaku IRGC8191 Japonica   RA5016 STS052 AGTACGACGCAACGGCCGCACCACAAGGTGCAGACTACCACAAGTGCAGA
GAAGAAGTAGTGAAGTTACTGAAGGTGAATGCGCCCTGCGAAACCAAGAA
CTGCAGCTTCAATGGCGTCTGGAACGGTGGTGGCGGAGCAGGGCAGGATG
ACCTCTACGTTGCGTCCGCCTTCTACTACATAGCCTCCCATGTACGTCGT
GATTACTTAATTAATTAGCCAACTAAATTATTTAACTTCTCAGGCATGCT
TCAGACTGGCTACTAGCTAACTAGTTATGTAAATATATACCCCTAAATAT
GTGCATTTAATTGTTTGTGTAATTATGTTACATATACAAATTAATACTTT
TACCTGATAATTTTATCTCCAATGCATACATTTTGATCGGACCGGGATAA
AGGTTGGGTTCATCAACAGCGATGCACCCAGTGCGAAGTCAACCCCTGCA
ACGTTTAAGGCTGTTGCAGAAAAGGTTTGTAAACTGAGTGTCAAAGAAGC
AAAAGTAGAATACCCC
View all "STS052" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS087 CCTCCAGCTTCAAAGGAAGTCGTTGCGAATCTACCAGTTGTAACCGTGAC
AGAAGAAATCATAGCTAGATTGGGCAAAGAGACTCAGTGTGCTGTTTGCC
GGGAGAGCTTGCTGGTGGACGACAAGATGCAGGAGCTACCGTGCAAGCAT
CTTTTCCACCCTCCATGCCTCAAGCCATGGCTGGTAATGTCCACATAACC
CCTTTGAATCATCTGAAAGTAGCCTCGACGCATCGTTACAACTCGGTGTA
GCTGAACATTATACCCATCATGGTTGTGTTGTGTTGCACGCAGGACGAGA
ACAACTCCTGCCCGATCTGCCGGCACGAGCTGAGGACGGACGACCATGTG
TACGAGAGCCGGAAGGAGCGGGAGCGAGAAGAGGAGGAAGACAGGAAGGG
CGCCGCGA
View all "STS087" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS104 GTACTAACAAATTACTACATAACCATCATCATTCTTTTTCCTAACATACA
AAGATGATAAGTCATATTTTTGT-GTACCAGTTCTTTGATCACGCAATTG
GTATCAATGTTCCAAGGTCCCGGTTCCTACCAGTGAAGGCAACATCAGAT
TTGCAGCTAGTACAGGTCTGTATGACACTCTGAGTAAACTTTTTAGGGTA
ACACTCATT----C----TAACTTAACTGTTTCACCCTTGCAGTCTGATC
TATATACCTTGGTTGATGGCTTTGTTACACGCAACCCGGCCAGAACAAAC
CCATCGAATCCCTCAATTGAACTGGGTCCAGAGTTCAAGAAGGTATAGTT
CCTTCCAACATTATTTCCTCATGCAAAAGCTTTAATTTAGTTCATGAGTT
CAAATGAAATTAACTGATCCTTCTTCGCGTAATGGCAGGTCGGGTGTTTC
CTTGGTCGCTTCAAGTCAATCCCC
View all "STS104" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS028 GTGAACACCGGTTTCCTTTCCTTGTTAAGGTACAAGGACCCAAGACTATG
ATACTAGTTGTAATTATTCTTTTCAAATTTCCTGTAAGGCTGTAACTGTT
ACAACCCTGGCAGGTTAACAATTGGAATAGGTTCAATTGCAACAGTGGAG
GAACTCTTGTTGAGAAGTGCTGCCATTTTTTTGATTTGATGAGATTGTTT
GCAGCTGCAAACCCTGTTCGTGTGATGGCTTCTGGAGCCATTGATGTCAA
CCACAAGGATGAAATTTATGATGGGAAGGTCAGGTTAATTGACTACAAGA
TCGCTGATTTATAAGCTGGATGGCATTTTCACTCATGTGATTATTTATAA
GCTTATAAAGGCTATATTTATAAGCTGCAGCGCATTTTTTGTGCTTATCG
GGTTATGGTGGTCTCAGTTTAAACAGCAGTCCCTGATTTTAACTTCTTTC
TCAATGCAGGTTCCAGATATTATAGACAATGCATATGTAATAGTAGAATT
TGATAATG
View all "STS028" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS117 AGGAAGAAGATCAGAGTCTTGGTACGTT---CATCAGAAGAATGCTATAG
AGAGAATGGAAGTGATTCAGCTTAGCTTACTGTTTTTGTGTTTGTTT-TG
TTCAGATGCTGACACTGTCAACGGAGAGGTTCATGAATATTCAGAGGGAG
GCCCCTGCGGAGTTCCAGCAGTATCTGGTCCAGGTCACCAAGTACCAGGC
TGCACAGAATTGCAAGGTAGTACGTACGTAAAATATAATTGAACTGGTCG
GTGTATGCAACTCAATCATGATGTCTT------------ACGACGGCGAT
GTCGGTCGTCGCAGACGTGGATCGTGGGGAAGTGGCTGTCGCCGAGGGAG
CAGCGGTGGGCGCCGGCGGGGACGCACTTCCACCAGTTCGTGGTGCCGCC
GATCATCGGGTTCCGGCGGGACTGCACGTACGGGAAGCTCGCCGCGATGA
GGCTGCCGGAGGACGTGGAGGGGCTGGGGACGTGCGAGTACACCATGGGC
CGCGGCGTCGTGCACGCGTGCCACGCCGGCGGCGTC
View all "STS117" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS061 AAAAGTGTGATGGATTTCTTCTGCCTAATGCAGGTTGGTTAACATCACGA
AGGAAAAATACTAACTGAAGAGATGTAATAGATTGGATTATTCAAACATA
ATGTCAGCTGCAGCTTTAATACTGTTTCAGTTATCATTGATCTTACATTT
TTATCTGGATTTAACATCTGTAGGAAACAAAGGTTATACATGCCAGAAAT
GTAGCACTTCTAGAGATGGGGAAGAGTTACAAAAGATGGCTAGCGATGTA
CTACTATTATCTGACAAAGTCTCTTCCTTAGTTTCATCTGGAAGTATCCT
TTTTCACTATTACTAGATGCTATCTGAGGCAAATGTATATAATT-ATTGC
ATCATATTTTTTTGTGATTTT--GTAAAATGCTACCTTAACTTTGGGCAG
TAGATAACAGTGAGGTAGGTTCTATGTACAAGACCATTGAAGAGCTAGAG
CGGAAGCTTTACCATCCTTTGT
View all "STS061" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS033 TATCTGAGAGGTTGGATGTGTGTGATTTTTGCTTTGTTTTCTGTTACATT
GTTCATGAATTAGGTCTAACTAGCTTTCATGTGGTATTTGGAATGTCAGG
TTTATGGGGATCAGAGCTGCCATGGTCACCAATTGCCCCCTTGTTAGTTC
TTTTGCAGCAAATCTTGGTTTTCATGTATCCGGGACTGAAGATTTAGTTG
CACAATCTGGATCTTCCGCTGCTTCTAAGGAGGCTGGAATTATTTCCCAG
GCGTTAAGTCTGCTTGGATTTTCAGAGGGGAATGTTCAGGAGACATCTGA
ATTTGATCTGGTGTTTCTGCATGTTGCCATGGAGAATACAAACAGCAAGT
TGGGAAAATTGGGAATGAAGACTGATCTAAATCGGCTTGATAAATTAGTT
GGTGCAATCATGGAAGCGGCGCCCATAAGTTCAGCTATCGCCTCCCGTAT
TCTTGTATCTGTGATGTTGA
View all "STS033" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS078 AAGGTCAGGCATCTCTTCGGCGTGTGCTTGTTGGTTACTCATTTCGTGAC
TCAGAAGTTGGATATTGCCAGGTAGGCATAAAGCAATGCTTTTCAAATGT
AACTGTTTTATAGAGAAGCTCCATTACTAACACCATGCAATGCAGGGTTT
AAATTATGTAGCTGCATTGTTGTTGCTTGTTATGAAGACAGAGGAAGATG
CATTCTGGATGCTTGCTGTACTACTGGAAAATGTACTTGTCAATGATTGC
TATACTGATAATCTTTCTGGATGCCATGTCGAGCAGAGAGTTTTCAAAGA
CCTCCTAGCTAAAAAGTGCCCCAGGTATTTCCCCCCTGTTATGTTTATGG
CTTTTATGCTATGATTTTTCATCAGTCGCTGGCAATAACAAGCATTACCA
TT-ATAAGATGATTGTGAATCATTGGATTACCCAAATGATGCAGGATTGC
TGCTCATCTTGAAGCAATGGGGTTTGATGTTTCTCTTGTTGCCACAGAAT
GGTTCTTGTG
View all "STS078" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS017 NNTTTCTTTCTGCTAAACTTTGCAAGACTCGTCCCCTGGTAGTAGTAGCA
GCTATGGAGGTCTCGAAGGAAGCCCCTTCTGCTGACTTTGCCAATCGCCA
GCCTTCCAAAGGTTGTTGCTGAGAACTCCATCTTATTAAATTGATTGATA
TGCCTCTGCGGGTTGCACTGTCTCCAGTTCTAAATTTAATATAACTTTTG
TCCTTGCATGATTCTGTTAGGGGTTCTTGAGACATGGTGCAATGCCGATG
CAGTGTGTTTTGATGTTGATAGCACGGTCTGCTTGGATGAGGGTATTGAT
GAACTCGCTGATTTCTGTGGGGCTGGGAAGGCTGTTGCTGAGTGGACTGC
AAAGTAAATAACATGTTATGAACATTAGTTTTGAAGTGTGTTTGTTGCTT
AGTGCATAAAATTCATTCAGGATGCTCATTGGTTTAATATTCTTAGGGCA
ATGACAGGAAC
View all "STS017" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS096 ACCCCCTACTTCATCTGCTCCTCCAATGGTACACAATTCCTCAGTTTTGA
TTTAATATGCTCATATTTTGATTTTTCAATATGTGACCCAAGTGAGATGT
TATCATCAACTGAATATGGCAGTTTTGTCTGCACAATAATTCTCACCCAT
GTTCTTGATTGCACTGGATTTTCTGCTTTCTTAGCTTAAATGAAACCTTG
TCTCATGTGCTTTTACATATTCCATTTTCATAACCATAAGTGCAATCTAT
AATTTCAAATTATAGGTGCAAATATAATTTAGAGTAGCTCCCGGTGCTAA
CATGGGCATATTTGCAACATTCTGTTGATCTTATGG----AAT----ATG
AATAGCTTGAATTGAATATTGTGTTCTGTTCTCAGTATAGTGCAACCAGT
GTCCCTGTCAGTGAAGACAACAATGTTGTCCATAAGGCTGAGGATGTTGT
CAGCACCATGCTTGCTAAGGGGTTCACCCTGGGGAAAGATGCCGTTGGCA
AGGCAAAAGCTTTTGATGAGAAGC
View all "STS096" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS016 GAGCGGAGTTACCATCAATGGGAAGCGAGCGGTCGTGGTTGGCCGCAGCA
ACATTGTCGGGCTACCTGTATCCCTGCTTCTTCTGAAGGCGGATGCGACC
GTATCCATTGTTCACTCCCGGACCCCAAACCCTGAAAGTATTGTCCGTGA
AGCAGACATTGTCATTGCAGCGGCTGGCCAGGCTATGATGGTACATTGTT
CTACCACCAAATTATGACATGGTTCATCACAAT--------CCA----CT
GCCCAGTTCTAACTGCAGATTTCTTGGTTGCCAGATCAAAGGAGACTGGA
TCAAACCAGGCGCTGCTGTCATCGACGTTGGGACGAACTCCATCAGTGAC
CCAACCAGGAAATCGGGGTACAGACTCGTCGGCGATGTGGATTTCGCAGA
GGTGAGCAAGGTTGCTGGTCACCTGACTCCAGTCCCAGGTGGCGTTGGCC
CCATGACGGTGGCGATGTTGCTGAAGAACACGG
View all "STS016" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS082 GCCGGATGTTCATCATCAACGCCGGTCAAGGATTCAGGCTTCTCTGGAAC
ACCGTCAAGTCCTTCCTCGATCCCAAGACCACAGCCAAGATCCATGTAAT
CCAATCCATCCACAATCTTTTCGATGTCAATGTCACATCGATCATT-CGT
AATTAAGCTACATTTGATCAATTTGCAACTAAACATTACATAATGTTTGC
ATTTATGTGCCCTGTTTTAACCAGGTCCTAGGCAACAAGTACCAGAGCAA
GCTGCTGGAAGTGATTGATCCCAGGTCTGAGCATGAACCTTCTAGAGTTG
TTCGTTCCTGCTTCTATGCAAATGCAAATGGAATCACCTTGAATATTTAT
ATTAAATCTGCTA--ATATCATTATTAAAAAGAACAAGATTGAGCAGCGT
GTTGAGCTCACTCCCTGTTATTTCGAGACAGC
View all "STS082" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS080 CCTTTCTTATGCTTTCTCGGCACTTTTTAGGAAATTGAGTACATTTTATT
CTCTGTAAAACTAGGATAGCAGACAGCTTTTTCGATTCATTTTGTTGTCA
ATTTTCTGAAGGATGTTTCCTTTTCAGGCATTGACACCCCACATGCAAAC
ACTGGTGAAAGATATATCAAGTCCAAAGGCTGGGAGTTTGTTGGGACCTG
CTTTGGGTGATCAGCAACAAGGGAACTTCTCCATTCATCTTTGGAAAACT
GCTTTCCAAGATGCCTTCAGCAGAATATGTCCTCTTCGTGCTGGTGGACA
TGAGTGTGGATGCTTACCAGTGTTGGCAAAACTGGTATGTTTAATCATTG
ATATTTAATTTGAGAAGAATAATCATTTTTGTGAAGTTTATGCATGAGTT
GTTTTATTATTGTCAGGTGATGGAGCACTGTGTAGCTCGTTTAGACGTT
View all "STS080" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS113 CCCCGCCGAGGCCGGCGCCGGCCGCGAGGGCTCCGGTTGTAGCGGAGGCG
GCGGGTTCCGGGAACGGAGCGGCGGCGCATGCGGCGGCTGGCCTCTCGCG
TTGCTCCAGCACGGCGTCGTCCGTGGACGCGGCGGCTCAGGACAGGAGCC
TCGCGTGCCGCTCCGACGTCGCGGAGGTGAGGGAATCGAAACCCTAGAAT
TCGAATTCGAAAAATGATCCCAGATCTCTAATCACCGGTTGCTGAAGCGT
GCGTGCTTTTTGGTGATGTTCTACAGGCAGGCAGCGAGCATGTCCCGGAG
GGCTCCGCGAGCGACTCGGCGAGCGGCCGTGACCGCGAGAGGTGGGAGAA
TTCTCCCTCATTTCCGGCAAATTCTTCTGAATTATGCGTTCTGACATGCC
CCTGACGCCGAATCACCCTCGATTTTTCAAAATTTTCAAATTCCAGGAGA
GAAACAACTCCATCAAGCTTTCTCCCCGGAGAGGTGAGCGATCTGGAGTC
GGATCTGGCTGGAGGACAGAAGCGCAGCCGT
View all "STS113" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS043 AGATTATGGAGAGTGTGAAGATATGCATGGCGAAGGCACTTGACAAAGCT
GCAGCTGATGGTCATAATATGGATGTTGGACTGAAGGCCATTGGTATTAC
AAATCAGAGGGAAACCACTGTTATGTGGAGCAAATCCACAGGCCTTCCTC
TATACAATGCCATTGTATGGATGGATGCTCGCACAAGCCCCATTTGCAGG
TCTTCCCTTTGTCCATCATGTTT-GACATATCAGTGTTATATAGTGCAGT
TTTCTCATAATGTTTGACCTTTCAGGAGATTGGAAAGTGATCTTTCTGGT
GGTAGAACCCACTTTGTCGAGACATGTGGATTGCCAATCAGTACCTATTT
CAGTGCTTTGAAGGTGTTATGGTTGATCGAAAATGTGGATGCCGTCAAGA
ATGCAGTCCGAGCTGGTGATGCCTTATTTGGCACAATTGACACCTGGTTA
ATCTGGAACCTCACAGGAGGCATTGGCGGGACAGATCGTGATGGAAATAA
AGTATTTGGGCAC
View all "STS043" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS007 AAAGATTTTCTGTCAGTTCCTGTGGCAGAAATGACTCATCTTTGGCCTTA
CAAAAATCAGGTGACAACCATGTTGCCTGCCAATCAGGACAACCACCTCT
GGCTGTGCATACTGAGCTCCAACATGACACTTCTATTGTAATATCCAGTG
GTGAAGAGAAGGTCCTTTTTGACCTTAATGTGCCAGCTGAAAGCATTGAC
ATGGAATCAACAATAACCAGTAATAGTTTTAGAGATAAGCTAGTGAAAAA
TGATGGAAGTGAAGAAACAGTAACCGATCATTCTTTCTCCAAGAGAAACG
GTGTGCATGCTGAAACTTCTATAGAAGAACGAACTGTTGGAGAACATCAT
ATATCAGTCAGCAAGGATGGAAACACCACATTTTTCCAAGAATCAATAAA
TAATGAAATTGATAAGGCGCAGTCTTCAGACCTTATAAGTGTTAGCAGCA
AACATTTGATTGCAGAAACTCCTCATGTTGACAATATTGTGTGTCCAGAA
CTGCGAGCATCTCCTGATGGA
View all "STS007" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS085 CCATTATGGTGTTGGAATTAAAGGGAAGGAACCCTCAGATTGTGGTGGGT
AAGAGATGGTGGTAGTGGAATCATATCAAAGTGTGGTGCTATTGACTAGA
GAAAAGTTGATGCAGGAAGGAAAAAA--CTGGAGATTGTGGCGGAGGGTT
GGGTTTGGTTTGGCTTTGGCCGGGGATAATAAATGATGGAGCTGTAGCCT
GTAGAATTAGGCCTTGTTTAGTTCCCAAAACAAAAACTTTTCACCCATCA
CATCAAATATTTGGACACATGCGTGGAGTATTAATTATGGACAAAAAGAA
AAACCAATTACACAGTTTACGTGTAAATTGTGAGATGAATCTTTTAAGCC
TAATTGCGCCATGATTTGACAATGTGGTGCTACAGTAAACATTTGCTAAT
GACAGATTAATTAGGCTTAATAAATTTGTCTCGCAGTTTCCTAGCGGAAT
CTGTAATTTGTTTTGTTATTAGATTACGTTTAATACTTCAAATGTATATC
CGTATATCCGATGTGACAACCAAACCCGAAAATATTC
View all "STS085" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS055 CGACATGGCACTGCATTTCTGTGAGCGTTACAAGTCAGTTCTTTGCATCT
TATGTGAATGGGCTTGATATGTTATATAATTCTCTCTTCTTCTTTTTT--
GCAACTTCTTATTTACATCTCAAAACTGAAAATATTATAAATACTCTACT
CAACTGAAATCCTCAGATGGAAGTTCTAATGTTGATGTTGAAAGGTGTCT
CAAAGTTGGGTCACTGTAATGATTATGATTAGGTTCTGTTTTACAGTAGT
ACTTACCATTCTATTTATTTGCAGGCTAATGGTTCTTAGAATCAGTTCAA
AATTTGAACTGAGAAGATTTTGCCGTACTACAGGGTCCATTGCACTTGTA
AGTTCTGATCTCAAGCTTTTGTTCAATTGCACAGTAGTATGTATATGCTG
ATGCATGTGCTCTTTCAAAAACAGTTGAAACTCAGCCGACCAAATGCGGA
TGAATTAGGA
View all "STS055" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS121 GACTTCCGAAAAGGCCGGCGCCTCCGAGATTTGGCCGGAAATTGACGGAA
TCACAAAAGGTAAGCTCAAGATAGTTCTGTCTGCTTCTCAGAGCTTATGC
TGCCTGCAATCGTCTGCTCTTTCCAACTTTTAAGCCTCAACCTGCAAAGT
TGTGAATTGTCACAGGCTAGAGCAACACACATTTGCCTTGATTGTGGATA
CATATACTTCCTTCCCAAGCCTTTCGAAGAACAGGTAAGATTCACTTCAA
TTCTTTCACAGAGAATCAGTCTTTTGGCACTCACAGCCCGCAAAATCAGG
TGTATCCAACAATTCAACTAGTGCTTTTTATCCATTTCAGCCTGATGAAT
ATGGCTGCCCACAATGCAACGCACCAAAGAAGCGGTTCGCGAAATATGAT
GCAGAAACCGGGAGGGCGATTGGTGGTGCGCTACCACCTATTACAGTGAT
CGTCAGTTTGATAATCGGCAT
View all "STS121" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS011 GACTTCAGTTTATCACCTTTGCTAGCAGCACAATCAATGACAAAATATAA
CTCAGCTGCACCAACTACTACTGGACCAGCAATCTCCATGCAAGAGGTAA
TTTAACTACGCTGGTTCACTTTCTCATGGTGTTTTCTCTGGATTCATATT
TCATAGAAGTATAACTTTAGGAAGAAAAAGGCTCCACATCCTTTCTTTAT
TTGAAAGATGAATTTACAAGGGTGTGATGGTGTTGGAATTTTTTATTTTG
TGTGCATATACAGTTAATCATTCAGCAACAAGTAATCTCTAGTTCTCTAA
TTTTCTTCACACACATGTACATATTTGTTTCAGACTCTGAAGCCAGGAGT
TTTCTCCAACGCTCAATCTACCCAAAATCTTCCAAGTACTAGTATAGCAA
CGGGGCCTCCTCTCCCTCAGCAATTAGTCCACCCTTACTCTCAGCCTACT
GTACCACTGGCGCCTTTTGCGAATATGATTGGTTATCCGTATTTGGCACA
GAACTACCCTGCTGCTTACCTACCATCAG
View all "STS011" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS073 AGTTATTGTGGATTCCTCTGATCCAATAGGTGATTTGTTAATCATGTG--
AGTTTTTGTGTTTGTCATTGATCTATATCATCAAAATAATCCTGCCTAAC
CACTTATCCAGGACCGGCTCAAGAGCTTTTCGAGAAGCCTTTCTTCCAGT
CAGTTGCCAGAGCTTTGCGTCCTGGTGGTGTTGTATGTACCCAGGCAGAG
AGCATATGGTTGCATATGCATATTATTGAAGATATTGTAGCTAATTGTCG
CCAAGTTTTTAAAGGCTCAGTGAATTATGCTTGGACAACAGTACCAACAT
ACCCTAGGTATGCTAACTGATTATTTACATGTGGCTGAATTGATATTTCC
TTAGTTCCTAAGCTAACCATGCTTCCAATGCAGTGGTGTTATT
View all "STS073" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS077 CTGGTGAAGCAACAGAACAGATTATTAGGCAAGTAGAGAAGATGACTAGA
AATATTGAGCGCGCTTCTCGTGCTAGCAAGGTAATGCCTGTACTGCTGTA
TGCATATATATTGCAGCATTAATAAATTTGGTATTTGCTTTTTTAGTTTT
CCTTGGTTGTGCACGTTCCTTTGAGGAATGTTAAAGTGTTCTTTTATTTA
TAGGATGAACCTTCAACGTTGGATATGCCTTACGGAGATGTTAGTCGGAA
ATATCCTGCTGCCAGATCAAGTGATGCTTTTGCTACAGCTGATGGCGTAG
CTAAAAGAGCAAGATTTGATACCTCTGCTGCTTTAAACCCACCATTTCAG
GGAGCATCTGATTATTCTAATATGCAGGTTGACAATGAAGCGAATGTGGA
TCATTCCTCTGATCCAGCTCTCTTGAATTGTGATATGTCTCCTGTTGAGA
AGATGATTGAAATGA
View all "STS077" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS014 CCGGAGGAGGACGAGAAGCTGTTCAACCACATCAGCCGCTATGGCGTCGG
CTGCTGGAGCTCCGTCCCAAAGCTCGCCGGTACGCCCATCGATCAGTGTA
TGCATTAGTAACCAAAAT----GGCAAACTGACAAGCTAAGCTAAACTTG
GGTTAATTA--ATCACTTCTTTTCTCCTGAATAATAATGCTAATTGCTTA
CATCAATGTGTTTATAGTATTTCAGTTTATTATTTCATCAATTTCTGTCC
TGCTGCATAATGCTCACT------ATAGAAATGTGTTTATATC-------
----------------------------------------GTAATTTAGT
TGCTATACCTCTCTCTTTGTATCTC------ACTCTCTGACAGTGTGTGA
ATAATATAATGTGTGTTGCTGAGTTGCTGTGTACAGGATTGGAGAGGTGT
GGCAAGAGTTGCAGGCTGAGATGGATCAACTACCTGAGGCCTGATCTCAA
GAGAGGCAGCTTCTCCCAGCAGGAGGAGGAGCTCATCATCAG
View all "STS014" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS110 TGATGAGAAGAAAGGTACATGCA--ACAAATTAACAATATGATCGATCGA
CGATAACGAACTGAATGGGAAGATTATTTCCTTAGTTATATATACCCACA
CAAATAATTCAATATGTATTGATCGGTCAATCGATCTGTAATTAATTAAT
TTGATCTGTTTTTGTTGAGTATAGTTCGGCTGATGAGGAACCGCTCGCTG
ACCAGGGAGGAGGTGGACGCGTTCTGGAGGCGCCAGCAACGGAAGCAGCC
ACCGTCGTCGTCGACGTCGTCGGAGCCCAACGCCACCACCTCGCCGCTCG
CCTCTCCCCGCGCCGCCGCCAACGTCGTCTCGCCGCTCGCATCACCCCGC
GCCGCCGGCGACATCTCGCCGCTCGCCGCCTCTCCCGGCCGCGCGGTATG
TAATTAAACTAATTAAACATGCATCGATATAT--------TCTTGGACTG
AATTAATCAATTAATATAATTAATTCTCTCATGCAGCAGCAGGAGATGAG
TAGTAGTCGTTGCACGTTGG
View all "STS110" genotypes
Mansaku IRGC8191 Japonica   RA5016 STS111 CCAACCAGCTCGACCAAACCTCCAGGGTACGTACGTGCGTAATCAATCTC
GAGATTAATTAATTGATGGACTCCA-----TCGGTCGAACACCTAACGTG
CAATGTTTCTTCTGCAGCGTTTCCGGCTAGCCGGCGGGCAGGCGAGGAGC
GAGGGGAGGCAGAGGTACGGTGAGGGCGAGTCGTCGGAGTCGGAGACGGA
ACGCGGCGGCGAGGAGTCGTACAACATCCTGAGCGGCTTCGACACCGAGC
TGCTCGCCGAGTCGATGCGCGTCAGCCCGGACATCGCGCGCAAGCTGCAG
GGCCGCAGCGACAAGCGCGGCAACATCGTGCGCGTCCGCCGCGGCGGCCT
CCGCATGCTCCGCCCGGCGACGGAGCGGGTGACCGACGAGGAGATGATGA
GGGGCGCCAACGCCGCCGCCGCCGCC------GGGAACGGGATCGACGAG
GCCGTCTGCTTGATGAAGCTCCGCGAGAACGTCGCCGACC
View all "STS111" genotypes
[ Download ]