grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "CIor5309" from the experiment "Genome-wide patterns of nucleotide polymorphism in domesticated rice".

E.g., Germplasm "IRGC9542", RA4969, Basmati 1, Marker/locus RM22.

Items 1 to 25 of 101.       of 5 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
WC6 CIor5309 japonica   RA5288 STS070 AAAAACAGAAGTGTGGTTACATTTGGTGAGCTTAAGGGACTGAAAAGATA
CAGCTCAGTGTTCAAGGATACTGAAATTAACGACTTAATGGAAGCAGTAA
GTGGTCACTGTTATTGCAAAATACGATGCAAA-A-TGTACTGTAGCACAC
TTAAACCATATACATGGTATCTGTAGTATATAGACTGGATATTGTTTGTC
AACCTTTTGATCATGCTGCTTTTCAGAATTCTGTATTGTTTTGAATGTGT
GTGAAAAGTCGGGGCCAACACATTCATGTCAAAAGATTACTTAAACCATT
GGTTTAGTTGAAATGGAGTATGTCATGCATCTGTGATGAAATACTGTCTT
CATTGCAGAACTGTTTTATATATTTTAACCTTTTTGAGTACTACTTCAGG
CTGATGACACCACCTCCACCATCAACTGGGAAGAGTTTATTGCTGCAGCA
GTGTCTCTTAATAAAATAGAACGTGAGAAACACTTGATGGCAGCCTTTAC
ATAC
View all "STS070" genotypes
WC6 CIor5309 japonica   RA5288 STS049 AAAAATTCCCCCCAGCCCCTCTTTTAAAAGCCTACCTTGAAGATTCAAAG
AAGATACCCTCAAATTCAGATAACCTGAGTACTAGCACTGGCCAATCTGG
GGTAAGTGAAATGGTTCTATATAATTATTTGAAGTCAATGCTGACCTCCT
AATATGAAGTCTCTACTCTGTAAGTGGTATGTCCACAGGGCATTCTGAAA
TATGTTGATCAGTGCTTCTTGGTGGTATCATACTACTGTACCCCTGATTG
CATGCTAGCAATGCATTTGATCCTTTTAGTCTCCAGAGGCAATTTCTTTC
AAGTGGTGCACTTGTTTCTTATACCAAATTAGAGGGTCTAATATTACTTC
TGTTGCAGAGCAATGCCAATAAGAAGGAGCAGTCTGCACTGCGGGCTGTT
ATAAAGTGTGTTGAGGACCACAAACTCGAAGCTGAGTTTCCATTGGAGGA
TCTCCGTGAGCGGCTG
View all "STS049" genotypes
WC6 CIor5309 japonica   RA5288 STS099 AAAACTTTTACAGATCTCTTCGATTACTTCCCCTTGACAGCATTGGTGTG
TATTCAGCATTTTCATATGTATATGCCAACATCCTTCCCACATTATCTAG
TGAATCTGACAGAAGCTGTTCATTTGTTCTGTAGGTTGAGTCAGAAATAT
TTTGCCTGCATGGTGGATTATCGCCATCCATTGAGACACTTGATAACATA
CGTAACTTCGATCGTGTCCAAGAAGTTCCCCATGAAGGGCCCATGTGTGA
TCTTCTGTGGTCTGATCCAGACGATCGATGTGGTTGGGGTATTTCTCCTC
GAGGTGCTGGATACACCTTCGGGCAGGTAACATTTTATATAAGAAAAAGA
AT--CTCTATATTTAGCTGTGCACCTCATGTTCATCGACTTATCAATTCT
ATCATTTCAGGATATATCAGAGCAGTTCAACCATACCAATAATTTAAGAC
TTATTGCTAGAGCTCACCAGTT
View all "STS099" genotypes
WC6 CIor5309 japonica   RA5288 STS061 AAAAGTGTGATGGATTTCTTCTGCCTAATGCAGGTTGGTTAACATCACGA
AGGAAAAATACTAACTGAAGAGATGTAATAGATTGGATTATTCAAACATA
ATGTCAGCTGCAGCTTTAATACTGTTTCAGTTATCATTGATCTTACATTT
TTATCTGGATTTAACATCTGTAGGAAACAAAGGTTATACATGCCAGAAAT
GTAGCACTTCTAGAGATGGGGAAGAGTTACAAAAGATGGCTAGCGATGTA
CTACTATTATCTGACAAAGTCTCTTCCTTAGTTTCATCTGGAAGTATCCT
TTTTCACTATTACTAGATGCTATCTGAGGCAAATGTATATAATT-ATTGC
ATCATATTTTTTTGTGATTTT--GTAAAATGCTACCTTAACTTTGGGCAG
TAGATAACAGTGAGGTAGGTTCTATGTACAAGACCATTGAAGAGCTAGAG
CGGAAGCTTTACCATCCTTNGT
View all "STS061" genotypes
WC6 CIor5309 japonica   RA5288 STS120 AAACAAGTTGGTGTTTTGACAGGTCATTTAGATGGGATTACATTTATTGA
TAGCCGTGGAGATGGGCATTATTTTATTTCAAATTGCAAGGATCAAACTA
TTAAACTATGGGACATCAGGAAAATGTCGTCCACTGTGAAAGAGTAAATA
CAGCTCTTGCTTTTGCATGATTATTCCTCTAAACCAAACCACTTTTT--A
TGCTTGAATCTTAAACGCAACATATTGTAAGCAAGTAGGAAATGCTAAAA
TCAAAATCTGCCTTTGACTAGATCTGCTTGGCCTGATTTGTCCAAGATCT
TGTCTACATGCCTGACCCAAAGTCCAAAATATAAAATAGGCTAAAGTTAT
TCGACAGAAATACTATTTTTACTTGTAGTTTGTTTTTGCAGCTGCACACC
AAAAGCATATGAATGGGATTACAGATGGATGACATATCCCTCAGAAGCCC
GATATTTCAA
View all "STS120" genotypes
WC6 CIor5309 japonica   RA5288 STS030 AAACATAAGTCTTCAACCCTCAGGATTGTTGGATATGTTCTTCTAGCTAT
TGTCCTGTTTATAGTTACAGTGCTGCTGGTAATATTTTGCCTGTCCAAGT
ACCAAGAGAGACAGTCAAGACGTGATTATACAACAAGTCAGGTGGGGAGG
GTTCATCAGAGGGTTGAAGAGCCGAAAGTTAAGCAAGCTTCAGTGCAGTC
AAGGAATGATGCCAAAAAAGGTCAACAATTAATTTATATATTCTGTAATA
TATTTCTGATTATATTTTATTTGTTTTATATCACAGCATATTGATGTTCT
ATTAACAGGATCAACAGAGGTTCCTGAACGGAGGCAGGTTCGTGAAATAA
ATTTGGCGGTACCAGGTATAGATGCTTGTAAATCTGATCTATCAGGTCTT
TTAGTACTGTAATACTATTCACATTTTTAAGTTCAGATGTATAAAATAAC
TATTCAATTGCTGGCAGCTGCTCT
View all "STS030" genotypes
WC6 CIor5309 japonica   RA5288 STS007 AAAGATTTTCTGTCAGTTCCTGTGGCAGAAATGACTCATCTTTGGCCTTA
CAAAAATCAGGTGACAACCATGTTGCCTGCCAATCAGGACAACCACCTCT
GGCTGTGCATACTGAGCTCCAACATGACACTTCTATTGTAATATCCAGTG
GTGAAGAGAAGGTCCTTTTTGACCTTAATGTGCCAGCTGAAAGCATTGAC
ATGGAATCAACAATAACCAGTAATAGTTTTAGAGATAAGCTAGTGAAAAA
TGATGGAAGTGAAGAAACAGTAACCGATCATTCTTTCTCCAAGAGAAACG
GTGTGCATGCTGAAACTTCTATAGAAGAACGAACTGTTGGAGAACATCAT
ATATCAGTCAGCAAGGATGGAAACACCACATTTTTCCAAGAATCAATAAA
TAATGAAATTGATAAGGCGCAGTCTTCAGACCTTATAAGTGTTAGCAGCA
AACATTTGATTGCAGAAACTCCTCATGTTGACAATATTGTGTGTCCAGAA
CTGCGAGCATCTCCTGATGGA
View all "STS007" genotypes
WC6 CIor5309 japonica   RA5288 STS012 AAAGGTTTCAAGTACAAAAGTCGAAGAGCTCCAAGTAGATGTGGCGTCTA
TGGATGTTGAAATCTCTGCGTTAATGAAGCTATTTAGAAAAATAACAGAA
AACGACCGAGCCCCTTACTCGAGGGAGAGAGCCGATGATTCATCTTTGGA
ATGTGAACCGGTTCAACTTGACGTAAGCTCATTTTTTCCTTGTTATAGTT
TCCTTTCGCTCTTCAACCCAAAGTACGTCATGTAGTTTTACCACCTCTTT
GATGAGCGATTGTTTTT-CCTCAATACAATTGGCTAAACGTCCTACTTGA
TATGGGCAGGATATGGTTGGTGACATCGACATGGAGAAGATGGAGCAGGA
AATGTCTGCATACGCTACAGCTCTCGCTGCCGCGAAAGACAATCCTACTG
A
View all "STS012" genotypes
WC6 CIor5309 japonica   RA5288 STS040 AAGAACTAATGGAGAAGGTGTGCCCTTGATTCAACCTTTATATTAGACTA
GTTCTATGATATGCTTGCTTTATTGTCTATTTATGGATGATGAGTGTACT
TTAGCCGGCATTAGTTAATGGATATCTTGTGATAACAGGAAATCTTGTTA
TGACAATCAACTGCTGATGGTGATATTGGTATCCTGTGGTATACATCTTT
AGATTGCTAGCCACATTGTGATTATGATCTAAATTAGAAAATTTGCTGCA
CAAAGTAGAATGATGATTTTGGACATAGTAATTTGTTAATTCTTTGCACC
AATACATCCATTGTTGATATGATGATATCTACTTCTGTTTCAGGAATGAT
TTGATGCCTTTGTATTTAGTGGCAAAGCTACCAACCACATGATTTAACTG
TTGTTTTTGGCATGTATTCAGACAGGATTTGACATGGATGATGTAGTAAG
GAAGTACATTCGATACACACTGAATGAAAAA
View all "STS040" genotypes
WC6 CIor5309 japonica   RA5288 STS089 AAGCTGTGAAGGTGGTCGACATTGTGGACACCTTCCGTCTTCAGGTTGCT
CTCACTTCCATTACCTTGGCTCTTGTATATGATACTATCTGCACTTTATT
TTTGTGCTTAAATTCCATGTGTGTTTGGCAGGAGCAACCTCCTTTTGACA
AGAAGCAGTTTGTGACCTTCATGAAGCGCTACATCAAGAACCTCTCCGCC
AAGCTGGATGCGGAAAAGCAAGAGGAATTCAAGAAGAACATTGAGGGTGC
CACCAAGTACTTGCTTGGAAAGCTCAAGGACCTTCAGTTGTAAGTTCACT
A--ATTGCTTGCCACAGGTCCAGGAAATAGTAACATATGTGATGCCATGA
ACATGTCTCACCATTAGTGCCTACAAATTCCAGTTTAAATGATTTGCTAT
GTTCTATCACATTAAATTCTTGAAGCAAT---------------------
-------------------------AAGACTTGTATTCAAACCTGCTTCT
TATGCTGTCTCTTATGATCTGTTTCAGCTTTGT
View all "STS089" genotypes
WC6 CIor5309 japonica   RA5288 STS078 AAGGTCAGGCATCTCTTCGGCGTGTGCTTGTTGGTTACTCATTTCGTGAC
TCAGAAGTTGGATATTGCCAGGTAGGCATAAAGCAATGCTTTTCAAATGT
AACTGTTTTATAGAGAAGCTCCATTACTAACACCATGCAATGCAGGGTTT
AAATTATGTAGCTGCATTGTTGTTGCTTGTTATGAAGACAGAGGAAGATG
CATTCTGGATGCTTGCTGTACTACTGGAAAATGTACTTGTCAATGATTGC
TATACTGATAATCTTTCTGGATGCCATGTCGAGCAGAGAGTTTTCAAAGA
CCTCCTAGCTAAAAAGTGCCCCAGGTATTTCCCCCCTGTTATGTTTATGG
CTTTTATGCTATGATTTTTCATCAGTCGCTGGCAATAACAAGCATTACCA
TT-ATAAGATGATTGTGAATCATTGGATTACCCAAATGATGCAGGATTGC
TGCTCATCTTGAAGCAATGGGGTTTGATGTTTCTCTTGTTGCCACAGAAT
GGTTCTTGTG
View all "STS078" genotypes
WC6 CIor5309 japonica   RA5288 STS094 ACAAGTTGAGGGTGGAGATCGGGAATTTGCCCGAGGAGAAAATGGGGAAT
GTGCTACAGATTGTGCAGAAGAGGAATACCGATCCGGCGCTAATGGGAGA
GGTCGTTGAGCTTGATTTCGACGAAATGGATGTCGAGACGCTGTGGGAGC
TCGATCGATTTGTGGTCAATTGCAAGAAGGCGCTCAGCAAGAGCCGGAGG
ACTGTCGCGATGAACGGTGATGCTGTTGATGCGACTGCTATTGTTCCAAC
TGAGGACGATACCGTGCAGGTGAATGTGCATCATCAGCCTTCGGTGGTTG
AAATTGGGGACTCGGTATGGCAATGTTGCAATCCTTTGTTCTGTGTAATG
ACTAATGCTTGAATTGTGTTCTCATGTTTTGTTTATGTTGCACTTTTGCA
GGAGAATGACACGCCGGAGAAGAGGGTTTCAGAGGTTGATATGGTTGATG
AGTATGTTGATATTGGCGATGAGATGCC
View all "STS094" genotypes
WC6 CIor5309 japonica   RA5288 STS096 ACCCCCTACTTCATCTGCTCCTCCAATGGTACACAATTCCTCAGTTTTGA
TTTAATATGCTCATATTTTGATTTTTCAATATGTGACCCAAGTGAGATGT
TATCATCAACTGAATATGGCAGTTTTGTCTGCACAATAATTCTCACCCAT
GTTCTTGATTGCACTGGATTTTCTGCTTTCTTAGCTTAAATGAAACCTTG
TCTCATGTGCTTTTACATATTCCATTTTCATAACCATAAGTGCAATCTAT
AATTTCAAATTATAGGTGCAAATATAATTTAGAGTAGCTCCCGGTGCTAA
CATGGGCATATTTGCAACATTCTGTTGATCTTATGG----AAT----ATG
AATAGCTTGAATTGAATATTGTGTTCTGTTCTCAGTATAGTGCAACCAGT
GTCCCTGTCAGTGAAGACAACAATGTTGTCCATAAGGCTGAGGATGTTGT
CAGCACCATGCTTGCTAAGGGGTTCACCCTGGGGAAAGATGCCGTTGGCA
AGGCAAAAGCTTTTGATGAGAAGC
View all "STS096" genotypes
WC6 CIor5309 japonica   RA5288 STS122 ACGGCTTCATGAACTTCATGCACCGCGACGAGGAGGTCGACTACTTCCCA
TCCCGCTACGATCCTGCCAAGCACGCCCCCCGCTACCCCATCCCCTCCGC
CACCCTCACCGGCCGCCGCGAGAAGGTAATTCTGTTGATTGATTTGCGTT
TGGGTTTTACATTTCACTATATTTTCTTTCTTAATTACTACTTCCCCCGT
TTCAGATTATAAGATGTTTTAATTTTAGTCAATCTCAAACTATAAGTTTA
ACTAAGTTTATAGATAAATATAGTAATAATTACAACACCAAATTAGTTTC
ATTAAATCATTAAATCTATAGTTCAATATATTTATTATGAGTTAAAAATG
TTACTATTTTTTATATAAACTTAGTCAAATTTAAAACAGTTTAATTTTGA
CCAAAGTTAAAACGATTTATAATCTAAAACAGGAGAAGTAGTAATAGCTA
GTCAATTTATTAACTGGTTTTGATCGATCGGGTTGC-GAGTGCAGGTGGT
GAT
View all "STS122" genotypes
WC6 CIor5309 japonica   RA5288 STS125 ACGGTGGCGATATTTGGTCTAGGAGCTGTAGGCCTTGCTGTGAGTGTCTG
AACTCACCTTGAATGTTCTCAATTACAATGAGAGATCCATCTAATTACTC
TACATATTGTCTGATTAGGCCGCAGAAGGTGCAAGGATTGCAGGAGCGTC
AAGGATCATTGGCATTGACCTGAACGCCAACAGATTTGAAGAAGGTAAAA
TCCTCTTGATTTACCAGATCATCAGTTTGTTTGATGGTCTTTTAAAGTCA
TCTTATATATTTTGTATATCTTCAGCTAGGAAATTTGGTTGCACTGAATT
TGTGAACCCAAAGGACCATGACAAGCCAGTTCAGCAGGTATGTATGTTCC
CTTACATCAGGAAAAGGAAAATCTGTATCACTTGATTGTACTGATACAGT
GTGTTATGGTAATTTAGGTACTTGCTGAGATGACCAATGGCGGAGTTGAC
CGCAG
View all "STS125" genotypes
WC6 CIor5309 japonica   RA5288 STS075 ACTCACATCTACTCAAGGTAGAGTACTCAATTTCTCATTGCTTTCACAGT
GATTTCACTGCTACTAGTGCCATGATCAGGCATTGCAATTTGCAAACCAC
ATTGGAGCTCCTGTAGATTAAATCTACTACTGGTAGTAGCTCATTGCCAT
TTGGTATTTTGATCATGATCCACAGAGGAGGAAGTCTTCTTCTTTTTCTT
GCAAGCCAAGCTCAGCAGCAGCTGACAAGGGATCATATGAAGAGGACTCC
TACTTTGAAGCACCC---TCACACTGCATGGGCAGGCCGGCTCCTGATTC
CTCTCCTGACCCTCTTCTCTCCCAGTTCATCTGCTGCAGCCTCGCTCCTC
CGGTC---------------AGCGAAGCCGATGCCGAGGGCCATGGTTCA
TCTTCCTCAGATGATCAAAAAAGGTAAGAATTGTGCAGTTGGTGCTGTTG
GAGCAGCCTGAAATTTGGTAACAATTGTGCTGAATCTGAACAATGCTGAC
TGATCCAAATGCAATCTTTGATGCTTGCAGGAGAG
View all "STS075" genotypes
WC6 CIor5309 japonica   RA5288 STS043 AGATTATGGAGAGTGTGAAGATATGCATGGCGAAGGCACTTGACAAAGCT
GCAGCTGATGGTCATAATATGGATGTTGGACTGAAGGCCATTGGTATTAC
AAATCAGAGGGAAACCACTGTTATGTGGAGCAAATCCACAGGCCTTCCTC
TATACAATGCCATTGTATGGATGGATGCTCGCACAAGCCCCATTTGCAGG
TCTTCCCTTTGTCCATCATGTTT-GACATATCAGTGTTATATAGTGCAGT
TTTCTCATAATGTTTGACCTTTCAGGAGATTGGAAAGTGATCTTTCTGGT
GGTAGAACCCACTTTGTCGAGACATGTGGATTGCCAATCAGTACCTATTT
CAGTGCTTTGAAGGTGTTATGGTTGATCGAAAATGTGGATGCCGTCAAGA
ATGCAGTCCGAGCTGGTGATGCCTTATTTGGCACAATTGACACCTGGTTA
ATCTGGAACCTCACAGGAGGCATTGGCGGGACAGATCGTGATGGAAATAA
AGTATTTGGGCAC
View all "STS043" genotypes
WC6 CIor5309 japonica   RA5288 STS062 AGCTGTTTTGCCTTTTGAAAAACTACGAGTTCTTCTCTTAGGTATTTTTT
GTGATCTGGCTTCCCTTATCTATTCCATAACAAAATATCGAATCTAAGAT
ATTTTCTGTAATATCTGGCTTCCGTTATCTATTTGGGAAAATTGATCATG
CGCCATGAAATGTTTTCCATAATATTTTCTGTTTAAGAACTGCCTTTAAT
TCAAGTAAGTTCAAAATGACTTGCTAATGATCACTTTCAAATGCCTCAGG
ATCTAACCAGATAGATGAGGTCCTTTCTGTGGATTCACTTAACCTCTTTC
CGAGTTTAACAGTAAGCAAGTTTCTTTCTAATGGTTTGTGTTTATTATTC
TGAAATTTAGTATTGATGTTCAATTCCTTTTCTATGAGGTTTGAACAGTT
AGAACTGCAAGATTTTGATACACTGCGATTCTTAGATTTACAAGAATGTT
ATGATGTACACCACACTGTATTTTTATTAGTTATGGCTTAGCACGCCAAT
ACTAATATCTACTTTTCTAAAGGATGTCAGGCTTT
View all "STS062" genotypes
WC6 CIor5309 japonica   RA5288 STS117 AGGAAGAAGATCAGAGTCTTGGTACGTT---CATCAGAAGAATGCTATAG
AGAGAATGGAAGTGATTCAGCTTAGCTTACTGTTTTTGTGTTTGTTT-TG
TTCAGATGCTGACACTGTCAACGGAGAGGTTCATGAATATTCAGAGGGAG
GCCCCTGCGGAGTTCCAGCAGTATCTGGTCCAGGTCACCAAGTACCAGGC
TGCACAGAATTGCAAGGTAGTACGTACGTAAAATATAATTGAACTGGTCG
GTGTATGCAACTCAATCATGATGTCTT------------ACGACGGCGAT
GTCGGTCGTCGCAGACGTGGATCGTGGGGAAGTGGCTGTCGCCGAGGGAG
CAGCGGTGGGCGCCGGCGGGGACGCACTTCCACCAGTTCGTGGTGCCGCC
GATCATCGGGTTCCGGCGGGACTGCACGTACGGGAAGCTCGCCGCGATGA
GGCTGCCGGAGGACGTGGAGGGGCTGGGGACGTGCGAGTACACCATGGGC
CGCGGCGTCGTGCACGCGTGCCACGCCGGCGGCGTC
View all "STS117" genotypes
WC6 CIor5309 japonica   RA5288 STS081 AGGGGATAACTATTGCACTAATGTGATGACCAAGGTCGATTATTTAGAGC
ATGATTCCATGGATGATCAGGCATTGTTTTTGCATGAAAAGAACTTATTT
GTTCCAGAAGGAAGGAGCTCAGACAATTATAATAATGATGCTGCATCAAG
CAATCCACTTATGTGTGATGGTGTTGGTGGAAAAGAATTGGATGATGACT
CCTCCAGTTCGAAGGTATGTGCTTTTGTCTAATTATTCCATTGACAAAGG
GATAATATTGATTCAACACCTTTTAAGTGTTTCTTTACTGAGTGTTTCCA
TGCTTAATGAAAGACAGAAAGCTAACCTTTTTCCCCTTGCAGGGTACACA
TACTGTAAAGTTTGATGGCCAGCTCACCAGCTCTAACGCAACTACTTCAT
CGAGTAAACCTGATCAGCTTTTCTGGATAAATGGCTACATTTGTTCCATT
TGTGGATTTGAACTACCTCCAGGTTTTGAGGAGGAGAGACAAGAACATTC
AGATTTCCACTTGGCTGAAA
View all "STS081" genotypes
WC6 CIor5309 japonica   RA5288 STS042 AGGTGGATTCCAATGGTGAAATGGTGAGGACTTGTTGTGCAAACTGAGCC
TAGATTACTGCCATATACGTGTTCCTAAAACTTATGCATTGTGCTCTTAT
AATCACTGTGCTGATATGGTAGTATGTGTTGGTGTATAATT--CAATAAA
TGCTGTATAGCAACTAGCAATAGTCTTTTGATTATAATTTATCCCTATTG
GTTGGGTATAGCTGTGCATCTTTAACTATTAGAATTGTGAATTCGCAAAC
AACTTGTTAATACAGCTAATTGGTAGAATATATCTTGGAATTAGTTATAT
GTTGAGAAATCGAAAAGGAATATGAATATTTCCTGCTCAAAGTACAAACT
ACATACTTCAAAACTTTTAAGAAGTGGTCTTTCAGTTATGCCCAATTAAC
TAGGTGTCTCAACTGTTATTATGTGAAGGGGCAACAGGTTGATAAGTCAA
GAAGCGAAAGGTTAATCCAATTGCCTATTGTTCAGTCCATTTATGGTGCA
ATGAGTAATCAGGAATTGCTGGAAGCTCAAGAGCAAGAATCACAACTTGC
TTATCA
View all "STS042" genotypes
WC6 CIor5309 japonica   RA5288 STS052 AGTACGACGCAACGGCCGCACCACAAGGTGCAGACTACCACAAGTGCAGA
GAAGAAGTAGTGAAGTTACTGAAGGTGAATGCGCCCTGCGAAACCAAGAA
CTGCAGCTTCAATGGCGTCTGGAACGGTGGTGGCGGAGCAGGGCAGGATG
ACCTCTACGTTGCGTCCGCCTTCTACTACATAGCCTCCCATGTACGTCGT
GATTACTTAATTAATTAGCCAACTAAATTATTTAACTTCTCAGGCATGCT
TCAGACTGGCTACTAGCTAACTAGTTATGTAAATATATACCCCTAAATAT
GTGCATTTAATTGTTTGTGTAATTATGTTACATATACAAATTAATACTTT
TACCTGATAATTTTATCTCCAATGCATACATTTTGATCGGACCGGGATAA
AGGTTGGGTTCATCAACAGCGATGCACCCAGTGCGAAGTCAACCCCTGCA
ACGTTTAAGGCTGTTGCAGAAAAGGTTTGTAAACTGAGTGTCAAAGAAGC
AAAAGTAGAATACCCC
View all "STS052" genotypes
WC6 CIor5309 japonica   RA5288 STS044 AGTCGCTGGGAAACCCGGCGACGCTGTCGACGTGGTCCCTGGCGTCGGCG
GACTGCTGCGAGTGGGACCACGTCCGGTGCGACGAGGCCGGGCGCGTGAA
CAACGTCTTCATCGACGGCGCCAACGACGTCCGCGGCCAGATCCCGTCCG
CCGTGGCGGGGCTGACGGCGCTCATGTCGCTGTCGCTGTTCCGCCTCCCG
GGCCTCTCCGGCCCCATCCCGGCGTGCCTCACCGCGCTCTCCAACCTCCA
GTTCCTCACCATCTCCCACACCAACGTCTCCGGCGTCATCCCGGACTCGC
TCGCGCGGATCCGCAGCCTCGACTCCGTCGACCTCTCCCACAACAGCCTG
ACCGGCCCCATCCCGAACTCCTTCTCCGACCTCCCGAACCTCCGGTCGCT
TGACCTCCGCAGCAACAAGCTGACGGGTTGCATCCCGGCGGGGCTCGTGC
AGGGGCAGTTCAG
View all "STS044" genotypes
WC6 CIor5309 japonica   RA5288 STS073 AGTTATTGTGGATTCCTCTGATCCAATAGGTGATTTGTTAATCATGTG--
AGTTTTTGTGTTTGTCATTGATCTATATCATCAAAATAATCCTGCCTAAC
CACTTATCCAGGACCGGCTCAAGAGCTTTTCGAGAAGCCTTTCTTCCAGT
CAGTTGCCAGAGCTTTGCGTCCTGGTGGTGTTGTATGTACCCAGGCAGAG
AGCATATGGTTGCATATGCATATTATTGAAGATATTGTAGCTAATTGTCG
CCAAGTTTTTAAAGGCTCAGTGAATTATGCTTGGACAACAGTACCAACAT
ACCCTAGGTATGCTAACTGATTATTTACATGTGGCTGAATTGATATTTCC
TTAGTTCCTAAGCTAACCATGCTTCCAATGCAGTGGTGTTATT
View all "STS073" genotypes
WC6 CIor5309 japonica   RA5288 STS048 AGTTGCTGTAAGCAAAAAAGCCATGATTTTAGCCTATTTTTGGCTATTCC
TGGGTAAGGATCCCTCTCTAGTATTTCCTTTTCACAGCATGCACCCACAA
CATAAGTCAACTATGTGCTATCAACCTGAACATTACCATCTGGGCTGGCC
TGTTGTGTATTTTAGCAAAACCAAGCATGA---ATGCATGAATCGTATGC
TGTACTGCTGTGTAGGTGCAAAACTGGAAAGCACACAACTGAGAAACCAA
TCACAAAAGCAGTTCCTACTAAACCATCAAAGGCAGTTCCAGTCCAGACT
TCGAAGCAGAGTGTGGGAGCTGACACTTGCTCAAGGTGCCGTCAAGGTTT
CTTTTGCTCTGACCATGGTGAGTTTCTGTCTATAAGCATAATGCTTGGAT
ACAACTGATTGATCCCCTATTTGGGTGTAAC-------------------
-AGCTGATTGTTTCGTTATTATTTTAACGACTGACATCCCTATGCATTTT
TATGTGTTGATAGAATAAATCGTAACTTTTAATTTAACAGATTATGCACT
GCTATTT
View all "STS048" genotypes
[ Download ]