grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "PI280681" from the experiment "Genome-wide patterns of nucleotide polymorphism in domesticated rice".

E.g., Germplasm "IRGC9542", RA4969, Basmati 1, Marker/locus RM22.

Items 51 to 75 of 101.       Previous | of 5 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
Taducan PI280681 indica   RA5374 STS059 TACAGTGAATTTGATCCATTACACCTCTCCTCTGACCTCTGCAGATTCAA
CCTCTGGTCATACTGAGCTATCTTTGCTAGAGGAAATTAATTCACATGGT
GGCATATCAGCTTCTAGTGGTGAGACATGCTTGGATCCTGAACATTTATT
GGATGTAAATGTGCTTCATTACCAGCTTTATGTTCAGAAAATTTTGTCCG
AAAGTTTAGCTTCTACTAGTTTTTAGTTTCTCATTCTTTTCCATATTGTC
ATGTCATAATTTTTGTAGGCTGTTCCCTTCTCTACATGTCTTACTAATTT
TATCTTGGATTGTTCATTACGCAGAGACTGGCAATCATGATTCCAGCCTG
GAGGAGTTTTGGGCTAATCTTTTAGAGTCATCTATAAAAAACGACCCAAA
AGTTGTTACTTCTGCCTGCGGTGGGATTTTTGACAAAGCTATGACAATTG
ATATTACTGTTGTAGAGTTATAATCCTGCTTATTGTATAAAACAGGTGGT
T
View all "STS059" genotypes
Taducan PI280681 indica   RA5374 STS060 TCAAGAGTTCAAAGGTTGTAATGATCGTAGCAGATATACTCCCCATTTAA
CATCTCGTATTTTCTTGTCTCCGGGTGATGGAAATTTCACAAATTGTGGA
TCAATAATCCTGCCTGCTGTTGGATTTCAGTCCAAATCAAATGGACAGAG
ATGTTCGGAAGGGTGAATTATGCAGAAAATAACTAATAGTACTCATCATC
TTGGTTTTTTACTTTTAGAATCTGTCGACCAGGATAATTTCAAAGTAAAA
GTAGATGGCAGCAGTTTGAAGGTGGACGTGCCAGGGACTGTCGACGTCGG
GAAGCTCTATGAGCGCCTCAAGAAAATGTCATCCAGTGTCAAGATTGAAT
CAGTTGTGCCGGTATGTGCTAAATGCAGAGATTTTAATTAATTGCAAGAT
TAATGCCTCAATCTTTCTGATTATATTTCCTTTGCTAACTTCATCATTTA
TTTCAGGATGATCTAATGGCGAAAATGGATCGATACAAAAAGGACCTTCA
GAACATGA
View all "STS060" genotypes
Taducan PI280681 indica   RA5374 STS061 AAAAGTGTGATGGATTTCTTCTGCCTAATGCAGGTTGGTTAACATCACGA
AGGAAAAATACTAACTGAAGAGATGTAATAGATTGGATTATTCAAACATA
ATGTCAGCTGCAGCTTTAATACTGTTTCAGTTATCATTGATCTTACATTT
TTATCTGGATTTAACATCTGTAGGAAACAAAGGTTATACATGCCAGAAAT
GTAGCACTTCTAGAGATGGGGAAGAGTTACAAAAGATGGCTAGCGATGTA
CTACTATTATCTGACAAAGTCTCTTCCTTAGTTTCATCTGGAAGTATCCT
TTTTCACTATTACTAGATGCTATCTGAGGCAAATGTATATAATT-ATTGC
ATCATATTTTTTTGTGATTTT--GTAAAATGCTACCTTAACTTTGGGCAG
TAGATAACAGTGAGGTAGGTTCTATGTACAAGACCATTGAAGAGCTAGAG
CGGAAGCTTTACCATCCTTTGT
View all "STS061" genotypes
Taducan PI280681 indica   RA5374 STS062 AGCTGTTTTGCCTTTTGAAAAACTACGAGTTCTTCTCTTAGGTATTTTTT
GTGATCTGGCTTCCCTTATCTATTCCATAACAAAATATCGAATCTAAGAT
ATTTTCTGTAATATCTGGCTTCCGTTATCTATTTGGGAAAATTGATCATG
CGCCATGAAATGTTTTCCATAATATTTTCTGTTTAAGAACTGCCTTTAAT
TCAAGTAAGTTCAAAATGACTTGCTAATGATCACTTTCAAATGCCTCAGG
ATCTAACCAGATAGATGAGGTCCTTTCTGTGGATTCACTTAACCTCTTTC
CGAGTTTAACAGTAAGCAAGTTTCTTTCTAATGGTTTGTGTTTATTATTC
TGAAATTTAGTATTGATGTTCAATTCCTTTTCTATGAGGTTTGAACAGTT
AGAACTGCAAGATTTTGATACACTGCGATTCTTAGATTTACAAGAATGTT
ATGATGTACACCACACTGTATTTTTATTAGTTATGGCTTAGCACGCCAAT
ACTAATATCTACTTTTCTAAAGGATGTCAGGCTTT
View all "STS062" genotypes
Taducan PI280681 indica   RA5374 STS063 TGGTATTTCATCTACTTTATCTGCCTACGAAACTCTGTTGCTCAGAGGAT
ATGATGTGGGCTCAGTTATTTTGGAAGATCGTGGCTTGTCGAATGACAGA
TTCCTGCTCTCATACTTGAGAAAGAGGTGATTAATGCCTTTCTGTTCTTT
GTCAAATCACTCTGAAAGTGTGCAGGAGCATAGAAGCATCTCTTTTATTT
TAATTATATTATCCTGTTAATAATAATTATTTCAGTCTTTCATTTGGATA
TATGATAAACCTACTGCAACTTGCTTGTATTGTTTCTGTATTTCAATGTA
TGACTGATTTGTGCTATTTCTGTTATTTAGGGTACCTGTGCATGTCCTGC
CACCAATTCCTGAGGATCCCAAAGACGACCTAACTGATTGGTTTTCTGAG
TCATCCTCAGCTTTTAGTTCACTTAAAGATAGTCTGCAATCTTTTCATTC
ACGAAGAGTTCAAAGGCTAAACAGTATGCAGAGAAAATCAAAGTATTTGT
TGTGG
View all "STS063" genotypes
Taducan PI280681 indica   RA5374 STS065 TCTTTAAACATGCTTGCGCCAACTGCAAGCCAGCTTTTGCACACCATGAA
TTGTATATATGCTGTGAAAGGGTAGTCCTCAATAGGTAAACTGGATGCTA
TAGACCCATCCAAAACATTTTCCCCCTTCCATTAGGATATTATCCTGGAA
AAAACAAGTAGTGCTCGGTCCGAATTAGAAAAAGCAGAGATAACGATCAT
TCAATATGCTTGTCAGTGCTTCTTGTGCTCTACTTTTGCAGAAAGTTCAT
GTCCAGATACATTTAGTTTTGTTGATACATCTATTTTTGCTCTCCATAGC
TTGCTGTGTAGACTTGTGTATGAGGTAAGACTTGGGTTTTTACCCCTTCT
ATTCTGTTTATAATGCCTATCCAGAATTTATAAATCTGTGTAATCCTTTG
TACCCTTTGGTTGTAGGTTTACATCAGAC
View all "STS065" genotypes
Taducan PI280681 indica   RA5374 STS066 CGAGGATGCTTCTAAAGCTGGTACGCATTCTTCTGCATAATCCAGAAAAG
CCTCCTCACTTCAATTTTTTAGCAATGTCTATAACACGGGATGTGAAAAA
ATAGCATTTTCGATGAATTATCAAATATCAAAATTCATATTTAAAAGCAT
TAAGGTAGAGAACTTATTCCATTTTTCGTTGCCAAGAATAGAATTGTTAT
TAATTTGACTGTCTGCAAATGCATTTAGAAAGCAGTAAATAAATTTATTT
TTGTCTGTTATTCTATTCAAACTTTATACCTTGCTGCACTGTACACTAGT
ACATCATCTTTGATTTTAGCGTGTCTTTGTTTTTTCTCTTCGAGATTATT
GGAGCTTACAAGATTGCTTTGTCTCTGCTTTACAGAGCATAAGTCTGGTC
AACAGATGGGGTATCAGGCTGCATATCCTCCATGGGCAATGCATCCTCCA
CCTTACCATATGCAAGGAATGCCTTACTATCCTGGGCCGTACTACCCTCC
ATATCCTCCAGTGGATGACCCC
View all "STS066" genotypes
Taducan PI280681 indica   RA5374 STS068 GCCACGCGGACGGGGCTCAGGCCGTCGTCGTCGCGCGGCAACCGCGCCCC
GACGTCGTTCCGGTACGCCAACGTCAGCACCGGCGATCTCCCGGCGAGCG
TCGACTGGCGCGGCAAGGGCGCCGTCAACCCCGTCAAGGACCAAGGCGAT
TGCGGTAAGCGTGCGTGGTGTTCGTCCCATTTTGCGTGAGGTGGCGTTCG
CCGCCATGGCGAGCTGAGAGCGTTGTGCTGCGTCGTGCGTGCGTGTGCAG
GGTGTTGCTGGGCGTTCTCGGCGGTGGCGGCCATGGAGGGAGCCGTGAAG
CTGGCCACGGGGAAGCTGGTGTCGCTGTCGGAGCAGCAGCTGGTGTCGTG
CGACGTCAAGGGCGAGGACCAGGGCTGCGAGGGCGGGCTCATGGACGACG
CGTTCGACTTCATCATCAAGAACGGCGGCCTCGCCGCGGAGTCCGACTAC
CCGTACACGGCGAGCGACGACAAGTGCGCCACC
View all "STS068" genotypes
Taducan PI280681 indica   RA5374 STS070 AAAAACAGAAGTGTGGTTACATTTGGTGAGCTTAAGGGACTGAAAAGATA
CAGCTCAGTGTTCAAGGATACTGAAATTAACGACTTAATGGAAGCAGTAA
GTGGTCACTGTTATTGCAAAATACGATGCAAA-A-TGTACTGTAGCACAC
TTAAACCATATACATGGTATCTGTAGTATATAGACTGGATATTGTTTGTC
AACCTTTTGATCATGCTGCTTTTCAGAATTCTGTATTGTTTTGAATGTGT
GTGAAAAGTCGGGGCCAACACATTCATGTCAAAAGATTACTTAAACCATT
GGTTTAGTTGAAATGGAGTATGTCATGCATCTGTGATGAAATACTGTCTT
CATTGCAGAACTGTTTTATATATTTTAACCTTTTTGAGTACTACTTCAGG
CTGATGACACCACCTCCACCATCAACTGGGAAGAGTTTATTGCTGCAGCA
GTGTCTCTTAATAAAATAGAACGTGAGAAACACTTGATGGCAGCCTTTAC
ATAC
View all "STS070" genotypes
Taducan PI280681 indica   RA5374 STS071 ATATTGATGCATCTGGCAGGAAGAGCACGGTCAGGACTTGTCCCCAGCTC
CTAAATTTCTCAATGT--CAG-TCGAAGTTTTTGCTAGTTATTCTTCATG
GTGGTGGCTAGATTTTAAAAAGAAAGCACCATAGGTTTCAAACTTTAAAA
CTTGCAAGAATAATTGCCCCATATTTGTCCAAGTTTCAGTGACAATTTCG
CAGGTTTTGTTCATTCAAAGATTCCATCTGTCAGACTATGCA-------C
TGAATAAACTGACAGATTTTTGTGATGGATGCAGGGGAAGGGTGTGTACC
AATTCGTTGACAAGTACGGCGCAAACGTCGACGGCTACAGGTAACCAAGA
TGAGATATAAAATTAATATTAAAAGAGTACTTTTACGGTGGTATCTACTT
GT-----TTTAGCAAAAATTGTTTGG
View all "STS071" genotypes
Taducan PI280681 indica   RA5374 STS072 ATTGGTACGTTTGGGCATGGTGATTTAGATCTGTCTCAAGTTATTGTCCA
ATTATTTGAGTTGTTTCTTTTCTCTTCACAGTGTTGCTCTCTTCTTTTAA
TATGTTCTTCCATGTAAAAAACGATTAATAATAAAATGTCACTACCGAAC
TAAAAGATACAACCTCAAAATGATGGTTTTGTCATTTAAGAAAAACTAAA
GACTTGTTTTCTACCTATAACTGAATTATATTAAGATTCTCCGCCGGGCA
ACTGAATTATATTAAGGGTTTAGAGAAATATATTTTTCCCTCAATTTTCA
TTTTTATTTTAGAGAATGTCTCCCTTTGGCTAGTCACTCTAACATTTATG
TGCCTGTGTAATTTTGTGAACAGGTTTTACTTGGGTCAATGGCTGCTCTT
T
View all "STS072" genotypes
Taducan PI280681 indica   RA5374 STS073 AGTTATTGTGGATTCCTCTGATCCAATAGGTGATTTGTTAATCATGTG--
AGTTTTTGTGTTTGTCATTGATCTATATCATCAAAATAATCCTGCCTAAC
CACTTATCCAGGACCGGCTCAAGAGCTTTTCGAGAAGCCTTTCTTCCAGT
CAGTTGCCAGAGCTTTGCGTCCTGGTGGTGTTGTATGTACCCAGGCAGAG
AGCATATGGTTGCATATGCATATTATTGAAGATATTGTAGCTAATTGTCG
CCAAGTTTTTAAAGGCTCAGTGAATTATGCTTGGACAACAGTACCAACAT
ACCCTAGGTATGCTAACTGATTATTTACATGTGGCTGAATTGATATTTCC
TTAGTTCCTAAGCTAACCATGCTTCCAATGCAGTGGTGTTATT
View all "STS073" genotypes
Taducan PI280681 indica   RA5374 STS075 ACTCACATCTACTCAAGGTAGAGTACTCAATTTCTCATTGCTTTCACAGT
GATTTCACTGCTACTAGTGCCATGATCAGGCATTGCAATTTGCAAACCAC
ATTGGAGCTCCTGTAGATTAAATCTACTACTGGTAGTAGCTCATTGCCAT
TTGGTATTTTGATCATGATCCACAGAGGAGGAAGTCTTCTTCTTTTTCTT
GCAAGCCAAGCTCAGCAGCAGCTGACAAGGGATCATATGAAGAGGACTCC
TACTTTGAAGCACCC---TCACACTGCATGGGCAGGCCGGCTCCTGATTC
CTCTCCTGACCCTCTTCTCTCCCAGTTCATCTGCTGCAGCCTCGCTCCTC
CGGTCGATTCGCCGCGCCGCAGCGAAGCCGATGCCGAGGGCCATGGTTCA
TCTTCCTCAGATGATCAAAAAAGGTAAGAATTGTGCAGTTGGTGCTGTTG
GAGCAGCCTGAAATTTGGTAACAATTGTGCTGAATCTGAACAATGCTGAC
TGATCCAAATGCAATCTTTGATGCTTGCAGGAGAG
View all "STS075" genotypes
Taducan PI280681 indica   RA5374 STS077 CTGGTGAAGCAACAGAACAGATTATTAGGCAAGTAGAGAAGATGACTAGA
AATATTGAGCGCGCTTCTCGTGCTAGCAAGGTAATGCCTGTACTGCTGTA
TGCATATATATTGCAGCATTAATAAATTTGGTATTTGCTTTTTTAGTTTT
CCTTGGTTGTGCACGTTCCTTTGAGGAATGTTAAAGTGTTCTTTTATTTA
TAGGATGAACCTTCAACGTTGGATATGCCTTACGGAGATGTTAGTCGGAA
ATATCCTGCTGCCAGATCAAGTGATGCTTTTGCTACAGCTGATGGCGTAG
CTAAAAGAGCAAGATTTGATACCTCTGCTGCTTTAAACCCACCATTTCAG
GGAGCATCTGATTATTCTAATATGCAGGTTGACAATGAAGCGAATGTGGA
TCATTCCTCTGATCCAGCTCTCTTGAATTGTGATATGTCTCCTGTTGAGA
AGATGATTGAAATGA
View all "STS077" genotypes
Taducan PI280681 indica   RA5374 STS078 AAGGTCAGGCATCTCTTCGGCGTGTGCTTGTTGGTTACTCATTTCGTGAC
TCAGAAGTTGGATATTGCCAGGTAGGCATAAAGCAATGCTTTTCAAATGT
AACTGTTTTATAGAGAAGCTCCATTACTAACACCATGCAATGCAGGGTTT
AAATTATGTAGCTGCATTGTTGTTGCTTGTTATGAAGACAGAGGAAGATG
CATTCTGGATGCTTGCTGTACTACTGGAAAATGTACTTGTCAATGATTGC
TATACTGATAATCTTTCTGGATGCCATGTCGAGCAGAGAGTTTTCAAAGA
CCTCCTAGCTAAAAAGTGCCCCAGGTATTTCCCCCCTGTTATGTTTATGG
CTTTTATGCTATGATTTTTCATCAGTCGCTGGCAATAACAAGCATTACCA
TT-ATAAGATGATTGTGAATCATTGGATTACCCAAATGATGCAGGATTGC
TGCTCATCTTGAAGCAATGGGGTTTGATGTTTCTCTTGTTGCCACAGAAT
GGTTCTTGTG
View all "STS078" genotypes
Taducan PI280681 indica   RA5374 STS079 GGTTCAGTATATCTCCATTTGGGAACAATGCTCCTGCTACTGAGGTGGAT
AAATCACTCTTCAATGTAAAAGTGATCACAGGCCCAAAGAAATCTACAGA
GCAAAAGCTTTCAAATGGGTCTCCACAAAATGTAGTGCACCTGGACATAT
TCAAAGGTAATTCCCCTGAGCTTTTGACTTGGATCATTCAGTTGTAGTTG
AACATATAATAGAATGAGGCGTTTTGGTTTGTCTTGTGAATTGGTGGGAT
AAACAGTTGGTTTTTAATGCAAGATGTAAAGTTGAAGTCTAGTAGTGTTT
GTTTTGCAATTTGCAACGCTCATTTTTGATGCTATCTTATCTTCTGTCTC
TGCGCTCTTTATTTTGTTACAGGAACAAAAGGAGGGGATGTGTGTGAGGA
TGAAGGGATGGTGAAAGATTGCCATCCATTCAGAAAGGGGAGGGATGAAA
TATCTCTAAAACCCATAGAAGTGAGGAAGAAAGTTGGGGGTGGACAGTCA
TGCTCGGATGCAGAGATCGA
View all "STS079" genotypes
Taducan PI280681 indica   RA5374 STS080 CCTTTCTTATGCTTTCTCGGCACTTTTTAGGAAATTGAGTACATTTTATT
CTCTGTAAAACTAGGATAGCAGACAGCTTTTTCGATTCATTTTGTTGTCA
ATTTTCTGAAGGATGTTTCCTTTTCAGGCATTGACACCCCACATGCAAAC
ACTGGTGAAAGATATATCAAGTCCAAAGGCTGGGAGTTTGTTGGGACCTG
CTTTGGGTGATCAGCAACAAGGGAACTTCTCCATTCATCTTTGGAAAACT
GCTTTCCAAGATGCCTTCAGCAGAATATGTCCTCTTCGTGCTGGTGGACA
TGAGTGTGGATGCTTACCAGTGTTGGCAAAACTGGTATGTTTAATCATTG
ATATTTAATTTGAGAAGAATAATCATTTTTGTGAAGTTTATGCATGAGTT
GTTTTATTATTGTCAGGTGATGGAGCACTGTGTAGCTCGTTTAGACGTT
View all "STS080" genotypes
Taducan PI280681 indica   RA5374 STS081 AGGGGATAACTATTGCACTAATGTGATGACCAAGGTCGATTATTTAGAGC
ATGATTCCATGGATGATCAGGCATTGTTTTTGCATGAAAAGAACTTATTT
GTTCCAGAAGGAAGGAGCTCAGACAATTATAATAATGATGCTGCATCAAG
CAATCCACTTATGTGTGATGGTGTTGGTGGAAAAGAATTGGATGATGACT
CCTCCAGTTCGAAGGTATGTGCTTTTGTCTAATTATTCCATTGACAAAGG
GATAATATTGATTCAACACCTTTTAAGTGTTTCTTTACTGAGTGTTTCCA
TGCTTAATGAAAGACAGAAAGCTAACCTTTTTCCCCTTGCAGGGTACACA
TACTGTAAAGTTTGATGGCCAGCTCACCAGCTCTAACGCAACTACTTCAT
CGAGTAAACCTGATCAGCTTTTCTGGATAAATGGCTACATTTGTTCCATT
TGTGGATTTGAACTACCTCCAGGTTTTGAGGAGGAGAGACAAGAACATTC
AGATTTCCACTTGGCTGAAA
View all "STS081" genotypes
Taducan PI280681 indica   RA5374 STS082 GCCGGATGTTCATCATCAACGCCGGTCAAGGATTCAGGCTTCTCTGGAAC
ACCGTCAAGTCCTTCCTCGATCCCAAGACCACAGCCAAGATCCATGTAAT
CCAATCCATCCACAATCTTTTCGATGTCAATGTCACATCGATCATT-CGT
AATTAAGCTACATTTGATCAATTTGCAACTAAACATTACATAATGTTTGC
ATTTATGTGCCCTGTTTTAACCAGGTCCTAGGCAACAAGTACCAGAGCAA
GCTGCTGGAAGTGATTGATCCCAGGTCTGAGCATGAACCTTCTAGAGTTG
TTCGTTCCTGCTTCTATGCAAATGCAAATGGAATCACCTTGAATATTTAT
ATTAAATCTGCTA--ATATCATTATTAAAAAGAACAAGATTGAGCAGCGT
GTTGAGCTCACTCCCTGTTATTTCGAGACAGC
View all "STS082" genotypes
Taducan PI280681 indica   RA5374 STS083 CGCAGAGGTTCGACGGCATCGACGTCCACGACCGATACGCCAACCGCAAC
ACCGTCTTCTTCGACGTGAGCTCTCTCCCACACAAACTAGATGAATATAT
ACAATCTTGAAAAATCCAGAGCAAATCACGATCGATCGAGCAATGTGACT
GAAATTTTGTGTGGTGCG--------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
-----------------------------------------TTCTTGGTG
AGATCATCAGATCAACATGAAGGGGCTTGATGGGATCCAGGGCCCGGTGT
ACGTCGGGACAGGGTGCGTGTTCAGGCGGCAGGCGCTGTACGGATACAAC
CCACCCAAGGGACCCAAGAGGCCCAAGATGGTGACCTGCGACTGCTGCCC
TTGCTTCGGGAGGAAGAAGCGGAAGCACGGCAAGGACGGCCTCCCGGAGG
CCGTCGCCGCCGACGGCGGTGAGCTCCCAAATTCAGAGCTAAGAA-GAAA
TTATGGTGTGAGAAGATTTTCAGCTGATGGAATAATGTAAGTTTGTGTGT
GGTGGATCAGGG
View all "STS083" genotypes
Taducan PI280681 indica   RA5374 STS085 CCATTATGGTGTTGGAATTAAAGGGAAGGAACCCTCAGATTGTGGTGGGT
AAGAGATGGTGGTAGTGGAATCATATCAAAGTGTGGTGCTATTGACTAGA
GAAAAGTTGATGCAGGAAGGAAAAAA--CTGGAGATTGTGGCGGAGGGTT
GGGTTTGGTTTGGCTTTGGCCGGGGATAATAAATGATGGAGCTGTAGCCT
GTAGAATTAGGCCTTGTTTAGTTCCCAAAACAAAAACTTTTCACCCATCA
CATCAAATATTTGGACACATGCGTGGAGTATTAATTATGGACAAAAAGAA
AAACCAATTACACAGTTTACGTGTAAATTGTGAGATGAATCTTTTAAGCC
TAATTGCGCCATGATTTGACAATGTGGTGCTACAGTAAACATTTGCTAAT
GACAGATTAATTAGGCTTAATAAATTTGTCTCGCAGTTTCCTAGCGGAAT
CTGTAATTTGTTTTGTTATTAGATTACGTTTAATACTTCAAATGTATATC
CGTATATCCGATGTGACAACCAAACCCGAAAATATTC
View all "STS085" genotypes
Taducan PI280681 indica   RA5374 STS086 ATTGAGGATCCGTTTGACCAGGATGACTGGGAACACTATGCTAAGATGAC
CGCTGAAATTGGAGAGCAAGTGCAGATTGTCGGTGATGACCTCCTTGTCA
CCAACCCAACAGTGAGTGCATAGTTTTCTATTACTTCTAAATATGATCTC
TCTTTCAGTGTGGTTGATAATTAATATTAATATATGTTATGCAGAGGGTG
GCAAAGGCAATCCAGGAGAAGTCATGCAATGCTCTTCTGCTGAAGGTATG
GTTCTATTGATTCTTTCCTTCACGTTTAATAGTTTATCTTCCATGTGCGA
ATATATCACCCTTGTCTTTCAACAGGTTAACCAAATTGGATCTGTCACTG
AGAGTATTGAGGCCGTGAAGATGTCAAAGCGTGCTGGCTGGGGTGTGATG
ACCAGCCACAGGAGGTATACTGATATGCTTACCTGTCTTTATTCCTGGTG
GACCTGGTCTGACTACCAACCATTTGTATATTGACTTGTG
View all "STS086" genotypes
Taducan PI280681 indica   RA5374 STS087 CCTCCAGCTTCAAAGGAAGTCGTTGCGAATCTACCAGTTGTAACCGTGAC
AGAAGAAATCATAGCTAGATTGGGCAAAGAGACTCAGTGTGCTGTTTGCC
GGGAGAGCTTGCTGGTGGACGACAAGATGCAGGAGCTACCGTGCAAGCAT
CTTTTCCACCCTCCATGCCTCAAGCCATGGCTGGTAATGTCCACATAACC
CCTTTGAATCATCTGAAAGTAGCCTCGACGCATCGTTACAACTCGGTGTA
GCTGAACATTATACCCATCATGGTTGTGTTGTGTTGCACGCAGGACGAGA
ACAACTCCTGCCCGATCTGCCGGCACGAGCTGAGGACGGACGACCATGTG
TACGAGAGCCGGAAGGAGCGGGAGCGAGAAGAGGAGGAAGACAGGAAGGG
CGCCGCGA
View all "STS087" genotypes
Taducan PI280681 indica   RA5374 STS089 AAGCTGTGAAGGTGGTCGACATTGTGGACACCTTCCGTCTTCAGGTTGCT
CTCACTTCCATTACCTTGGCTCTTGTATATGATACTATCTGCACTTTATT
TTTGTGCTTAAATTCCATGTGTGTTTGGCAGGAGCAACCTCCTTTTGACA
AGAAGCAGTTTGTGACCTTCATGAAGCGCTACATCAAGAACCTCTCCGCC
AAGCTGGATGCGGAAAAGCAAGAGGAATTCAAGAAGAACATTGAGGGTGC
CACCAAGTACTTGCTTGGAAAGCTCAAGGACCTTCAGTTGTAAGTTCACT
A--ATTGCTTGCCACAGGTCCAGGAAATAGTAACATATGTGATGCCATGA
ACATGTCTCACCATTAGTGCCTACAAATTCCAGTTTAAATGATTTGCTAT
GTTCTATCACATTAAATTCTTGAAGCAAT---------------------
-------------------------AAGACTTGTATTCAAACCTGCTTCT
TATGCTGTCTCTTATGATCTGTTTCAGCTTTGT
View all "STS089" genotypes
Taducan PI280681 indica   RA5374 STS090 TACAGGGGGTAAGTTCTTCGACTAACCGATAAATGGTACTCCTATTTTAT
TTCTTTGAACCTCTTGAAATTATGGGAACTTGTAGATAGTTTTGGCTGAT
GGAACAGAGGTGCTCACATCAGTTGTTTTATCAAATGCAACTCCATATAG
AACATTTGTGGTAAGAGCTACTCAGAATATATAACAATGTGAAGATATA-
--CCTGTTCCAATTTTGTAGACACAATGAAACAAATATTTGTACACTAAT
ATATGGTTTCCTTTTCAGGACCTAGTGCCTGCCAATGTTCTTCCAGACAA
CTTCCTCTCTGCTATAAAAACTGCAGATTATAGCTCTGTAAGAACGTACT
TTGAAGCATAACATAATAAATAAGTGTTATAATATTGATTGATAACAATG
TAATATGATTCTGTGGAGAGCAGGCAACAACGAAAATTAATGTGGCTGTT
GACAGGCTGCCACAGTTTTCCTG
View all "STS090" genotypes
[ Download ]