grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "W1952" from the experiment "Genome-wide patterns of nucleotide polymorphism in domesticated rice".

E.g., Germplasm "IRGC9542", RA4969, Basmati 1, Marker/locus RM22.

Items 1 to 25 of 103.       of 5 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
Oryza rufipogon-RA4782 W1952     RA4782 STS070 AAAAACAGAAGTGTGGTTACATTTGGTGAGCTTAAGGGACTGAAAAGATA
CAGCTCAGTGTTCAAGGATACTGAAATTAACGACTTAATGGAAGCAGTAA
GTGGTCACTGTTATTGCAAAATACGATGCAAA-A-TGTACTGTAGCACAC
TTAAACCATATACATGGTATCTGTAGTATATAGACTGGATATTGTTTGTC
AACCTTTTGATCATGCTGCTTTTCAGAATTCTGTATTGTTTTGAATGTGT
GTGAAAAGTCGGGGCCAACACATTCATGTCAAAAGATTACTTAAACCATT
GGTTTAGTTGAAATGGAGTATGTCATGCATCTGTGATGAAATACTGTCTT
CATTGCAGAACTGTTTTATATATTTTAACCTTTTTGAGTACTACTTCAGG
CTGATGACACCACCTCCACCATCAACTGGGAAGAGTTTATTGCTGCAGCA
GTGTCTCTTAATAAAATAGAACGTGAGAAACACTTGATGGCAGCCTTTAC
ATAC
View all "STS070" genotypes
Oryza rufipogon-RA4782 W1952     RA4782 STS049 AAAAATTCCCCCCAGCCCCTCTTTTAAAAGCCTACCTTGAAGATTCAAAG
AAGATACCCTCAAATTCAGATAACCTGAGTACTAGCACTGGCCAATCTGG
GGTAAGTGAAATGGTTCTATATAATTATTTGAAGTCAATGCTGACCTCCT
AATATGAAGTCTCTACTCTGTAAGTGGTATGTCCACAGGGCATTCTGAAA
TATGTTGATCAGTGCTTCTTGGTGGTATCATACTACTGTACCCCTGATTG
CATGCTAGCAATGCATTTGATCCTTTTAGTCTCCAGAGGCAATTTCTTTC
AAGTGGTGCACTTGTTTCTTATACCAAATTAGAGGGTCTAATATTACTTC
TGTTGCAGAGCAATGCCAATAAGAAGGAGCAGTCTGCACTGCGGGCTGTT
ATAAAGTGTGTTGAGGACCACAAACTCGAAGCTGAGTTTCCATTGGAGGA
TCTCCGTGAGCGGCTG
View all "STS049" genotypes
Oryza rufipogon-RA4782 W1952     RA4782 STS099 AAAACTTTTACAGATCTCTTCGATTACTTCCCCTTGACAGCATTGGTGTG
TATTCAGCATTTTCATATGTATATGCCAACATCCTTCCCACATTATCTAG
TGAATCTGACAGAAGCTGTTCATTTGTTCTGTAGGTCGAGTCAGAAATAT
TTTGCCTGCATGGTGGATTATCGCCATCCATTGAGACACTTGATAACATA
CGTAACTTCGATCGTGTCCAAGAAGTTCCCCATGAAGGGCCCATGTGTGA
TCTTCTGTGGTCTGATCCAGACGATCGATGTGGTTGGGGTATTTCTCCTC
GAGGTGCTGGATACACCTTCGGGCAGGTAACATTTTATATAAGAAAAAGA
AT--CTCTATATTTAGCTRTGCACCTCATGTTCATCGACTTATCAATTCT
ATCATTTCAGGATATATCAGAGCAGTTCAACCATACCAATAATTTAAGAC
TTATTGCTAGAGCTCACCAGTT
View all "STS099" genotypes
Oryza rufipogon-RA4782 W1952     RA4782 STS061 AAAAGTGTGATGGATTTCTTCTGCCTAATGCAGGTTGGTTAACATCACGA
AGGAAAAATACTAACTGAAGAGATGTAATAGATTGGATTATTCAAACATA
ATGTCAGATGCGGCTTTAATACTGTTTCAGTTATCATTGATCTTACATTT
TTATCTGGATTTAACATCTGTAGGAAACAAAGGTTATACATGCCAGAAAT
GTAGCACTTCTAGAGATGGGGAAGAGTTACAAAAGATGGCTAGCGATGTA
CTACTATTATCTGACAAAGTCTCTTCCTTAGTTTCATCTGGAAGTATCCT
TTTTCACTATTACTAGATGCTATCTGAGGCAAATGTATATAATTGATTGC
ATCATATTGTTTTGTGATTTT--GTAAAATGCTACCTTAACTTTGGGCAG
TAGATAACAGTGAGGTAGGTTCTATGTACAAGACCATTGAAGAGCTAGAG
CGGAAGCTTTACCATCCTTTGT
View all "STS061" genotypes
Oryza rufipogon-RA4782 W1952     RA4782 STS120 AAACAAGTTGGTGTTTTGACAGGTCATTTAGATGGGATTACATTTATTGA
TAGCCGTGGAGATGGGCATTATTTTATTTCAAATTGCAAGGATCAAACTA
TTAAACTATGGGACATCAGGAAAATGTCGTCCACTGTGAAAGAGTAAATA
CAGCTCTTGCTTTTGCATGATTATTCCTCTAAACCAAACCACTTTTT--A
TGCTTGAATCTTAAACGCAACATATTGTAAGCAAGTAGGAAATGCTAAAA
TCAAAATCTGCCTTTGACTAGATCTGCTTGGCCTGATTTGTCCAAGATCT
TGTCTACATGCCTGACCCAAAGTCCAAAATATAAAATAGGCTAAAGTTAT
TCGACAGAAATACTATTTTTACTTGTAGTTTGTTTTTGCAGCTGCACACC
AAAAGCATATGAATGGGATTACAGATGGATGACATATCCCTCAGAAGCCC
GATATTTCAA
View all "STS120" genotypes
Oryza rufipogon-RA4782 W1952     RA4782 STS030 AAACATAAGTCTTCAACCCTCAGGATTGTTGGATATGTTCTTCTAGCTAT
TGTCCTGTTTATAGTTACAGTGCTGCTGGTAATATTTTGCCTGTCCAAGT
ACCAAGAGAGACAGTCAAGACGTGATTATACAACAAGTCAGGTGGGGAGG
GTTCATCAGAGGGTTGAAGAGCCGAAAGTTAAGCAAGCTTCAGTGCAGTC
AAGGAATGATGCCAAAAAAGGTCAACAATTAATTTATATATTCTGTAATA
TATTTCTGATTATATTTTATTTGTTTTATATCACAGCATATTGATGTTCT
ATTAACAGGATCAACAGAGGTTCCTGAACGGAGGCAGGTTCGTGAAATAA
ATTTGGCGGTACCAGGTATAGATGCTTGTAAATCTGATCTATCAGGTCTT
TTAGTACTGTAATACTATTCACATTTTTAAGTTCAGATGTATAAAATAAC
TATTCAATTGCTGGCAGCTGCTCT
View all "STS030" genotypes
Oryza rufipogon-RA4782 W1952     RA4782 STS007 AAAGATTTTCTGTCAGTTCCTGTGGCAGAAATGACTCATCTTCGGCCTTA
CAAAAATCAGGTGACAACCATGTTGCCTGCCAATCAGGACAACCACCTCT
GGCTGTGCATACTGAGCTCCAACATGACACTTCTATTGTAATATCCAGTG
GTGAAGAGAAGGTCCTTTTTGACCTTAATGTGCCAGCTGAAAGCATTGAC
ATGGAATCAACAATAACCAGTAATAGTTTTAGAGATAAGCTAGTGAAAAA
TGATGGAAGTGAAGAAACAGTAACCGATCATTCTTTCTCCAAGAGAAACG
GTGTGCATGCTGAAACTTCTATAGAAGAACGAACTGTTGGAGAACATCAT
ATATCAGTCAGCAAGGATGGAAACACCACATTTTTCCAAGAATCAATAAA
TAATGAAATTGATAAGGCGCAGTCTTCAGACCTTATAAGTGTTAGCAGCA
AACATTTGATTGCAGAAACTCCTCATGTTGACAATATTGTGTGTCCAGAA
CTGCGAGCATCTCCTGATGGA
View all "STS007" genotypes
Oryza rufipogon-RA4782 W1952     RA4782 STS012 AAAGGTTTCAAGTACAAAAGTCGAAGAGCTCCAAGTAGATGTGGCGTCTA
TGGATGTTGAAATCTCTGCGTTAATGAAGCTATTTAGAAAAATAACAGAA
AACGACCGAGCCCCTTACTCGAGGGAGAGAGCCGATGATTCATCTTTGGA
ATGTGAACCGGTTCAACTTGACGTAAGCTCATTTTTTCCTTGTTATAGTT
TCCTTTCGCTCTTCAACCCAAAGTACGTCATGTAGTTTTACCACCTCTTT
GATGAGCGATTGTTTTT-CCTCAATACAATTGGCTAAACGTCCTACTTGA
TATGGGCAGGATATGGTTGGTGACATCGACATGGAGAAGATGGAGCAGGA
AATGTCTGCATACGCTACAGCTCTCGCTGCCGCGAAAGACAATCCTACTG
A
View all "STS012" genotypes
Oryza rufipogon-RA4782 W1952     RA4782 STS040 AAGAACTAATGGAGAAGGTGTGCCCTTGATTCAACCTTTATATTAGACTA
GTTCTATGATATGCTTGCTTTATTGTCTATTTATGGATGATGAGTGTACT
TTAGCCGGCRTTAGTTAATGGATATCTTGTGATAACAGGAAATCTTGTTA
TGACAATCAACTGCTGATGGTGATATTGGTATCCTGTGGTATACATCTTT
AGATTGCTAGCCACATTGTGATTATGATCTAAATTAGAAAATTTGCTGCA
CAAAGTAGAATGATGATTTTGGACATAGTAATTTGTTAATTCTTTGCACC
AATACATCCATTGTTGATATGATGATATCTACTTCTGTTTCAGGAATGAT
TTGATGCCTTTGTATTTAGTGGCAAAGCTACCAACCACATGATTTAACTG
TTGTTTTTGGCATGTATTCAGACAGGATTTGACATGGATGATGTAGTAAG
GAAGTACATTCGATACACACTGAATGAAAAA
View all "STS040" genotypes
Oryza rufipogon-RA4782 W1952     RA4782 STS089 AAGCTGTGAAGGTGGTCGACATTGTGGACACCTTCCGTCTTCAGGTTGCT
CTCACTTCCATTACCTTGGCTCTTGTATATGATACTATCTGCACTTTATT
TTTGTGCTTAAATTCCATGTGTGTTTGGCAGGAGCAACCTCCTTTTGACA
AGAAGCAGTTTGTGACCTTCATGAAGCGCTACATCAAGAACCTCTCCGCC
AAGCTGGATGCGGAAAAGCAAGAGGAATTCAAGAAGAACATTGAGGGTGC
CACCAAGTACTTGCTTGGAAAGCTCAAGGACCTTCAGTTGTAAGTTCACT
A--ATTGCTTGCCACAGGTCCAGGAAATAGTAACATATGTGATGCCATGA
ACATGTCTCACCATTAGTGCCTACAAATTCCAGTTTAAATGATTTGCTAT
GTTCTATCACATTAAATTCTTGAAGCAAT---------------------
-------------------------AAGACTTGTATTCAAACCTGCTTCT
TATGCTGTCTCTTATGATCTGTTTCAGCTTTGT
View all "STS089" genotypes
Oryza rufipogon-RA4782 W1952     RA4782 STS078 AAGGTCAGGCATCTCTTCGGCGTGTGCTTGTTGGTTACTCATTTCGTGAC
TCAGAAGTTGGATATTGCCAGGTAGGCATAAAGCAATGCTTTTCAAATGT
AACTGTTTTATAGAGAAGCTCCATTACTAACACCATGCAATGCAGGGTTT
AAATTATGTAGCTGCATTGTTGTTGCTTGTTATGAAGACAGAGGAAGATG
CATTCTGGATGCTTGCTGTACTACTGGAAAATGTACTTGTCAATGATTGC
TATACTGATAATCTTTCTGGATGCCATGTCGAGCAGAGAGTTTTCAAAGA
CCTCCTAGCTAAAAAGTGCCCCAGGTATTTCCCCCCTGTTATGTTTATGG
CTTTTATGCTATGATTTTTCATCAGTCGCTGGCAATAACAAGCATTACCA
TT-ATAAGATGATTGTGAATCATTGGATTACCCAAATGATGCAGGATTGC
TGCTCATCTTGAAGCAATGGGGTTTGATGTTTCTCTTGTTGCCACAGAAT
GGTTCTTGTG
View all "STS078" genotypes
Oryza rufipogon-RA4782 W1952     RA4782 STS094 ACAAGTTGAGGGTGGAGATCGGGAATTTGCCCGAGGAGAAAATGGGGAAT
GTGCTACAGATTGTGCAGAAGAGGAATACCGATCCGGCGCTAATGGGAGA
GGTCGTTGAGCTTGATTTCGACGAAATGGATGTCGAGACGCTGTGGGAGC
TCGATCGATTTGTGGTCAATTGCAAGAAGGCGCTCAGCAAGAGCCGGAGG
ACTGTCGCGATGAACGGTGATGCTGTTGATGCGACTGCTATTGTTCCAAC
TGAGGACGATACCGTGCAGGTGAATGTGCATCATCAGCCTTCGGTGGTTG
AAATTGGGGACTCGGTATGGCAATGTTGCAATCCTTTGTTCTGTGTAATG
ACTAATGCTTGAATTGTGTTCTCATGTTTTGTTTATGTTGCACTTTTGCA
GGAGAATGACACGCCGGAGAAGAGGGTTTCAGAGGTTGATATGGTTGATG
AGTATGTTGATATTGGCGATGAGATGCC
View all "STS094" genotypes
Oryza rufipogon-RA4782 W1952     RA4782 STS096 ACCCCCTACTTCATCTGCTCCTCCAATGGTACACAATTCCTCAGTTTTGA
TTTAATATGCTCATATTTTGATTTTTCAATATGTGACCCAAGTGAGATGT
TATCATCAACTGAATATGGCAGTTTTGTCTGCACAATAATTCTCACCCAT
GTTCTTGATTGCACTGGATTTTCTGCTTTCTTAGCTTAAATGAAACCTTG
TCTCATGTGCTTTTACATATTCCATTTTCATAACCATAAGTGCAATCTAT
AATTTCAAATTATAGGTGCAAATATAATTTAGAGTAGCTCCCGGTGCTAA
CATGGGCATATTTGCAACATTCTGTTGATCTTATGG----AAT----ATG
AATAGCTTGAATTGAATATTGTGTTCTGTTCTCAGTATAGTGCAACCAGT
GTCCCTGTCAGTGAAGACAACAATGTTGTCCATAAGGCTGAGGATGTTGT
CAGCACCATGCTTGCTAAGGGGTTCACCCTGGGGAAAGATGCTGTTGGCA
AGGCAAAAGCTTTTGATGAGAAGC
View all "STS096" genotypes
Oryza rufipogon-RA4782 W1952     RA4782 STS122 ACGGCTTCATGAACTTCATGCACCGCGACGAGGAGGTCGACTACTTCCCA
TCCCGCTACGATCCTGCCAAGCACGCCCCCCGCTACCCCATCCCCTCCGC
CACCCTCACCGGCCGCCGCGAGAAGGTAATTCTGTTGATTGATTTGCGTT
TGGGTTTTACATTTCACTATATTTTCTTTCTTAATTACTACTTCCCCCGT
TTCAGATTATAAGATGTTTTAATTTTAGTCAATCTCAAACTATAAGTTTA
ACTAAGTTTATAGATAAATATAGTAATAATTACAACACCAAATTAGTTTC
ATTAAATCATTAAATCTATAGTTCAATATATTTATTATGGGTTAAAAATG
TTACTATTTTTTATATAAACTTAGTCAAATTTAAAACAGTTTAATTTTGA
CCAAAGTTAAAACGATTTATAATCTAAAACAGGAGAAGTAGTAATAGCTA
GTCAATTTATTAACTGGTTTTGATCGATCGGGTTGC-GAGTGCAGGTGGT
GAT
View all "STS122" genotypes
Oryza rufipogon-RA4782 W1952     RA4782 STS125 ACGGTGGCGATATTTGGTCTAGGAGCTGTAGGCCTTGCTGTGAGTGTCTG
AACTCACCTTGAATGTTCTCAATTACAATGAGAGATCCATCTAATTACTC
TACATATTGTCTGATTAGGCCGCAGAAGGTGCAAGGATTGCAGGAGCGTC
AAGGATCATTGGCATTGACCTGAACGCCAACAGATTTGAAGAAGGTAAAA
TCCTCTTGATTTACCAGATCATCAGTTTGTTTGATGGTCTTTTAAAGTCA
TCTTATATATTTTGTATATCTTCAGCTAGGAAATTTGGTTGCACTGAATT
TGTGAACCCAAAGGACCATGACAAGCCAGTTCAGCAGGTATGTATGTTCC
CTTACATCAGGAAAAGGAAAATCTGTATCACTTGATTGTACTGATACAGT
GTGTTATGGTAATTTAGGTACTTGCTGAGATGACCAATGGCGGAGTTGAC
CGCAG
View all "STS125" genotypes
Oryza rufipogon-RA4782 W1952     RA4782 STS075 ACTCACATCTACTCAAGGTAGAGTACTCAATTTCTCATTGCTTTCACAGT
GATTTCACTGCTACTAGTGCCATGATCAGGCATTGCAATTTGCAAACCAC
ATTGGAGCTCCTGTAGATTAAATCTACTACTGGTAGTAGCTCATTGCCAT
TTGGTATTTTGATCATGATCCACAGAGGAGGAAGTCTTCTTCTTTTTCTT
GCAAGCCAAGCTCAGCAGCAGCTGACAAGGGATCATATGAAGAGGACTCC
TACTTTGAAGCACCC---TCACACTGCATGGGCAGGCCGGCTCCTGATTC
CTCTCCTGACCCTCTTCTCTCCCAGTTCATCTGCTGCAGCCTCGCTCCTC
CGGTCGATTCGCCGCGCCGCAGCGAAGCCGATGCCGAGGGCCATGGTTCA
TCTTCCTCAGATGATCAAAAAAGGTAAGAATTGTGCAGTTGGTGCTGTTG
GAGCAGCCTGAAATTTGGTAACAATTGTGCTGAATCTGAACAATGCTGAC
TGATCCAAATGCAATCTTTGATGCTTGCAGGAGAG
View all "STS075" genotypes
Oryza rufipogon-RA4782 W1952     RA4782 STS035 AGAAGACCAAGGATGGCAAGCTCTTCGTCGATGTCCTCAAGGAGGGTGGT
GTCCTCCCGGGCATCAAGGTGGACAAGGGCACCATCGAGGTTGCCGGCAC
CGAGAAGGAGACCACCACCCAGGGCCATGATGACCTTGGCAAGAGATGCG
CCAAGTACTACGAGGCTGGTGCCCGCTTCGCCAAGTGGCGCGCCGTCCTC
AAGATCGGCCCCAACGAGCCGTCGCAGCTCGCCATTGATCTGAATGCGCA
GGGCCTCGCTCGCTACGCCATCATCTGCCAGGAGAACGGGCTGGTGCCGA
TCGTCGAGCCCGAGATCCTTGTTGATGGCCCTCACGACATCGACCGCTGC
GCCTACGTCTCGGAGGTGGTCCTCGCTGCGTGCTACAAGGCCCTCAACGA
GCACCATGTCCTCCTCGAGGGTACCCTCCTCAAGCCCAACATGGTCACCC
CAGGCTCTGACGCCAAGAAGGTGTCTCCCGA
View all "STS035" genotypes
Oryza rufipogon-RA4782 W1952     RA4782 STS043 AGATTATGGAGAGTGTGAAGATATGCATGGCGAAGGCACTTGACAAAGCT
GCAGCTGATGGTCATAATATGGATGTTGGACTGAAGGCCATTGGTATTAC
AAATCAGAGGGAAACCACTGTTATGTGGAGCAAATCCACAGGCCTTCCTC
TATACAATGCCATTGTATGGATGGATGCTCGCACAAGCCCCATTTGCAGG
TCTTCCCTTTGTCCATCATGTTT-GACATATCAGTGTTATATAGTGCAGT
TTTCTCATAATGTTTGACCTTTCAGGAGATTGGAAAGTGATCTTTCTGGT
GGTAGAACCCACTTTGTCRAGACATGTGGATTGCCAATCAGTACCTATTT
CAGTGCTTTGAAGGTGTTATGGTTGATCGAAAATGTGGATGCCGTCAAGA
ATGCAGTCCGAGCTGGTGATGCCTTATTTGGCACAATTGACACCTGGTTA
ATCTGGAACCTCACAGGAGGCATTGGCGGGACAGATCGTGATGGAAATAA
AGTATTTGGGCAC
View all "STS043" genotypes
Oryza rufipogon-RA4782 W1952     RA4782 STS062 AGCTGTTTTGCCTTTTGAAAAACTACGAGTTCTTCTCTTAGGTATTTTTT
GTGATCTGGCTTCCCTTATCTATTCCATAACAAAATATCGAATCTAAGAT
ATTTTCTGTAATATCTGGCTTCCGTTATCTATTTGGGAAAATTGATCATG
CGCCATGAAATGTTTTCCATAATATTTTCTGTTTAAGAACTGCCTTTAAT
TCAAGTAAGTTCAAAATGACTTGCTAATGATCACTTTCAAATGCCTCAGG
ATCTAACCAGATAGATGAGGTCCTTTCTGTGGATTCACTTAACCTCTTTC
CGAGTTTAACAGTAAGCAAGTTTCTTTCTAATGGTTTGTGTTTATTATTC
TGAAATTTAGTATTGATGTTCAATTCCTTTTCTATGAGGTTTGAACAGTT
AGAACTGCAAGATTTTGATACACTGCGATTCTTAGATTTACAAGAATGTT
ATGATGTACACCACACTGTATTTTTATTAGTTATGGCTTAGCACGCCAAT
ACTAATATCTACTTTTCTAAAGGATGTCAGGCTTT
View all "STS062" genotypes
Oryza rufipogon-RA4782 W1952     RA4782 STS117 AGGAAGAAGATCAGAGTCTTGGTACGTT---CATCAGAAGAATGCTATAG
AGAGAATGGAAGTGATTCAGCTTAGCTTACTGTTTTTGTGTTTGTTT-TG
TTCAGATGCTGACACTGTCAACGGAGAGGTTCATGAATATTCAGAGGGAG
GCCCCTGCGGAGTTCCAGCAGTATCTGGTCCAGGTCACCAAGTACCAGGC
TGCACAGAATTGCAAGGTAGTACGTACGTAAAATATAATTGAACTGGTCG
GTGTATGCAACTCAATCATGATGTCTT------------ACGACGGCGAT
GTCGGTCGTCGCAGACGTGGATCGTGGGGAAGTGGCTGTCGCCGAGGGAG
CAGCGGTGGGCGCCGGCGGGGACGCACTTCCACCAGTTCGTGGTGCCGCC
GATCATCGGGTTCCGGCGGGACTGCACGTACGGGAAGCTCGCCGCGATGA
GGCTGCCGGAGGACGTGGAGGGGCTGGGGACGTGCGAGTACACCATGGGC
CGCGGCGTCGTGCACGCGTGCCACGCCGGCGGCGTC
View all "STS117" genotypes
Oryza rufipogon-RA4782 W1952     RA4782 STS081 AGGGGATAACTATTGCACTAATGTGATGACCAAGGTCGATTATTTAGAGC
ATGATTCCATGGATGATCAGGCATTGTTTTTGCATGAAAAGAACTTATTT
GTTCCAGAAGGAAGGAGCTCAGACAATTATAATAATGATGCTGCATCAAG
CAATCCACTTATGTGTGATGGTGTTGGTGGAAAAGAATTGGATGATGACT
CCTCCAGTTCGAAGGTATGTGCTTTTGTCTAATTATTCCATTGACAAAGG
GATAATATTGATTCAACACCTTTTAAGTGTTTCTTTACTGAGTGTTTCCA
TGCTTAATGAAAGACAGAAAGCTAACCTTTTTCCCCTTGCAGGGTACACA
TACTGTAAAGTTTGATGGCCAGCTCACCAGCTCTAACGCAACTACTTCAT
CGAGTAAACCTGATCAGCTTTTCTGGATAAATGGCTACATTTGTTCCATT
TGTGGATTTGAACTACCTCCAGGTTTTGAGGAGGAGAGACAAGAACATTC
AGATTTCCACTTGGCTGAAA
View all "STS081" genotypes
Oryza rufipogon-RA4782 W1952     RA4782 STS042 AGGTGGATTCCAATGGTGAAATGGTGAGGACTTGTTGTGCAAACTGAGCC
TAGATTACTGCCATATACGTGTTCCTAAAACTTATGCATTGTGCTCTTAT
AATCACTGTGCTGATATGGTAGCATGTGTTGGTGTATAATT--CAATAAA
TGCTGTATAGCAACTAGCAATAGTCTTTTGATTATAATTTATCCCTATTG
GTTGGGTATAGCTGTGCATCTTTTACTATTAGAATTGTGAATTCGCAAAC
AACTTGTTAATACAGCTAATTGGTAGAATATATCTTGGAATTAGTTATAT
GTTGAGAAATCGAAAAGGAATATGAATATTTCCTGCTCAAAGTACAAACT
ACATACTTCAAAACTTTTAAGAAGTGGTCTTTCAGTTATGCCCAATTAAC
TAGGTGTCTCAACTGTTATTATGTGAAGGGGCAACAGGTTGATAAGTCAA
GAAGCGAAAGGTTAATCCAATTGCCTATTGTTCAGTCCATTTATGGTGCA
ATGAGTAATCAGGAATTGCTGGAAGCTCAAGAGCAAGAATCACAACTTGC
TTATCA
View all "STS042" genotypes
Oryza rufipogon-RA4782 W1952     RA4782 STS052 AGTACGACGCAACGGCCGCACCACAAGGTGCAGACTACCACAAGTGCAGA
GAAGAAGTAGTGAAGTTACTGAAGGTGAATGCGCCCTGCGAAACCAAGAA
CTGCAGCTTCAATGGCGTCTGGAACGGTGGTGGCGGAGCAGGGCAGGATG
ACCTCTACGTTGCGTCCGCCTTCTACTACATAGCCTCCCATGTACGTCGT
GATTACTTAATTAATTAGCCAACTAAATTATTTAACTTCTCAGGCATGCT
TCAGACTGGCTACTAGCTAACTAGTTATGTAAATATATACCCCTAAATAT
GTGCATTTAATTGTTTGTGTAATTATGTTACATATACAAATTAATACTTT
TACCTGATAATTTTATCTCCAATGCATACATTTTGATCGGACCGGGATAA
AGGTTGGGTTCATCGACAGCGATGCACCCAGTGCGAAGTCAACCCCTGCA
ACGTTTAAGGCTGTTGCAGAAAAGGTTTGTAAACTGAGTGTCAAAGAAGC
AAAAGTAGAATACCCC
View all "STS052" genotypes
Oryza rufipogon-RA4782 W1952     RA4782 STS044 AGTCGCTGGGAAACCCGGCGACGCTGTCGACGTGGTCCCTGGCGTCGGCG
GACTGCTGCGAGTGGGACCACGTCCGGTGCGACGAGGCCGGGCGCGTGAA
CAACGTCTTCATCGACGGCGCCAACGACGTCCGCGGCCAGATCCCGTCCG
CCGTGGCGGGGCTGACGGCGCTCATGTCGCTGTCGCTGTTCCGCCTCCCG
GGCCTCTCCGGCCCCATCCCGGCGTGCCTCACCGCGCTCTCCAACCTCCA
GTTCCTCACCATCTCCCACACCAACGTCTCCGGCGTCATCCCGGACTCGC
TCGCGCGGATCCGCAGCCTCGACTCCGTCGACCTCTCCCACAACAGCCTG
ACCGGCCCCATCCCGAACTCCTTCTCCGACCTCCCGAACCTCCGGTCGCT
TGACCTCCGCAGCAACAAGCTGACGGGTTGCATCCCGGCGGGGCTCGTGC
AGGGGCAGTTCAG
View all "STS044" genotypes
Oryza rufipogon-RA4782 W1952     RA4782 STS073 AGTTATTGTGGATTCCTCTGATCCAATAGGTGATTTGTTAATCATGTGTG
AGTTTTTGTGTTTGTCATTGATCTATATCATCAAAATAATCCTGCCTAAC
CACTTATCCAGGACCGGCTCAAGAGCTTTTCGAGAAGCCTTTCTTCCAGT
CAGTTGCCAGAGCTTTGCGTCCTGGTGGTGTTGTATGTACCCAGGCAGAG
AGCATATGGTTGCATATGCATATTATTGAAGATATTGTAGCTAATTGTCG
CCAAGTTTTTAAAGGCTCAGTGAATTATGCTTGGACAACAGTACCAACAT
ACCCTAGGTATGCTAACTGATTATTTACATGTGGCTGAATTGATATTTCC
TTAGTTCCTAAGCTAACCATGCTTCCAATGCAGTGGTGTTATT
View all "STS073" genotypes
[ Download ]