grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "IRGC24225" from the experiment "Genome-wide patterns of nucleotide polymorphism in domesticated rice".

E.g., Germplasm "IRGC9542", RA4969, Basmati 1, Marker/locus RM22.

Items 26 to 50 of 101.       Previous | of 5 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
Khao Hawm IRGC24225 japonica   RA5030 STS031 ATTGCCCAGCCAAAGGTTAGAACTTGTTTATCAGTTTGCATTTTGTTTGG
TATCAACTGTCATTATTAGTGGAAAATATTCACCTTTGATTTTTGCAGGG
TGTCCTTCTTTACGGGCCTCCGGGTACAGGAAAAACGCTACTAGCTCGGG
CAGTTGCTCATCACACCGACTGTACCTTTATTAGGGTGTCAGGTTCCGAG
TTGGTTCAGAAGTATATTGGAGAGGGTTCCAGAATGGTTCGTGAACTATT
TGTGATGGCCAGGTAAACATTTTCTGTTGATGATACATTGAAATTTACCA
TATATTCAATGGGATCTGAAAATCCTTCATTGGGAAGGATGCTTGCATTG
CTTTACACTATTCAGTAGGCTGACGTCTTTGGTTTGAATTTTGACAGAGA
GCATGCACCATCCATAATCTTTATGGATGAAATAGACTCCATTGGATCTG
CTAGAATGCAGTCAGGATCTGGGGGT
View all "STS031" genotypes
Khao Hawm IRGC24225 japonica   RA5030 STS033 TATCTGAGAGGTTGGATGTGTGTGATTTTTGCTTTGTTTTCTGTTACATT
GTTCATGAATTAGGTCTAACTAGCTTTCATGTGGTATTTGGAATGTCAGG
TTTATGGGGATCAGAGCTGCCATGGTCACCAATTGCCCCCTTGTTAGTTC
TTTTGCAGCAAATCTTGGTTTTCATGTATCCGGGACTGAAGATTTAGTTG
CACAATCTGGATCTTCCGCTGCTTCTAAGGAGGCTGGAATTATTTCCCAG
GCGTTAAGTCTGCTTGGATTTTCAGAGGGGAATGTTCAGGAGACATCTGA
ATTTGATCTGGTGTTTCTGCATGTTGCCATGGAGAATACAAACAGCAAGT
TGGGAAAATTGGGAATGAAGACTGATCTAAATCGGCTTGATAAATTAGTT
GGTGCAATCATGGAAGCGGCGCCCATAAGTTCAGCTATCGCCTCCCGTAT
TCTTGTATCTGTGATGTTGA
View all "STS033" genotypes
Khao Hawm IRGC24225 japonica   RA5030 STS034 ATGAGTACCACAGGTACAGACACGAACGCATTAAGCCCATTCATCTCATG
GCAATCCTCTGTAATGATCTGCTTAACATCTTCTGTTCATTTCTGACAGT
TTTGTCCATGGAAGACTGCCCTACGAGAACATCAAGCCGGACCCTGTCCT
GAAGCACATTCTCAAGAACCTGCGCATCCGCAAACTCGTGAGTTCCTCCA
GACCAGAATCGAAA-CC-AATCTCACATGTCTCATGTAATCGTGTTTTGG
TTCTGAACTGGCACGCGTCGTTGCAGATATTCACCAACGGCGACAAGGAC
CACGCCGTGAGAGCCCTCAAGAGGCTGGGGCTGGAGGACTGCTTCGAGGG
GATCATCTGCTTCGAGACCCTCAACCCGCCGTGCCCGTCGCCGCCGTGCG
ACGGGGAGGCCAGCATCTTCGACATCGCCGGACACTTCTCCATGCCCGGC
GCCGCCGCCGACGAGCTTCCCAGGACACCCGTCCTCTGCAAGCCCAACGT
CGACGCCATGGAGGAGGCCCTCAGGATCG
View all "STS034" genotypes
Khao Hawm IRGC24225 japonica   RA5030 STS035 AGAAGACCAAGGATGGCAAGCTCTTCGTCGATGTCCTCAAGGAGGGTGGT
GTCCTCCCGGGCATCAAGGTGGACAAGGGCACCATCGAGGTTGCCGGCAC
CGAGAAGGAGACCACCACCCAGGGCCATGATGACCTTGGCAAGAGATGCG
CCAAGTACTACGAGGCTGGTGCCCGCTTCGCCAAGTGGCGTGCCGTCCTC
AAGATCGGCCCCAACGAGCCGTCGCAGCTCGCCATTGATCTGAATGCGCA
GGGCCTCGCTCGCTACGCCATCATCTGCCAGGAGAACGGGCTGGTGCCGA
TCGTCGAGCCCGAGATCCTTGTTGATGGCCCTCACGACATCGACCGCTGC
GCCTACGTCTCGGAGGTGGTCCTCGCTGCGTGCTACAAGGCCCTCAACGA
GCACCATGTCCTCCTCGAGGGTACCCTCCTCAAGCCCAACATGGTCACCC
CAGGCTCTGACGCCAAGAAGGTGTCTCCCGA
View all "STS035" genotypes
Khao Hawm IRGC24225 japonica   RA5030 STS036 GGCCCCCACCGACAACCTCACCGTCCTCCGCCAAAAGTTCGCCGCCCTCA
ACCTCAACGACGTCGACCTCGTCGCCCTCTCAGGTACTCGTATCACTTCT
CCGGCGAACTCAATTTCG-----GTTCTGCCGTCATGCCCGCCGGAGCTG
ACGACGACGACAATAATGCGAAATGCAGGTGGGCACACGTTCGGGAGGGT
GCAGTGCCAGTTCGTGACGGACAGGCTGTACAACTTCAGCAACACGGGGA
GGCCGGACCCCACCATGGACGCCGCCTACCGGAGCTTCCTGTCGCAGCGG
TGCCCGCCCAACGGGCCGCCGGCGGCGCTCAACGACCTGGACCCGACGAC
GCCGGACACCTTCGACAACCACTACTACACCAACATCGAGGTCAACCGCG
GCTTCCTCCAGTCGGACCAGGAGCTCAAGTCGGCGCCGGAGGCGACCGGG
ACGACGGCGCCCATCGTCGACCGCTTCGCCACCAGCCAGGCCGCCTTCTT
CCGCAGCTTCGCGCAGTCCATGATCAACATGGGCAACCTCTC
View all "STS036" genotypes
Khao Hawm IRGC24225 japonica   RA5030 STS037 CCCACGAATTCATGAAAAATTCCCAGGTTCAGAATCTATACTTTCATTAT
CTAAATTTAGAAACCAACTGCTGTATAAGACTATAAGATTCAACATAAAT
TGCATAATCTTTCTTGAAGGTTGTAAGGAATCATCCTGGTGACCAAAGTT
ACTGGCATCGCCATAGATCAAAGGGTTCTTGGACTCTTTCCTCTGCAGAC
AATGGGTGGGCTGTGTCTGACACTACAGCAGAAGCACTGAAGGTCATTAT
GTTCTTTGTTCTTTTCCTGGTTACTAATGTAGGCAAATGAGGTATAAAAC
TAGTGTCATATTAATCCAGTCCTAATCGGTGACAGCACATCGAAGAAGCT
CATGCATATAAAAAATATTGGCCTTGATATATTCCCAATTCTGCATAATT
TCTATTATGTCTACCCTAGAAATCTTACATAATTTCATTTCCAGGCTGTA
TTGTTGCTGACAAAGATATCTAGTAGCATGGTTGGGGATCCCATTGAAAG
AGAAAG
View all "STS037" genotypes
Khao Hawm IRGC24225 japonica   RA5030 STS038 TCCAGCGCCTTTCAAGCCCCCATCCGGGGGTAGCACTAGTGATATCGTCG
AAGCTTCTGGCACAGCAAAACCTGGGGAAGTTGTTTCTGCCGCAGAGAGC
AATGTTGCTTCCAATGTGAACAGCACCATCTCTAGGCCTGTGCCCCCACG
GCCTTGGCAGCAGCAAGGATACGGAAATTCTTATGGAGGTAATCATTAAT
TCTGTAATCGCATAATCAGATACACTTAGTGGCTCAGAATCTTAACCTCT
CGATCAAAATGCAGGTTATGGCTCCAGTATGTATAGTTCGCTTGGTGGGT
TTGGTGGACCTTATAGTAGCGGCGGACTTTACGGAAATAACATGTATTCA
AGTTATGGAGGAGGTTATGGGGGTATGTATGGAAGTTCTGGAATGTACGG
TGGGTCCATGTATAATAGCGGGATGGGAGGTCCCTATGGTGGCTATGGTA
TGGGCATGGGTGCTTACAACCAAGGTCCAAATTCATTTGGGCCACCAGCA
CCANNNN
View all "STS038" genotypes
Khao Hawm IRGC24225 japonica   RA5030 STS040 AAGAACTAATGGAGAAGGTGTGCCCTTGATTCAACCTTTATATTAGACTA
GTTCTATGATATGCTTGCTTTATTGTCTATTTATGGATGATGAGTGTACT
TTAGCCGGCATTAGTTAATGGATATCTTGTGATAACAGGAAATCTTGTTA
TGACAATCAACTGCTGATGGTGATATTGGTATCCTGTGGTATACATCTTT
AGATTGCTAGCCACATTGTGATTATGATCTAAATTAGAAAATTTGCTGCA
CAAAGTAGAATGATGATTTTGGACATAGTAATTTGTTAATTCTTTGCACC
AATACATCCATTGTTGATATGATGATATCTACTTCTGTTTCAGGAATGAT
TTGATGCCTTTGTATTTAGTGGCAAAGCTACCAACCACATGATTTAACTG
TTGTTTTTGGCATGTATTCAGACAGGATTTGACATGGATGATGTAGTAAG
GAAGTACATTCGATACACACTGAATGAAAAA
View all "STS040" genotypes
Khao Hawm IRGC24225 japonica   RA5030 STS042 AGGTGGATTCCAATGGTGAAATGGTGAGGACTTGTTGTGCAAACTGAGCC
TAGATTACTGCCATATACGTGTTCCTAAAACTTATGCATTGTGCTCTTAT
AATCACTGTGCTGATATGGTAGTATGTGTTGGTGTATAATT--CAATAAA
TGCTGTATAGCAACTAGCAATAGTCTTTTGATTATAATTTATCCCTATTG
GTTGGGTATAGCTGTGCATCTTTAACTATTAGAATTGTGAATTCGCAAAC
AACTTGTTAATACAGCTAATTGGTAGAATATATCTTGGAATTAGTTATAT
GTTGAGAAATCGAAAAGGAATATGAATATTTCCTGCTCAAAGTACAAACT
ACATACTTCAAAACTTTTAAGAAGTGGTCTTTCAGTTATGCCCAATTAAC
TAGGTGTCTCAACTGTTATTATGTGAAGGGGCAACAGGTTGATAAGTCAA
GAAGCGAAAGGTTAATCCAATTGCCTATTGTTCAGTCCATTTATGGTGCA
ATGAGTAATCAGGAATTGCTGGAAGCTCAAGAGCAAGAATCACAACTTGC
TTATCA
View all "STS042" genotypes
Khao Hawm IRGC24225 japonica   RA5030 STS043 AGATTATGGAGAGTGTGAAGATATGCATGGCGAAGGCACTTGACAAAGCT
GCAGCTGATGGTCATAATATGGATGTTGGACTGAAGGCCATTGGTATTAC
AAATCAGAGGGAAACCACTGTTATGTGGAGCAAATCCACAGGCCTTCCTC
TATACAATGCCATTGTATGGATGGATGCTCGCACAAGCCCCATTTGCAGG
TCTTCCCTTTGTCCATCATGTTT-GACATATCAGTGTTATATAGTGCAGT
TTTCTCATAATGTTTGACCTTTCAGGAGATTGGAAAGTGATCTTTCTGGT
GGTAGAACCCACTTTGTCGAGACATGTGGATTGCCAATCAGTACCTATTT
CAGTGCTTTGAAGGTGTTATGGTTGATCGAAAATGTGGATGCCGTCAAGA
ATGCAGTCCGAGCTGGTGATGCCTTATTTGGCACAATTGACACCTGGTTA
ATCTGGAACCTCACAGGAGGCATTGGCGGGACAGATCGTGATGGAAATAA
AGTATTTGGGCAC
View all "STS043" genotypes
Khao Hawm IRGC24225 japonica   RA5030 STS044 AGTCGCTGGGAAACCCGGCGACGCTGTCGACGTGGTCCCTGGCGTCGGCG
GACTGCTGCGAGTGGGACCACGTCCGGTGCGACGAGGCCGGGCGCGTGAA
CAACGTCTTCATCGACGGCGCCAACGACGTCCGCGGCCAGATCCCGTCCG
CCGTGGCGGGGCTGACGGCGCTCATGTCGCTGTCGCTGTTCCGCCTCCCG
GGCCTCTCCGGCCCCATCCCGGCGTGCCTCACCGCGCTCTCCAACCTCCA
GTTCCTCACCATCTCCCACACCAACGTCTCCGGCGTCATCCCGGACTCGC
TCGCGCGGATCCGCAGCCTCGACTCCGTCGACCTCTCCCACAACAGCCTG
ACCGGCCCCATCCCGAACTCCTTCTCCGACCTCCCGAACCTCCGGTCGCT
TGACCTCCGCAGCAACAAGCTGACGGGTTGCATCCCGGCGGGGCTCGTGC
AGGGGCAGTTCAG
View all "STS044" genotypes
Khao Hawm IRGC24225 japonica   RA5030 STS045 GCTTGTGGTCCTTACCTCTGTTAAGAGGCAGAACTCGGGTGGATGGGCCT
TTCTGCAGCCATTCACGATCAAGATGTGGACCGTCACTGGACTGTTCTTT
CTTATCATAGGGACAGTAGTTTGGATGCTTGAACATAGAATCAATGATGA
ATTCCGTGGCCCTCCTGCGAAACAGCTTATTACTGTGTTCTGGTAAGGCT
ATAATTTCGTCAGTTTGTATTTATCGC-GTGTACAATTCCTGCAAATATC
ATTCCATGTTTTCTGTCACCATTATCCAGATTCTTGGACGATGAACTGGT
TTTATTTGCCTGACACTTCATGTTCTACTTACTTTGCAGGTTCAGTTTCT
CAACTCTGTTTTTCGCACACAGTGAGTGAAACG-ACAGCTTGTCACATTC
TCGACATTTTCAATAACCATGATGGAATTTTCCAGCTCATAGGAGCTACT
CTTTCTTCTATGTTTATACAGGAGAGGACACCAGGAGCACTCTCGGCC
View all "STS045" genotypes
Khao Hawm IRGC24225 japonica   RA5030 STS046 TCGGAGCAAGGGGCGGCGAGGTTCGCGGCGATCCACAAGGTGTTCGGCGC
CAGCAACGCCTCCAAGCTCCTCTCCCACCTCCCCGTCGCCGACCGCTGCG
AGGCCGTCGTCACCATCACCTACGAGGCCCAGGCCAGGCTCCGCGACCCC
GTCTATGGCTGCGTCGCCCAAATCTTCGCCCTCCAGCAGCAGGTACTATT
TCATTTCATGGATGAGAATGAGATGATCTCGTCCCTGCTCGATCGATCGA
TCGATCG----CCTCTCGGATTTGTGACTGATTCGATCGATGCTACATAC
AGGTCGCGATCCTGCAAGCGCAGCTGATGCAGGCGAGGGCGCAGCTGGCG
TGCGGCATCCAGAGCAGCTCGCACTCTCCGGTGAGCTGGCCGGACAGCGG
CAGCATCAGCGCGCTACTCCGGCAGGACATGGCGAGAAGGCCGCCCGGCG
GCGCCCTCGACGACTGCTTCGGCGGCGGCGGCGCGCTGCTGCCGGAGCTC
ATGGCGGCCG
View all "STS046" genotypes
Khao Hawm IRGC24225 japonica   RA5030 STS047 GACGCCGGGCTGTACATGATCCTGCGCATTGGGCCGTTCGTCGCCGCAGA
ATGGACCTTCGGGTTTGCCTCTTCGTTATACTGATGCAGTGTCACGATTG
GTTGTAGTTGTGCAGAATTATGGTGATTCGATTTCTCTGGGTTGATGGGT
TTATCCGTTTATGTGTGCGTGGATGTACAGGGGCGTGCCGGTGTGGCTGC
ATTACGCGCCCGGGACGGTGTTCCGGACGAACAATGAGCCGTTCAAGGTG
TGGCGGGCTTGTGAATTTCGTGGCGTTTTATTTGGGGAGTTTGCAAGTTT
GGTGATGGTTATACTGACATTTACTTACGCAGTCTCACATGAAGAGATTC
ACGACGTACATTGTGGATATGATGAAGAAAGAACAATTCTTCGCTTCGCA
GGGTGGGCACATCATCCTAGCTCAGGTCTGGACATTGTCATACTAATCCT
AATTGGGGCGCTGAAACATCAATCTGTTTCTATCAACTTTGAGATAGGTG
TACTTCACAATTGACGGCAGAATTGGTGCACTGTAGGTTGAAAATGAATA
View all "STS047" genotypes
Khao Hawm IRGC24225 japonica   RA5030 STS048 AGTTGCTGTAAGCAAAAAAGCCATGATTTTAGCCTATTTTTGGCTATTCC
TGGGTAAGGATCCCTCTCTAGTATTTCCTTTTCACAGCATGCACCCACAA
CATAAGTCAACTATGTGCTATCAACCTGAACATTACCATCTGGGCTGGCC
TGTTGTGTATTTTAGCAAAACCAAGCATGA---ATGCATGAATCGTATGC
TGTACTGCTGTGTAGGTGCAAAACTGGAAAGCACACAACTGAGAAACCAA
TCACAAAAGCAGTTCCTACTAAACCATCAAAGGCAGTTCCAGTCCAGACT
TCGAAGCAGAGTGTGGGAGCTGACACTTGCTCAAGGTGCCGTCAAGGTTT
CTTTTGCTCTGACCATGGTGAGTTTCTGTCTATAAGCATAATGCTTGGAT
ACAACTGATTGATCCCCTATTTGGGTGTAAC-------------------
-AGCTGATTGTTTCGTTATTATTTTAACGACTGACATCCCTATGCATTTT
TATGTGTTGATAGAATAAATCGTAACTTTTAATTTAACAGATTATGCACT
GCTATTT
View all "STS048" genotypes
Khao Hawm IRGC24225 japonica   RA5030 STS049 AAAAATTCCCCCCAGCCCCTCTTTTAAAAGCCTACCTTGAAGATTCAAAG
AAGATACCCTCAAATTCAGATAACCTGAGTACTAGCACTGGCCAATCTGG
GGTAAGTGAAATGGTTCTATATAATTATTTGAAGTCAATGCTGACCTCCT
AATATGAAGTCTCTACTCTGTAAGTGGTATGTCCACAGGGCATTCTGAAA
TATGTTGATCAGTGCTTCTTGGTGGTATCATACTACTGTACCCCTGATTG
CATGCTAGCAATGCATTTGATCCTTTTAGTCTCCAGAGGCAATTTCTTTC
AAGTGGTGCACTTGTTTCTTATACCAAATTAGAGGGTCTAATATTACTTC
TGTTGCAGAGCAATGCCAATAAGAAGGAGCAGTCTGCACTGCGGGCTGTT
ATAAAGTGTGTTGAGGACCACAAACTCGAAGCTGAGTTTCCATTGGAGGA
TCTCCGTGAGCGGCTG
View all "STS049" genotypes
Khao Hawm IRGC24225 japonica   RA5030 STS050 TGGTAAGTTGAACATTATTCCATGACAACCTATATTTGTTTCGTTCCATA
GAGTTTGCTGATGAGAAAAGAGTCAATATTTGACCATCAATTTAAACTAG
ATAATGCTGGTAGATGGAAACATTCATGTTTGCAAGAACCACTGGGGAAT
GCACCAGAATGTTTTCTGTATTCTTAGTACTGTTGTCATTTCTTAGTACT
GTTGCATCCTTTGCCTTTTTAAATATTAT--GCAACTGATTGCCAATTAT
GTATCTTCTTTGTCCAATTCTCTGCCCTGTTATTTTGATAGATGAGTTTC
TTTTTTCTACTTTTTGGCTTCCTTTGTTTGTATGCCGCTTGGAATCTAAT
TATGTAAACTGCTGATGATATTTCACATTACAGCAAAGTGCGATGTTCCA
ACTCAGGATAATAAGTGGCATTTCTTCGCTGCTCGTGACAGAAAGTATCC
TAACGGTTCTCGGTCAAATAGGGCAAC
View all "STS050" genotypes
Khao Hawm IRGC24225 japonica   RA5030 STS051 CCTTTCTTGACAGATGCTTTGACAAAGTTTCAGGTAAAGCTTTCCATGAA
CAAAAATACAATCTGTTTATGGTTTCATTGATCAGAGGTAATGGAAATGT
TCTACAAATATTGTTACACACTATTGACCTGGGGTCAGGGGATATTTTAC
CATCTCCTTTATGGAGGACAACCGAACCTTACAATAAACAAAGAAAAGTG
TAACTGAAGAAGTTCATTTGTTTTACAATGTATTCTTCCATCATCTCAAT
TGAAATATGCTATGCTTGTTCTTGGATGAAAAGAGAAATGTCCATTAGCC
ATATGATAAGTTATTTGCTGCTTTTGGTTGGTGTCTGAACATATTATATG
CTTTCGACTTATTAAGACAACTGCTTTTGTTTGTGATTTTCTTCTTGTCC
TTGTTGGTCCAAACTGCCAGTACTTAAA-CACGCACTGCATCCTGCATGA
ATGTTTTCTTATGAGATAACTTGATTTCATTATTTTGTAGGACCCTGCAG
AGGCTGACAAGTTAATGAAAAT
View all "STS051" genotypes
Khao Hawm IRGC24225 japonica   RA5030 STS052 AGTACGACGCAACGGCCGCACCACACGGTGCAGACTACCACAAGTGCAGA
GAAGAAGTAGTGAAGTTACTGAAGGTGAATGCGCCCTGCGAAACCAAGAA
CTGCAGCTTCAATGGCGTCTGGAACGGTGGTGGCGGAGCAGGGCAGGATG
ACCTCTACGTTGCGTCCGCCTTCTACTACATAGCCTCCCATGTACGTCGT
GATTACTTAATTAATTAGCCAACTAAATTATTTAACTTCTCAGGCATGCT
TCAGACTGGCTACTAGCTAACTAGTTATGTAAATATATACCCCTAAATAT
GTGCATTTAATTGTTTGTGTAATTATGTTACATATACAAATTAATACTTT
TACCTGATAATTTTATCTCCAATGCATACATTTTGATCGGACCGGGATAA
AGGTTGGGTTCATCAACAGCGATGCACCCAGTGCGAAGTCAACCCCTGCA
ACGTTTAAGGCTGTTGCAGAAAAGGTTTGTAAACTGAGTGTCAAAGAAGC
AAAAGTAGAATACCCC
View all "STS052" genotypes
Khao Hawm IRGC24225 japonica   RA5030 STS053 CCGAGCGCATGAGGGATTGCTTAAGAAATCTTAAGCAGCAGAACAAGGTA
GCATGTAGTTTTAACTTGAAATCATCTTCAATGTTACTCATATTTGTCAG
GCAGATTGACACATATCCTTCATTGCAT----GTGAATACAGATGCAACT
GTAAAGACTTGAGAATTCTATTGTTTGTTGAAACTATACCAAAAATTGTG
TTCTCCCTGTAGTTTTAGAGTGGAATCATTCAATGCTGATATAATCATAT
TATATGTTTGGTATTCAATTTGACCCAATTATGGGCCGTTTTTGCAACAG
GATGACGATGCTAAAGTGAAGAGGGCTTTTCAAACACTCCTTACCTACAT
TGGCAATGTAGCTAAAAATCCTGACGAGGAGAAATTCAGGAAGATCAGAC
TGTCCAACGCTACATTTCAGGTGAAAATAATTACTGTACATATTGACCTG
GTAAAATGATCCGCTGTTATCCTTTCAAGAACAACACGCGACTGATAATC
TGTTTCGGTACAATGCAGGAGAGGGTTGG
View all "STS053" genotypes
Khao Hawm IRGC24225 japonica   RA5030 STS054 TTTTGTTACATTTTCGGATCCATCTGTTATTGACAAGGTTCTGCAAGATG
AACACACTATAGATGGAAGAACAGTAAGCCTTCTATGTATCACTTCACCA
AAGTATGCAAAGCTTGCTGTAGAGTCTGTTCTCATTTGTCTGTCATACAT
TTTGATCTATCAAGGTTGAAGTTAAAAGGACTGTCCCGAGGGAGGAAATG
TCGTCGAAAGATGGTCCTAAAACGAGAAAAATCTTTGTTGGTGGTATTCC
ACCATCTCTTACTGAAGGTAGCCAGCAGAACTAAGTTGTTTCCTTTTTAC
AAGCAAAAATATATTTGTATTCTAGAAAACAATGGCTTGAATACTCTAAA
TAATGTTATGTCTTGATAAATATGATTGTCATGAAACTTCCAGATAAATT
GAAGGAGCATTTCTCTTCATATGGGAAGGTAGTTGAGCATCAGATAATGC
TTGACCATGGCACTGGGCGGTCACGAGGCTTTGGCTTTGTCACATTTGAA
AATGAGGACGCT
View all "STS054" genotypes
Khao Hawm IRGC24225 japonica   RA5030 STS055 CGACATGGCACTGCATTTCTGTGAGCGTTACAAGTCAGTTCTTTGCATCT
TATGTGAATGGGCTTGATATGTTATATAATTCTCTCTTCTTCTTTTTT--
GCAACTTCTTATTTACATCTCAAAACTGAAAATATTATAAATACTCTACT
CAACTGAAATCCTCAGATGGAAGTTCTAATGTTGATGTTGAAAGGTGTCT
CAAAGTTGGGTCACTGTAATGATTATGATTAGGTTCTGTTTTACAGTAGT
ACTTACCATTCTATTTATTTGCAGGCTAATGGTTCTTAGAATCAGTTCAA
AATTTGAACTGAGAAGATTTTGCCGTACTACAGGGTCCATTGCACTTGTA
AGTTCTGATCTCAAGCTTTTGTTCAATTGCACAGTAGTATGTATATGCTG
ATGCATGTGCTCTTTCAAAAACAGTTGAAACTCAGCCGACCAAATGCGGA
TGAATTAGGA
View all "STS055" genotypes
Khao Hawm IRGC24225 japonica   RA5030 STS056 TCATTATTATTGCTTCGTTCGAACTTCCAGTGGAATGTGGCACAACCTTG
ATGATAACCAGGTCTAGCATGATATTTGCCATTACGTGAAGCTTTACTGT
TTCATTTTTAGTTGATAGTTGATAGTCATATCACAACCTTCCATTAGCTG
CTTAATTGGCTATTTTATTTTAATCTTGCGCTTGGCCATATGTATGTGAG
GGAGTACAGTGACTCTAGTGCATGGTGGATGCTACTTTATTCCTCTCGCT
AATTCAGCAGACTTTAGCTTCCCTTGTACTGATCCTTGTGGACAACTTCA
GGTACGCCAAGTCCGTGAGGCAGATGTATTGAGACAGAAAGCATATATGT
TATTTTATGTACGTGACAGAGTTGGGAATCCGACTCCACGCAAGGATAAT
ATCACTGCTAATATGCCAGCCAGGAGAACAATACCTGAAAAGATCTCAGG
TCTGAGTGATATGATCCAGAGCGGCGTAATTGAAGCAAAATTGAATGGTT
CCT
View all "STS056" genotypes
Khao Hawm IRGC24225 japonica   RA5030 STS057 CCACTGAGCTACAGGGGAGCGGATATATTTGTGCTGGCATTCTCACTGAT
CAGCAGAGCAAGCTATGAGAATGTTCTCAAGAAGGTAGGTACTATACTCC
ATTTAGTTCAGTTTGGACTCAAAATGTCTGAACATCTGACAACATGAGGA
TAGTGACCACAGATACTGTACCAAGAACTTTACCTTTCCTTCTGACAATG
ACATTTTTAGACCACCTTTGACCAATATTCTTCACATTTTTCTTCTTTAC
AGATATATACTATATGTGCATATGATTTTCACTGGAATATTCTGAGCTAA
TGTTATCTTTTTCTGTTTCTGATCATGCAGTGGATGCCGGAGCTTCGCCG
GTTCGCACCGAATGTTCCAATTGTTCTTGTTGGGACCAAGTTAGGTTTGT
ACCGGATGCAACATTAACTCAACAAAGCTCAGTGCCACTTCCTTTTGCAG
GCTTGTTTCAATGCTCTTAGGTTTTAACCGTGCTTGCTTCCAATTGTTCA
GATCT
View all "STS057" genotypes
Khao Hawm IRGC24225 japonica   RA5030 STS058 CTCACAGTATCTGACATAGCATCCCACATCCAGGTCCAGATTTCTATTTG
TAGACTAATCACACTCTTATTGTACTACATATAGTTCACTTTCACACCTA
TGATCTGTTCACTGAACCTCTCAGCTAGGCTGTAGTATTATGAACGATGA
TATTTCATCACATTTCATTAATAGCTCCTGTCCTTACTCCTTACCCATGT
AGCCATGTTTATGGGTTTTTCTTGAATGTAGCACGAGATTGAGTATGGAG
GTGACAATGCATTAACTTCACCGAGATCGCAACACGCATTCCAGAATCTC
CAAGCTCCAATGCACATCCCCAACACAAGCACGCAGCAGCCGCCATCTTG
TTCAATCACACCATCAAACCCTTCCAAGGACTCTATGATATTTTCGAAAG
CGCTATCCAGCCCTGTCCGGCAAAACCTGCAACTGTACCATGTACAGCAA
GGCGGTGACACAGGATGCTTTGCAGATGGCATTTTTTGCCCTGGAAACCG
TGACTCGGATCCTGCAGCATCAAATGATTCGTCGGT
View all "STS058" genotypes
[ Download ]