grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "PI366153" from the experiment "Genome-wide patterns of nucleotide polymorphism in domesticated rice".

E.g., Germplasm "IRGC9542", RA4969, Basmati 1, Marker/locus RM22.

Items 26 to 50 of 101.       Previous | of 5 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
Taipei 309 PI366153 Japonica   RA5397 STS048 AGTTGCTGTAAGCAAAAAAGCCATGATTTTAGCCTATTTTTGGCTATTCC
TGGGTAAGGATCCCTCTCTAGTATTTCCTTTTCACAGCATGCACCCACAA
CATAAGTCAACTATGTGCTATCAACCTGAACATTACCATCTGGGCTGGCC
TGTTGTGTATTTTAGCAAAACCAAGCATGA---ATGCATGAATCGTATGC
TGTACTGCTGTGTAGGTGCAAAACTGGAAAGCACACAACTGAGAAACCAA
TCACAAAAGCAGTTCCTACTAAACCATCAAAGGCAGTTCCAGTCCAGACT
TCGAAGCAGAGTGTGGGAGCTGACACTTGCTCAAGGTGCCGTCAAGGTTT
CTTTTGCTCTGACCATGGTGAGTTTCTGTCTATAAGCATAATGCTTGGAT
ACAACTGATTGATCCCCTATTTGGGTGTAAC-------------------
-AGCTGATTGTTTCGTTATTATTTTAACGACTGACATCCCTATGCATTTT
TATGTGTTGATAGAATAAATCGTAACTTTTAATTTAACAGATTATGCACT
GCTATTT
View all "STS048" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS094 ACAAGTTGAGGGTGGAGATCGGGAATTTGCCCGAGGAGAAAATGGGGAAT
GTGCTACAGATTGTGCAGAAGAGGAATACCGATCCGGCGCTAATGGGAGA
GGTCGTTGAGCTTGATTTCGACGAAATGGATGTCGAGACGCTGTGGGAGC
TCGATCGATTTGTGGTCAATTGCAAGAAGGCGCTCAGCAAGAGCCGGAGG
ACTGTCGCGATGAACGGTGATGCTGTTGATGCGACTGCTATTGTTCCAAC
TGAGGACGATACCGTGCAGGTGAATGTGCATCATCAGCCTTCGGTGGTTG
AAATTGGGGACTCGGTATGGCAATGTTGCAATCCTTTGTTCTGTGTAATG
ACTAATGCTTGAATTGTGTTCTCATGTTTTGTTTATGTTGCACTTTTGCA
GGAGAATGACACGCCGGAGAAGAGGGTTTCAGAGGTTGATATGGTTGATG
AGTATGTTGATATTGGCGATGAGATGCC
View all "STS094" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS057 CCACTGAGCTACAGGGGAGCGGATATATTTGTGCTGGCATTCTCACTGAT
CAGCAGAGCAAGCTATGAGAATGTTCTCAAGAAGGTAGGTACTATACTCC
ATTTAGTTCAGTTTGGACTCAAAATGTCTGAACATCTGACAACATGAGGA
TAGTGACCACAGATACTGTACCAAGAACTTTACCTTTCCTTCTGACAATG
ACATTTTTAGACCACCTTTGACCAATATTCTTCACATTTTTCTTCTTTAC
AGATATATACTATATGTGCATATGATTTTCACTGGAATATTCTGAGCTAA
TGTTATCTTTTTCTGTTTCTGATCATGCAGTGGATGCCGGAGCTTCGCCG
GTTCGCACCGAATGTTCCAATTGTTCTTGTTGGGACCAAGTTAGGTTTGT
ACCGGATGCAACATTAACTCAACAAAGCTCAGTGCCACTTCCTTTTGCAG
GCTTGTTTCAATGCTCTTAGGTTTTAACCGTGCTTGCTTCCAATTGTTCA
GATCT
View all "STS057" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS023 GAGCAACTCAGGGTATAGATAATCTGAAAACAAACCACTTGAATCCCATG
ATGAAAACCATTTCACACTTCGAGTTTACTGATGATCTGTTCACTTCTGC
AGAAAGAACATTTTGATATCAGGAAAGGTAAAGCGCCCGAAGATGCCATC
GACTGGAATGATTTCAAGTCCATGACCTTCACTCGAGCTGTAAGTTTGAT
GATGATAAACTCAGAAAGCAGCCACAGTAACAGTGTAGTCTGATCATGAT
GAACTCATGGGCACTTTTACTATGCAGGTTATCTTCGAGACATTAAGATT
AGCTACAGTTGTGAATGGGCTGCTGAGGAAAACTACCCAAGATGTTGAAA
TGAATGGTGAGATATGCATGATATATACGCTGCTGCAATTAGCATCTTTT
TGATAAATCTTTGGATAGCCCTAATGCAGTGCTTATTTGTTTCTTCCAGG
GTATGTTATCCCAAAAGGTTGGAGAATATATGTTTACACAAGGGAAATAA
ATTA
View all "STS023" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS021 TGGTTCCAGTCACTATGACATTGAGGTGGCACCCCGCCGGTTGGAAAGCT
TGATAATTTCTAGCGGTGAGGTCATCTACTCACTTGAGTTCTCATACATT
GACCACAGTGGGCAGCAGCACACATCAGGCACATGGGGCGGCTATGGCCC
AAATAAAGGGAACAAACATACTAAGGTGACTATGAATCTTATTATTCAAT
TCTTGCATTTTTCTTTTAGATAAAATGATTGGTATACATTCATTATCTCT
GCACACAACTAGTGAAATTTATAATAGGTTTACTAGTAGTATTATGTTAT
TTTGAAACTTTTCTTGCAGATTGAGCTTGGTCTTATAGAGTATGTAACGG
AAGTTTCTGGGACAATCGGACCATTTGATAGGGCACCCGCTGGTGTTATT
ACATCGCTTATGTTTATCACTAATAAGGGAAGCTACGGACCTTTTGGAGA
AGTAAGAGGAACTCCTTTCCACATCCCAGTGCAGGACAATGGCAGCATTG
TTGGCTTTTTTGCACGTGC
View all "STS021" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS008 TTAAGCGGGCAATTGCAACGAGCATTTGTCACAGGTACACGCTTCCTCTA
CATGTATATTTTGTGTGTCTTATATCTAGTATTTCAGTTACACCTTACAC
CATGACCCATCAATCTTTTATCCCAGGTGTACCTTCATTGAAACGGTCTG
AGCTGGAAGCAGCATGTGAGGATTTCAGCAATATAATTGGTTCTACATCT
AGTTGCATGTTGTACAAGGGAACTTTATCAAGTGGAGTTGAAATAGCAGT
TTTGACAAGTTCAACAGAATCCGGGAAGGAATGGTCAAAAGAATGCGAGT
CACAGTACAGAAAAAAGGTAACATGTGCTCATAACTTTTAGGATATCCCC
TAAAATACAAATATGTTTTCTGTGGTGCAAATGACTTTTCTCAGAAATGT
GCGTATGCTTTTTCTCATCTTTACTGTGCGAATGGCTGAAATGGTTATGA
TTTCAGATCACAAATTTATCCAAAGTTAGCCATAAGAACTTTATGAATCT
GCTCGGCTATTGTGAAGAAGAG
View all "STS008" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS081 AGGGGATAACTATTGCACTAATGTGATGACCAAGGTCGATTATTTAGAGC
ATGATTCCATGGATGATCAGGCATTGTTTTTGCATGAAAAGAACTTATTT
GTTCCAGAAGGAAGGAGCTCAGACAATTATAATAATGATGCTGCATCAAG
CAATCCACTTATGTGTGATGGTGTTGGTGGAAAAGAATTGGATGATGACT
CCTCCAGTTCGAAGGTATGTGCTTTTGTCTAATTATTCCATTGACAAAGG
GATAATATTGATTCAACACCTTTTAAGTGTTTCTTTACTGAGTGTTTCCA
TGCTTAATGAAAGACAGAAAGCTAACCTTTTTCCCCTTGCAGGGTACACA
TACTGTAAAGTTTGATGGCCAGCTCACCAGCTCTAACGCAACTACTTCAT
CGAGTAAACCTGATCAGCTTTTCTGGATAAATGGCTACATTTGTTCCATT
TGTGGATTTGAACTACCTCCAGGTTTTGAGGAGGAGAGACAAGAACATTC
AGATTTCCACTTGGCTGAAA
View all "STS081" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS047 GACGCCGGGCTGTACATGATCCTGCGCATTGGGCCGTTCGTCGCCGCAGA
ATGGACCTTCGGGTTTGCCTCTTCGTTATACTGATGCAGTGTCACGATTG
GTTGTAGTTGTGCAGAATTATGGTGATTCGATTTCTCTGGGTTGATGGGT
TTATCCGTTTATGTGTGCGTGGATGTACAGGGGCGTGCCGGTGTGGCTGC
ATTACGCGCCCGGGACGGTGTTCCGGACGAACAATGAGCCGTTCAAGGTG
TGGCGGGCTTGTGAATTTCGTGGCGTTTTATTTGGGGAGTTTGCAAGTTT
GGTGATGGTTATACTGACATTTACTTACGCAGTCTCACATGAAGAGATTC
ACGACGTACATTGTGGATATGATGAAGAAAGAACAATTCTTCGCTTCGCA
GGGTGGGCACATCATCCTAGCTCAGGTCTGGACATTGTCATACTAATCCT
AATTGGGGCGCTGAAACATCAATCTGTTTCTATCAACTTTGAGATAGGTG
TACTTCACAATTGACGGCAGAATTGGTGCACTGTAGGTTGAAAATGAATA
View all "STS047" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS116 TGAAATATCATATATGCTTGCTGTAATGGCACTGCCTGAATTAAATGGTG
GAATAGCAAATGAGCATCAATCTATTGTCAGCATAGTAGAAACATCTGCA
GATTTGGAATCTACTTGTTCAAGCTCCCTTGTTGGGTAAGATGGTTTAAC
AGTAGCTTATAATTATATATTTTGAGATGTTATGTAGTTATTCTGTTGTA
TTTTGGAAGTTAAAAGACAATGAAATTGTTTATTTTGCAGGTATCTCTTA
TACCATGATGATCTTAGACCTTCAATACTAAGGCTAATCAATAATATTAT
TGGCTATTGGAAAGATAGTGAAGCAAGGATTAAAGTTGTGTCATTTTGTC
ATATGCTGATCCAACTTGCTATTTCTACGCACAATGATAAACTTATATCT
TTTGTTCAAGATAATTTAATTCCAATGGTTGTCCGATGCTTAATATTTGA
GCCAATATCAAACAATAATGATCTTCTTCTT
View all "STS116" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS122 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTCCCA
TCCCGCTACGATCCTGCCAAGCACGCCCCCCGCTACCCCATCCCCTCCGC
CACCCTCACCGGCCGCCGCGAGAAGGTAATTCTGTTGATTGATTTGCGTT
TGGGTTTTACATTTCACTATATTTTCTTTCTTAATTACTACTTCCCCCGT
TTCAGATTATAAGATGTTTTAATTTTAGTCAATCTCAAACTATAAGTTTA
ACTAAGTTTATAGATAAATATAGTAATAATTACAACACCAAATTAGTTTC
ATTAAATCATTAAATCTATAGTTCAATATATTTATTATGAGTTAAAAATG
TTACTATTTTTTATATAAACTTAGTCAAATTTAAAACAGTTTAATTTTGA
CCAAAGTTAAAACGATTTATAATCTAAAACAGGAGAAGTAGTAATAGCTA
GTCAATTTATTAACTGGTTTTGATCGATCGGGTTGC-GAGTGCAGGTGGT
GAT
View all "STS122" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS109 CGACGTCGAGGACGCTGGTGCTCGCCAACTCCGCGCCGGTGCTCGCCGGG
CAGCGCCGGTACGCCGTCAACGGCGTGTCGTTCGTCGTCCCCGACACGCC
GCTCAAGCTCGTGGACAACTACAACATCGCCAATGTCATCGGCTGGGACA
GCGTCCCGGCGAGGCCCGACGGCGCGGCGCCGCGGTCGGGGACGCCGGTG
GTGAGGCTCAACCTGCACGAGTTCATCGAGGTGGTGTTCCAGAACACGGA
GAACGAGCTGCAGTCTTGGCATCTCGATGGATATGACTTCTGGGTTGTTG
GGTAAGCTACATTCCCATCAACCACTGAAACTTTCAGAT-TTTCAGTTGC
ATCAATTCTCAGATGAACATCAACATGAGAAAGATCTGTTCATTCACCTT
TGATGATTTCTTTCTCTGATAAATGGATTCAGGTATGGCAATGGTCAGTG
GACTGAGAATCAGCGGACAACCTACAACTTGGTTGATGC
View all "STS109" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS059 TACAGTGAATTTGATCCATTACACCTCTCCTCTGACCTCTGCAGATTCAA
CCTCTGGTCATACTGAGCTATCTTTGCTAGAGGAAATTAATTCACATGGT
GGCATATCAGCTTCTAGTGGTGAGACATGCTTGGATCCTGAACATTTATT
GGATGTAAATGTGCTTCATTACCAGCTTTATGTTCAGAAAATTTTGTCCG
AAAGTTTAGCTTCTACTAGTTTTTAGTTTCTCATTCTTTTCCATATTGTC
ATGTCATAATTTTTGTAGGCTGTTCCCTTCTCTACATGTCTTACTAATTT
TATCTTGGATTGTTCATTACGCAGAGACTGGCAATCATGATTCCAGCCTG
GAGGAGTTTTGGGCTAATCTTTTAGAGTCATCTATAAAAAACGACCCAAA
AGTTGTTACTTCTGCCTGCGGTGGGATTTTTGACAAAGCTATGACAATTG
ATATTACTGTTGTAGAGTTATAATCCTGCTTATTGTATAAAACAGGTGGT
T
View all "STS059" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS010 CACCAAGGTGAGCGTTGGTTGCTTAGCTAATGATATTAGCTTCCTTAATT
-----GCGTTGTTTAGATTGTATTAACGTTTAACTAATCACGCAATGGGT
TCATGGATGGATGCAGGTGAAGATCCTGAGGAGGGAGTCCTACTGGTACA
ACGGCACTGGCTCCGTCGTCACCGTTGATCAGGTACGTACA---------
--------------------AATCTCATAGCCTTCACATGAATCAGTTCA
ATTCTCCTAGTACTCCAATCGATAATCAAAAGGAAGAAATACTTTTAAGC
AATGAATAATAATCAATTAATGGTTGAATTGAATTGACTGGATGCAGGAT
CCCAACACTCGCTACCCGGTGGTGGTTCGGTTCGCCAAGGTGAACTACGC
CGGCGTGTCGACCAACAACTACGCC
View all "STS010" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS072 ATTGGTACGTTTGGGCATGGTGATTTAGATCTGTCTCAAGTTATTGTCCA
ATTATTTGAGTTGTTTCTTTTCTCTTCACAGTGTTGCTCTCTTCTTTTAA
TATGTTCTTCCATGTAAAAAACGATTAATAATAAAATGTCACTACCGAAC
TAAAAGATACAACCTCAAAATGATGGTTTTGTCATTTAAGAAAAACTAAA
GACTTGTTTTCTACCTATAACTGAATTATATTAAGATTCTCCGCCGGGCA
ACTGAATTATATTAAGGGTTTAGAGAAATATATTTTTCCCTCAATTTTCA
TTTTTATTTTAGAGAATGTCTCCCTTTGGCTAGTCACTCTAACATTTATG
TGCCTGTGTAATTTTGTGAACAGGTTTTACTTGGGTCAATGGCTGCTCTT
T
View all "STS072" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS030 AAACATAAGTCTTCAACCCTCAGGATTGTTGGATATGTTCTTCTAGCTAT
TGTCCTGTTTATAGTTACAGTGCTGCTGGTAATATTTTGCCTGTCCAAGT
ACCAAGAGAGACAGTCAAGACGTGATTATACAACAAGTCAGGTGGGGAGG
GTTCATCAGAGGGTTGAAGAGCCGAAAGTTAAGCAAGCTTCAGTGCAGTC
AAGGAATGATGCCAAAAAAGGTCAACAATTAATTTATATATTCTGTAATA
TATTTCTGATTATATTTTATTTGTTTTATATCACAGCATATTGATGTTCT
ATTAACAGGATCAACAGAGGTTCCTGAACGGAGGCAGGTTCGTGAAATAA
ATTTGGCGGTACCAGGTATAGATGCTTGTAAATCTGATCTATCAGGTCTT
TTAGTACTGTAATACTATTCACATTTTTAAGTTCAGATGTATAAAATAAC
TATTCAATTGCTGGCAGCTGCTCT
View all "STS030" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS035 AGAAGACCAAGGATGGCAAGCCCTTCGTCGATGTCCTCAAGGAGGGTGGT
GTCCTCCCGGGCATCAAGGTGGACAAGGGCACAATCGAGGTTGCCGGCAC
CGAGAAGGAGACCACCACCCAGGGCCATGATGACCTTGGCAAGAGATGCG
CCAAGTACTACGAGGCTGGTGCCCGCTTCGCCAAGTGGCGCGCCGTCCTC
AAGATCGGCCCCAACGAGCCGTCGCAGCTCGCCATTGATCTGAATGCGCA
GGGCCTCGCTCGCTACGCCATCATCTGCCAGGAGAACGGGCTGGTGCCGA
TCGTCGAGCCCGAGATCCTTGTTGATGGCCCTCACGACATCGACCGCTGC
GCCTACGTCTCGGAGGTGGTCCTCGCTGCGTGCTACAAGGCCCTCAACGA
GCACCATGTCCTCCTCGAGGGTACCCTCCTCAAGCCCAACATGGTCACCC
CAGGCTCTGACGCCAAGAAGGTGTCTCCCGA
View all "STS035" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS112 CAAAGAACTTTCAGATGGGTGTCTCCAACAAGACTCCTGAGTATCTCAAG
ATGAATCCTATTGGGAAGGTTTGAGCAAAACCACCTCTGAATTTTGGTAC
ATTTGCACAGAATCTGATTTGGACACGTTTCCTTTCAGGTCCCTATTCTA
GAGACTCCTGATGGTCCTGTTTTTGAAAGCAATGCGATTGCACGATATGG
TAAGTGATACATAGCAAGGATTCCGTTCTTTTAATCCTTTTCTCTCTATT
GCTTGATTTAGTTCTAAGTTCCTCTCATTTTCCTGAAGTTACTCGCTCGA
AGTCTGACAACCCACTCTATGGGTCTTCACTGATTGAATATGTGAGTGAT
CTTTCATAAATATTTAGGATCATTCTTGATTATTTTCCAGCTCCTAGAAT
TTTGTGTTTCTTTCAGGTTGATCTTTCATAGACATTTAGGATCATTCTTG
ATTATTTTACCAGCTCCTTGAATTTCTTGTTTCTTTCAGG
View all "STS112" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS110 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNGGGAAGATTATTTCCTTAGTTATATATACCCACA
CAAATAATTCAATATGTATTGATCGGTCAATCGATCTGTAATTAATTAAT
TTGATCTGTTTTTGTTGAGTATAGTTCGGCTGATGAGGAACCGCTCGCTG
ACCAGGGAGGAGGTGGACGCGTTCTGGAGGCGCCAGCAACGGAAGCAGCC
ACCGTCGTCGTCGACGTCGTCGGAGCCCAACGCCACCACCTCGCCGCTCG
CCTCTCCCCGCGCCGCCGCCAACGTCGTCTCGCCGCTCGCATCACCCCGC
GCCGCCGGCGACATCTCGCCGCTCGCCGCCTCTCCCGGCCGCGCGGTATG
TAATTAAACTAATTAAACATGCATCGATATAT--------TCTTGGACTG
AATTAATCAATTAATATAATTAATTCTCTCATGCAGCAGCAGGAGATGAG
TAGTAGTCGTTGCACGTTGG
View all "STS110" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS051 CCTTTCTTGACAGATGCTTTGACAAAGTTTCAGGTAAAGCTTTCCATGAA
CAAAAATACAATCTGTTTATGGTTTCATTGATCAGAGGTAATGGAAATGT
TCTACAAATATTGTTACACACTATTGACCTGGGGTCAGGGGATATTTTAC
CATCTCCTTTATGGAGGACAACCGAACCTTACAATAAACAAAGAAAAGTG
TAACTGAAGAAGTTCATTTGTTTTACAATGTATTCTTCCATCATCTCAAT
TGAAATATGCTATGCTTGTTCTTGGATGAAAAGAGAAATGTCCATTAGCC
ATATGATAAGTTATTTGCTGCTTTTGGTTGGTGTCTGAACATATTATATG
CTTTCGACTTATTAAGACAACTGCTTTTGTTTGTGATTTTCTTCTTGTCC
TTGTTGGTCCAAACTGCCAGTACTTAAA-CACGCACTGCATCCTGCATGA
ATGTTTTCTTATGAGATAACTTGATTTCATTATTTTGTAGGACCCTGCAG
AGGCTGACAAGTTAATGAAAAT
View all "STS051" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS012 AAAGGTTTCAAGTACAAAAGTCGAAGAGCTCCAAGTAGATGTGGCGTCTA
TGGATGTTGAAATCTCTGCGTTAATGAAGCTATTTAGAAAAATAACAGAA
AACGACCGAGCCCCTTACTCGAGGGAGAGAGCCGATGATTCATCTTTGGA
ATGTGAACCGGTTCAACTTGACGTAAGCTCATTTTTTCCTTGTTATAGTT
TCCTTTCGCTCTTCAACCCAAAGTACGTCATGTAGTTTTACCACCTCTTT
GATGAGCGATTGTTTTT-CCTCAATACAATTGGCTAAACGTCCTACTTGA
TATGGGCAGGATATGGTTGGTGACATCGACATGGAGAAGATGGAGCAGGA
AATGTCTGCATACGCTACAGCTCTCGCTGCCGCGAAAGACAATCCTACTG
A
View all "STS012" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS108 TCGTGTAGCTGCTTCCAAAATAGGCACTCTTCTTGGGGCACATGTCGAGC
AGTGGAATACAGCTGAGTGTTGGCTTCAGCTGTATGAACGCTGGTCATCA
GTGGATGATATTGGTTCCCTTTCAGTGATTTACCGGATGCTTGAGTCAGA
TGCAGCAAAAGGTGTTTTGTATTTCAGACAATCTTTGCTGCTCCTTAGGT
TAGTTATACTAGCACCTCACTCTGTTGATTCCCTTGTGGCCATTTTGGTC
TCAACTCTCAACATAACTATAGATGATGCTTAATATTTTTTT-GTTTACA
GGTTGAACTGTCCTGAGGCTGCAATGCGCAGTTTGCAATTGGCACGGCAA
CATGCAGCAACTGAGCATGAACGGCTAGTGTATGAGGGGTGGCTTTTGTA
CGATACTGGGCATTGTGAGGAGGCCCTACAAAAAGCAGAGGAATCTATTT
CTATTCAAAGGTCATTTGAGGCTTTCTTNNNNNNN
View all "STS108" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS107 CATCAGACGCCTTTTACAGGCTTAGCAACACCAGGGAGCAAATCCAGTCG
TATGTTTTTGATGGTAAGGTTCCTGTATGCTGTGAACATTCATGCATCCG
ATGCATTTGCAGTTCATACTCTTCTGATTACCTTCTCTATGTTTTGCCTC
TATTGTTCAATGCTAACAGAACTTTCTTCCTC--G--CAGTGATCAGGGC
TAGTGTTCCAAAGATGAACTTGGATGATGCATTTGAGCAGAAGAATGAGA
TCGCAAAAGCTGTGGAAGATGAGCTTGAAAAGGTTTGTGTTCAATAATTG
GTGGTCATCTAGAGCATAGTGGAGTTTTATACTGACCTAGTATATACTCT
GTAGGCAATGTCAATGTATGGTTATGAGATTGTGCAAACNNNNNNNNNNN
NNNNNNNN
View all "STS107" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS002 ATTTGCTAACCAACTCACTCAAGGTTACAACAAGAAACTGAAGAGGATGA
TCTACAAGCTGAACCAGGAGATGGGGCCTGAGAGTAGATTTGTTTACGCA
AACACGTACGAGATCGTGATGGAAATCATTCAGCAGTACCGTCAATACGG
TGAGCTTTCTTCCTTGCTGCAGCTACCTCTTGCGAAAACCACCTGCGAAT
GCTGTGCTGCAGTCTGCAGAGCATTAGAAAATGCAGAATATTTCAGTCTT
GCATTTGTCTTCAGGTTTTGAGAATGCGCTGGACCCATGCTGCGGAGGCA
GCTTCCCTCCATTTCTCTGCATCAGCATCGCTAACTCAACCTCCACCTTA
TGCAATGACCGGTCCAAGTACGTCTTCTGGGACGCGTTCCACCCGACCGA
AGCCGTCAACTTCATCGTCGCCGGCAAGCTTCTCGACGGCAACTCCGCCG
TTGCTTCTC
View all "STS002" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS118 ATCCTCCTCTGTCGATGATTCAGTGACATCTGTAGATTTCTTCCTAGGAG
AGGTCTGGCATTCTTTTCATGCAAAATCTATTGCACCATCTGCCAAATGA
ACATGAATTTACCGATGTTATGCTTCTTACATAAAT-TGTTTGGTCGTTA
TGATGCAGGCCCTTGATTCCTTCAAGGCTGAAAGTGAGTCTGAGCTTAAC
TTGTCAGCTGGAGACATTGTTATTGTCCGGAAGGTAATATACCTCTGCTG
TCCATGTTTTGTAATCTTCAATTGAGTTGCCGATATTGTTCCGATGTTTC
TAAATACAAGTTCCTGGCAGCTAACATATCATAATTGAGCTGTCAGTAAT
CTAATGTGGTCTTGTCCGAACACAGATATCAACCAATGGTTGGGCAGAAG
GCGAATGCAAGGGAAAAGCAGGATGGTTCCCACATGGTTATATCGAAAGA
CGAGAG
View all "STS118" genotypes
Taipei 309 PI366153 Japonica   RA5397 STS046 TCGGAGCAAGGGGCGGCGAGGTTCGCGGCGATCCACAAGGTGTTCGGCGC
CAGCAACGCCTCCAAGCTCCTCTCCCACCTCCCCGTCGCCGACCGCTGCG
AGGCCGTCGTCACCATCACCTACGAGGCCCAGGCCAGGCTCCGCGACCCC
GTCTATGGCTGCGTCGCCCAAATCTTCGCCCTCCAGCAGCAGGTACTATT
TCATTTCATGGATGAGAATGAGATGATCTCGTCGCTGCTCGATCGATCGA
TCGATCG----CCTCTCGGATTTGTGACTGATTCGATCGATGCTACATAC
AGGTCGCGATCCTGCAAGCGCAGCTGATGCAGGCGAGGGCGCAGCTGGCG
TGCGGCATCCAGAGCAGCTCGCACTCTCCGGTGAGCTGGCCGGACAGCGG
CAGCATCAGCGCGCTACTCCGGCAGGACATGGCGAGAAGGCCGCCCGGCG
GCGCCCTCGACGACTGCTTCGGCGGCGGCGGCGCGCTGCTGCCGGAGCTC
ATGGCGGCCG
View all "STS046" genotypes
[ Download ]