grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "W1961(-1)" from the experiment "Genome-wide patterns of nucleotide polymorphism in domesticated rice".

E.g., Germplasm "IRGC9542", RA4969, Basmati 1, Marker/locus RM22.

Items 1 to 25 of 103.       of 5 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
Oryza rufipogon-RA4790 W1961(-1)     RA4790 STS003 TTCTGGGAATAAAGAAGACAACACCAGCTATCGCATCAGCCATGCCAAAC
TTGAGCCCTGGACTCATCTTCATCATTGCGGCTTGTTTCAGGTATAGTAG
TAGCTGCTTATAGATGAAGCTGCAATTGATGACCTACCTAAGATATATAC
ATTTACCTGAATTATTACATATACTTAAGGTTGGAGAAGTTTGACAAGGG
ATGCAAGTACACAAGAGCCAAGATACTGGGAACGTTGGTGTGCTTGGTGG
GAGCTATGGCCATGAGCTTCTTGCAGAGTCCCGTTTCGTCTTCTCCACAA
CTCACAACAACTAGTTACTATGACTGGATCCTTGGTTGCTTCTACCTTTT
CCTGGCAGTAGTTGTTCTCTCTATCTACACGGTGCTCCAGGTAATCATCA
ATTACTACTAATTCACTCACTCTACATACATGCATG----TAGTTTCATT
GTTAGCTAGCTGCTCATGGATTACTGAAACTTGCAACAATATATACTCAT
GGTATTATTCAGGCAGCGACGTTGGTGAGCTTCCCTGC
View all "STS003" genotypes
Oryza rufipogon-RA4790 W1961(-1)     RA4790 STS001 CCNCNNAGGAGATGGTCGTCCTNTCCGGCGCCCNCACCGTCGGCCGCTCC
TTCTGCTCCTCCTTCCTCGCCCGCATCTGGAACAACACCACCCCCATCGT
ACGTACATAGCTNGCCGGCGACGGCGACGGCGAGCTCGATCGCCANNTGT
AAAANGNNCGGCCAGTCCAGCTTCGCCAACAAGTCGTTCACCGCCGAGGA
GATGGTCGTCCTCTCCGGCGCCCACACCGTCGGCCGCTCCTTCTGCTCCT
CCTTCCTCGCCCGCATCTGGAACAACACCACCCCCATCGTACGTACATAG
ATCGATCGCCGGCGACGGCGACGGCGACCTCGCG----------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
---------------------------GCCATT-GACCATTTCGCCATTG
ACGTACGGCTCACATG---GCGGCGGCCGGTGTGTTCGATCGTGTGCAGG
TGGACACGGGGCTGAGCCCGGGGTACGCGGCGCTGCTGAGGGCGCTGTGC
CCATCGAACGCG------TCGGCGACGGCGACGACGGCGATCGACGTGAG
CACGCCGGCGACGCTGGACAACAACTACTACAAGCTGCTGCCGCTCAACC
TGGGGCTCTTCTTCTCCGACAACCAGCTGCGGGTGAACGCGACGCTGGGC
GCGTCGGTGAGCAGCTTCGCGGCGAACGAGACGCTGTGGAAGGAGAAGTT
CGTCGCCGC
View all "STS001" genotypes
Oryza rufipogon-RA4790 W1961(-1)     RA4790 STS002 ATTTGCTAACCAACTCACTCAAGGTTACAACAAGAAACTGAAGAGGATGA
TCTACAAGCTGAACCAGGAGATGGGGCCTGAGAGTAGATTTGTTTACGCA
AACACGTACGAGATCGTGATGGAAATCATTCAGCAGTACCGTCAATACGG
TGAGCTTTCTTCCTTGCTGCAGCTACCTCTTGCGAAAACCACCTGCGAAT
GCTGTGCTGCAGTCTGCAGAGCATTAGAAAATGCAGAATATTTCAGTCTT
GCATTTGTCTTCAGGTTTTGAGAATGCGCTGGACCCATGCTGCGGAGGCA
GCTTCCCTCCATTTCTCTGCATCGGCATCGCTAACTCAACCTCCACCTTA
TGCAATGACCGGTCCAAGTACGTCTTCTGGGACGCGTTCCACCCGACCGA
AGCCGTCAACTTCATCGTCGCCGGCAAGCTTCTCGACGGCAACTCCGCCG
TTGCTTCTC
View all "STS002" genotypes
Oryza rufipogon-RA4790 W1961(-1)     RA4790 STS004 TTATATAGGTATGTAGCAAAAAGAAGCAAAAAATAATAGACTACTTTTAT
CACTTATRTGTTAATGTAAATTCTATTTAATAAAATGGCATGTTTTTTGT
TTTTGGAAAACATGCGAAYCTCTTGTTGTTTAAACAGTTGTGAAGTCTTA
TCAGTACACATCTTTGACAAGCGTGATGCTCTTGGATTGCTGGTCAATTC
CTTGTGTGATTATTCTTACATGGATATTTTTGAAGACCAAGTATGGGCTC
AGGAAGTTCATCGGTGTTGGAGTTTGCGTGGCCGGACTTATATTAGTAGT
ATTTTCAGATGTCCATGCCTCTGATCGAGCTAGTAAGGACATAACTTCTC
ATGATGCAATTTGTACTAGTTACAGCAATACATACTTTTTATGTTTTTCT
TTTCACAAATTCTGATCAGTGATCAGAATATAAGTACAGTTTCTGAAATG
TATTGCAGAAGGAC
View all "STS004" genotypes
Oryza rufipogon-RA4790 W1961(-1)     RA4790 STS005 TCCTCAGTTCCTCCAAGTCCTCCTTACAGAGTAACTGGCATGTATGGAAC
ACCTAGATATCCTGCAGAGAAATCGGTGCTATTGAAAAAGAATAATGTGA
TTCATCGGCAAGGCGTCGGTCGATCCGAAGGCGACGCAAACATGAACCAC
ACCGGCAAAGGAACTGTGGATAAGTGGCTTCAAATGCTCATGGAGGATCA
GCAGCAGCAAGAAGATCCTGCAGCAGCATATCATTCTTCTGAAGATCACA
ACACTGCTGATGAAATCGCTTCAGACGAGCACCAAATGCAAAGCAGAATT
GATGATGAGAGCTGCAGGAATGAGATCACCGAATGCTCCGATGAGATCGT
CGAGGTCGGTGGCGATGGTGCTACTGAGCAGCAGGACAGGTGCAGGAACA
GCTTTGAGATCAAGGAGAGGGGAGAGGAGAAGAAGATCTGGTTCCCAAGG
TCTGACAGCTCCAGGGGTTTCAGGTCTCTG
View all "STS005" genotypes
Oryza rufipogon-RA4790 W1961(-1)     RA4790 STS007 AAAGATTTTCTGTCAGTTCCTGTGGCAGAAATGACTCATCTTCGGCCTTA
CAAAAATCAGGTGACAACCATGTTGCCTGCCAATCAGGACAACCACCTCT
GGCTGTGCATACTGAGCTCCAACATGACACTTCTATTGTAATATCCAGTG
GTGAAGAGAAGGTCCTTTTTGACCTTAATGTGCCAGCTGAAAGCATTGAC
ATGGAATCAACAATAACCAGTAATAGTTTTAGAGATAAGCTAGTGAAAAA
TGATGGAAGTGAAGAAACAGTAACCGATCATTCTTTCTCCAAGAGAAACG
GTGTGCATGCTGAAACTTCTATAGAAGAACGAACTGTTGGAGAACATCAT
ATATCAGTCAGCAAGGATGGAAACACCACATTTTTCCAAGAATCAATAAA
TAATGAAATTGATAAGGCGCAGTCTTCAGACCTTATAAGTGTTAGCAGCA
AACATTTGATTGCAGAAACTCCTCATGTTGACAATATTGTGTGTCCAGAA
CTGCGAGCATCTCCTGATGGA
View all "STS007" genotypes
Oryza rufipogon-RA4790 W1961(-1)     RA4790 STS006 CCCCACCTGCCCCTGTTCTTGGAGAGCCGATGGACCTGATGACTGCTCTG
CAGCTTGTGATGAAGAAGTCAAGCGCTCATGATGGGCTCGTGAAGGGGCT
CCGTGAGGCGGCCAAGGCCATTGAGAAGCATGCCGCTCAGCTTTGCGTGC
TTGCTGAGGACTGTGACCAGCCTGATTATGTCAAGTTGGTCAAGGCACTC
TGCGCTGAGCACAGTGTTCACCTCGTTACCGTGCCTAGTGCTAAAACTCT
TGGCGAGTGGGCAGGGGTGAGATACATTACTCTTCTATTAGCTGTACCTT
GTCAATTGTTATACTGTGTTAATCTGATGTCTAGGCTGCCGGATAAGATT
TTTTGATTTAGCCTTCTGCTAATGACTACAGTTTTAGCAGCTCAATGTAA
AATGTGCTATTTAATTTTGTAATCCTTTATCTAAATTTTAATTTCATTTT
GTTGTTGATATTGTTCTGCATCTCTCCTTTCTGCATATCTTCTGATT---
----------------------------TAACAATATCACAACAAACGTT
GTTTGCAGCTTT
View all "STS006" genotypes
Oryza rufipogon-RA4790 W1961(-1)     RA4790 STS008 TTAAGCGGGCAATTGCAACGAGCATTTGTCACAGGTACACGCTTCCTCTA
CATGTATATTTTGTGTGTCTTATATCTAGTATTTCAGTTACACCTTACAC
CATGACCCATCAATCTTTTATCCCAGGTGTACCTTCATTGAAACGGTCTG
AGCTGGAAGCAGCATGTGAGGATTTCAGCAATATAATTGGTTCTACATCT
AGTTGCATGTTGTACAAGGGAACTTTATCAAGTGGAGTTGAAATAGCAGT
TTTGACAAGTTCAACAGAATCCGGGAAGGAATGGTCAAAAGAATGCGAGT
CACAGTACAGAAAAAAGGTAACATGTGCTCATAACTTTTAGGATATCCCC
TAAAATACAAATATGTTTTCTGTGGTGCAAATGACTTTTCTCAGAAATGT
GCGTATGCTTTTTCTCATCTTTACTGTGCGAATGGCTGAAATGGTTATGA
TTTCAGATCACAAATTTATCCAAAGTTAGCCATAAGAACTTTATGAATCT
GCTCGGCTATTGTGAAGAAGAG
View all "STS008" genotypes
Oryza rufipogon-RA4790 W1961(-1)     RA4790 STS009 GGTTGTTGACTATTCCTTTGGAGGTTATAGCTACATTAAGTGTGAGGCAG
TCCTAGAAGAGAACAAAATATGTGGGCATATTGGGCACCTTGATTGTGCT
CTCCGTACTTTTATGGCTGGAACAGTTGGAGGATGTATTGACTTGGACAT
GCAGTATTGTTGCAGACGTTGTGATAACAAAACGAACTTGATGCTGCACG
TAGAAAAATTCTTGGAAATATGCCAATCTCTTCAATCAAGGGATGACATT
GAACCTATCCTGAATACTGGCTTATGCCTAGTGCGTGGTTCAAGACAAAC
AAGAGCAAAAAGCTTGGAGAGCATTATGAGATCAGCAATGGCAAAGGTAT
GGTCAGTTTTATTTTTTT-AGCCACTTGTGGAAACTTCCATTTTGGTCAC
CATTTATCTTCTTTTTGATCTCTTATAAGTAGTTTGTGGCTATGCACTGA
TGGTTTACAACTATATGCAGCTAAAGTGTGGGGTTGATCTTGCTGAAGTT
View all "STS009" genotypes
Oryza rufipogon-RA4790 W1961(-1)     RA4790 STS010 CACCAAGGTGAGCGTTGGTTGCTTAGCTAATGATATTAGCTTCCTTAATG
-----GCGTTGTTTAGATTGTATTAACGTTTAACTAATCACGCAATGTGT
TCATGGATGGATGCAGGTGAAGATCCTGAGGAGGGAGTCCTACTGGTACA
ACGGCACTGGCTCCGTCGTCACCGTTGATCAGGTACGTACA---------
--------------------AATCTCATAGCCTTCACATGAATCAGTTCA
ATTCTCCTAGTACTCCAATCGATAATCAAAAGGAAGAAATACTTTTAAGC
AATGAATAATAATCAATTAATGGTTGAATTGAATTGACTGGATGCAGGAT
CCCAACACTCGCTACCCGGTGGTGGTTCGGTTCGCCAAGGTGAACTACGC
CGGCGTGTCGACCAACAACTACGCC
View all "STS010" genotypes
Oryza rufipogon-RA4790 W1961(-1)     RA4790 STS011 GACTTCAGTTTATCACCTTTGCTAGCAGCACAATCAATGACAAAATATAA
CTCAGCTGCACCAACTACTACTGGACCAGCAATCTCCATGCAAGAGGTAA
TTTAACTACGCTGGTTCACTTTCTCATGGTGTTTTCTCTGGATTCATATT
TCATAGAAGTATAACTTTAGGAAGAAAAAGGCTCCACATCCTTTCTTTAT
TTGAAAGATGAATTTACAAGGGTGTGATGGTGTTGGAATTTTTTATTTTG
TGTGCATATACAGTTAATCATTCAGCAACAAGTAATCTCTAGTTCTCTAA
TTTTCTTCACACACATGTACATATTTGTTTCAGACTCTGAAGCCAGGAGT
TTTCTCCAACGCTCAATCTACCCAAAATCTTCCAAGTACTAGTATAGCAA
CGGGGCCTCCTCTCCCTCAGCAATTAGTCCACCCTTACTCTCAGCCTACT
GTACCACTGGCGCCTTTTGCGAATATGATTGGTTATCCGTATTTGGCACA
GAACTACCCTGCTGCTTACCTACCATCAG
View all "STS011" genotypes
Oryza rufipogon-RA4790 W1961(-1)     RA4790 STS012 AAAGGTTTCAAGTACAAAAGTCGAAGAGCTCCAAGTAGATGTGGCGTCTA
TGGATGTTGAAATCTCTGCGTTAATGAAGCTATTTAGAAAAATAACAGAA
AACGACCGAGCCCCTTACTCGAGGGAGAGAGCCGATGATTCATCTTTGGA
ATGTGAACCGGTTCAACTTGACGTAAGCTCATTTTTTCCTTGTTATAGTT
TCCTTTCGCTCTTCAACCCAAAGTACGTCATGTAGTTTTACCACCTCTTT
GATGAGCGATTGTTTTT-CCTCAATACAATTGGCTAAACGTCCTACTTGA
TATGGGCAGGATATGGTTGGTGACATCGACATGGAGAAGATGGAGCAGGA
AATGTCTGCATACGCTACAGCTCTCGCTGCCGCGAAAGACAATCCTACTG
A
View all "STS012" genotypes
Oryza rufipogon-RA4790 W1961(-1)     RA4790 STS014 CCGGAGGAGGACGAGAAGCTGTTCAACCACATCAGCCGCTATGGCGTCGG
CTGCTGGAGCTCCGTCCCAAAGCTCGCCGGTACGCCCATCGATCAGTGTA
TGCATTAGTAACCAAAAT----GGCAAACTGACAAGCTAAGCTAAACTTG
GGTTAATTA--ATCACTTCTTTTCTCCTGAATAATAATGCTAATTGCTTA
CATCAATGTGTTTATAGTATTTCAGTTTATTATTTCATCAATTTCTGTCC
TGCTGCATAATGCTCACT------ATAGAAATGTGTTTATATC-------
----------------------------------------GTAATTTAGT
TGCTATACCTCTCTCTTTGTATCTC------ACTCTCTGACAGTGTGTGA
ATAATATAATGTGTGTTGCTGAGTTGCTGTGTACAGGATTGGAGAGGTGT
GGCAAGAGTTGCAGGCTGAGATGGATCAACTACCTGAGGCCTGATCTCAA
GAGAGGCAGCTTCTCCCAGCAGGAGGAGGAGCTCATCATCAG
View all "STS014" genotypes
Oryza rufipogon-RA4790 W1961(-1)     RA4790 STS015 TTATAATGCCAGACGGCCTATGAAACAAAGGTACTTTTTCTTATGAGGCC
CGAAAGTTTTAGTTTATAGTTAGCTATATGATCCACCTTTGTTAATGCAG
TACAATGCAACATACATGTTCTATATTTTGCAGGTATCACTACAACGTTG
CAGATTCAAGGCTTGTACAACACATTGACAAAGGGAATGAAGATGGTCTG
TTTATCAGTTGCATAACATCTTGCACAAATCTGTGGGCTCTAATCATGGA
TGCTGGCACTGGGTTCACTTCCCAGGTTTATGAACTTTCACCACATTTTC
TTCACAAGGTGAGTAGCTTGCTCCTTGTTTAACTGGTGGAAAATCTTAGC
AAACTAATCACATAACTTTTCAAGGCAAAGTTACATATAAGGAAGCTCTT
GTATACATTGTCAAATGTGATTCCATGGTTTTCTGGTCATT
View all "STS015" genotypes
Oryza rufipogon-RA4790 W1961(-1)     RA4790 STS016 GAGCGGAGTTACCATCAATGGGAAGCGAGCGGTCGTGGTTGGCCGCAGCA
ACATTGTCGGGCTACCTGTATCCCTGCTTCTTCTGAAGGCGGATGCGACC
GTATCCATTGTTCACTCCCGGACCCCAAACCCTGAAAGTATTGTCCGTGA
AGCAGACATTGTCATTGCAGCGGCTGGCCAGGCTATGATGGTACATTGTT
CTACCACCAAATTATGACATGGTTCATCACAAT--------CCA----CT
GCCCAGTTCTAACTGCAGATTTCTTGGTTGCCAGATCAAAGGAGACTGGA
TCAAACCAGGCGCTGCTGTCATCGACGTTGGGACGAACTCCATCAGTGAC
CCAACCAGGAAATCGGGGTACAGACTCGTCGGCGATGTGGATTTCGCAGA
GGTGAGCAAGGTTGCTGGTCACCTGACTCCAGTCCCAGGTGGCGTTGGCC
CCATGACGGTGGCGATGTTGCTGAAGAACACGG
View all "STS016" genotypes
Oryza rufipogon-RA4790 W1961(-1)     RA4790 STS017 CATTTCTTTCTGCTAAACTTTGCAAGACTCGTCCCCTGGTAGTAGCAGCA
GCTATGGAGGTCTCGAAGGAAGCCCCTTCTGCTGACTTTGCCAATCGCCA
GCCTTCCAAAGGTTGTTGCTGAGAACTCCATCTTATTAAATTGATTGATA
TGCCTCTGCGGGTTGCACTGTCTCCAGTTCTAAATTTAATATAACTTTTG
TCCTTGCATGATTCTGTTAGGGGTTCTTGAGACATGGTGCAATGCCGATG
CAGTGTGTTTTGATGTTGATAGCACGGTCTGCTTGGATGAGGGTATTGAT
GAACTCGCTGATTTCTGTGGGGCTGGGAAGGCTGTTGCTGAGTGGACTGC
AAAGTAAATAACATGTTATGAACATTAGTTTTGAAGTGTGTTTGTTGCTT
AGTGCATAAAATTCATTCAGGATGCTCATTGGTTTAATATTCTTAGGGCA
ATGACAGGAAC
View all "STS017" genotypes
Oryza rufipogon-RA4790 W1961(-1)     RA4790 STS018 GTGTATTTTGCTCATTGCACGTCAGAGATGATATTCATTACTCATTTGCT
CACAGAACAACCTGAGAAACTTGCTGGCCCTCTGCTGGCTGATACTTATG
TTACTCTCCTGAAAGGTCGCAATGCGTGGTATGGGCAAATGCTAGCGAAG
GGAGAACTGAGCCCTGACATGGGCGACAGCATCAAGGGGAAGGGGATGAT
TCAGGTTATCTCATAAAACTACTCATTATTTTCCCCGAAAGTTATATGAA
TTTTGAGCGTATTTTTGAAGAATGCTGGAAGTCAAAACTTGCAAAAGATA
TCACATCATCCTGGATATAACCTGTTCACTTTTCACTCTACAGGGTATCT
CTGCTGTTGGTGCATTTTTTGAGCTTCTCAGTCAACCCAGCTTAAGTGTG
CAACACCCAGAGGAAAATAAGCAAGTTGCAC
View all "STS018" genotypes
Oryza rufipogon-RA4790 W1961(-1)     RA4790 STS019 TAGCAAATCATTCCAGTTGGGTATCAGCTTTGCTGGTGGTTACATTGCCG
GTGTCTTCTGTGCTATTGTTTCTCACCCGGCAGATAATCTAGTCTCTTTC
CTGAACAATGCCAAGGGTGCTACAGTGGGTGATGTGAGTTTATTACTTAT
TACAATGCTCTGGTATTAATGCATTGTGGTGCTTTGCTTTTGAAGTTTTG
TTGATGAGCAACTGATTACAGTTATGTATTTCTGTAGGCTGTTAAGAAGC
TTGGTCTCTGGGGTCTATTCACTCGTGGACTGCCCCTACGTATTGTCATG
ATCGGTACCCTTACTGGAGCTCAATGGGGAATTTATGATGCATTCAAAGT
CATGGTTGGATTGTAAGTATCTTTCTTTATTATTACTGTCATTAGAACAG
CGTCATTATCTTTCGATTGAATCAGTAAATTGAGAATTCACTTTATAATT
TAACAGGCCAACTACCGGTGGTGTTACGCCAGCACCAGCCACTTC
View all "STS019" genotypes
Oryza rufipogon-RA4790 W1961(-1)     RA4790 STS021 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNTTGCATTTTTCTTTTAGATAAAATGATTGGTATACATTCATTATCTCT
GCACACAACTAGTGAAATTTATAATAGGTTTACTAGTAGTATTATGTTAT
TTTGAAACTTTTCTTGCAGATTCAGCTTGGTCTTATAGAGTATGTAACGG
AAGTTTCTGGGACAATCGGACCATTTGATAGGGCACCCGCTGGTGTTATT
ACATCGCTTATGTTTATCACTAATAAGGGAAGCTACGGACCTTTTGGAGA
AGTAAGAGGAACTCCTTTCCACATCCCAGTGCAGGACAATGGCAGCATTG
TTGGCTTTTTTGCACGTNN
View all "STS021" genotypes
Oryza rufipogon-RA4790 W1961(-1)     RA4790 STS022 TGTTGGATCATTATTACAAGAGTGCTGTTTGGCACTGAATAAATTGCATC
CCTAGTTGAACATAAGAGTCAATCTTTGCTTTTCCTCCAGTTAAGCGAGC
TAAGAAGTACGTATATCATACCTGAGCCTGCCTTTTCTTTGCTCTTATGA
AGCTTGCTGGAAAAAACTCACACCATATTATTGAGGCAACTTTCAAAGCA
TTTGCTAGAGCCCTTCGACAAGCAACAGAATATGACTTGCGCCGACGCGG
CACTGTCCCCAGGTTCGTTTTAGCTTATTGCAAATAGCGTTTAGGAAATT
CTATGTTGTGCCCAACTACACTGTTGATGCCTGATTCAAAAACTTCACAC
CTGCTAAGCATATGGTTTATCTCTGACCTTTGCTGATATTGAAACATTAA
CGTATCTTTCTTGACTTGATCGCAGCTCAAAAGGTGTGTTGTCAAGGTCA
TAGTGTTGCAGGTTTGGAAAACAAGGGGTGCATGCTACTGTTCCTTGTAG
ATTGCAATATTCAAAGGAAACAAATGGAATGGCCTCTACAGCT
View all "STS022" genotypes
Oryza rufipogon-RA4790 W1961(-1)     RA4790 STS023 GAGCAACTCAGGGTATAGATAATCTGAAAACAAACCACTTGAATCCCATG
ATGAAAACCATTTCACACTTCGAGTTTACTGATGATCTGTTCACTTCTGC
AGAAAGAACATTTTGATATCAGGAAAGGTAAAGCGCCTGAAGATGCCATC
GACTGGAATGATTTCAAGTCCATGACCTTCACTCGAGCTGTAAGTTTGAT
GATGATAAACTCAGAAAGCAGCCACAGTAACAGTGTAGTCTGATCATGAT
GAACTCATGGGCACTTTTACTATGCAGGTTATCTTTGAGACATTAAGATT
AGCTACAGTTGTGAATGGGCTGCTGAGGAAAACTACCCAAGATGTTGAAA
TGAATGGTGAGATATGCATGATATATATGCTGCTGCAATTAGCATCTTTT
TGATAAATCTTTGGATAGCCCTAATGCAGTGCTTATTTGTTTCTTCCAGG
GTATGTTATCCCAAAAGGTTGGAGAATATATGTTTACACAAGGGAAATAA
ATTA
View all "STS023" genotypes
Oryza rufipogon-RA4790 W1961(-1)     RA4790 STS024 TTCTTTTATAAGGTAATTCTAATTTTGTCCTGAAATGCATTAATTATTTA
CTCTACTTGTATTGCTAGCTAGCTAGCTAACAACATCATCGTGCTCTTCT
TCTTAGCTTTTCTCAAATGGCATGAAAGAATCTGATCAGAGGCATGCTAC
TCTTAGAATAACTGCTTCAGGTAATTCTGTAGTTCATTGTTCATTGTTTG
GTTCTGTTTGACAAAAACTATAATTTCTGCACTATCCTATGACTGTCTGT
AACGTTTTTCTTTATATTGCTGATATGATCAGTTTTGGTGGAACTTAAAG
CTTATATCGATCTGATATTTAATAGTCCTGAATATTTATTCAAATTGATA
TTCTAGAATTCAATGTTGTGCATTTTCCTATATCATCTCTCAAGAATTAT
CAAGAAGTGTATGCTTCATTTGAAACTTTTCCAAATGAGAATAAGGGAGA
TTTTTCTGCTATTTGATTTTCTTGTAAACAGAT--AGCTTTTATCTGATC
ATTGTATGTCTATCTGAAACAGA
View all "STS024" genotypes
Oryza rufipogon-RA4790 W1961(-1)     RA4790 STS027 GTGAACACCGGTTTCCTTTCCTTGTTAAGGTACAAGGACCCAAGACTATG
ATACTAGTTGTAATTATTCTTTTCAAATTTCMTGTAAGGCTGTAACTGTT
ACAACCCTGGCAGGTTAACAATTGGAATAGGTTCAATTGCAACAGTGGAG
GAACTCTTGTTGAGAAGTGCTGCCATTTTTTTGATTTGATGAGATTGTTT
GCAGCTGCAAACCCTGTTCGTGTGATGGCTTCTGGAGCCATTGATGTCAA
CCACAAGGATGAAATTTATGATGGGAAGGTCAGGTTAATTGACTACAAGA
TCGCTGATTTATAAGCTGGATGGCATTTTCACTCATGTGATTATTTATAA
GCTTATAAAGGCTATATTTATAAGCTGCAGCGCATTTTTTGTGCTTATCG
GGTTATGGTGGTCTCAGTTTAAACAGCAGTCCCTGATTTTAACTTCTTTC
TCAATGCAGGTTCCAGATATTATAGACAATGCATATGTAATAGTAGAATT
TGATAATG
View all "STS027" genotypes
Oryza rufipogon-RA4790 W1961(-1)     RA4790 STS028 GTGAACACCGGTTTCCTTTCCTTGTTAAGGTACAAGGACCCAAGACTATG
ATACTAGTTGTAATTATTCTTTTCAAATTTCMTGTAAGGCTGTAACTGTT
ACAACCCTGGCAGGTTAACAATTGGAATAGGTTCAATTGCAACAGTGGAG
GAACTCTTGTTGAGAAGTGCTGCCATTTTTTTGATTTGATGAGATTGTTT
GCAGCTGCAAACCCTGTTCGTGTGATGGCTTCTGGAGCCATTGATGTCAA
CCACAAGGATGAAATTTATGATGGGAAGGTCAGGTTAATTGACTACAAGA
TCGCTGATTTATAAGCTGGATGGCATTTTCACTCATGTGATTATTTATAA
GCTTATAAAGGCTATATTTATAAGCTGCAGCGCATTTTTTGTGCTTATCG
GGTTATGGTGGTCTCAGTTTAAACAGCAGTCCCTGATTTTAACTTCTTTC
TCAATGCAGGTTCCAGATATTATAGACAATGCATATGTAATAGTAGAATT
TGATAATG
View all "STS028" genotypes
Oryza rufipogon-RA4790 W1961(-1)     RA4790 STS029 CCGGCGAGGGTGCCCCGGCGGCTGACCGCCGCCGAGCTCCTGCCGGTGAC
CCCGACTCCCCCCGCCGCCGAGAGGAGAACCACCCGGAAGCGCAAGTCCG
ACGTCGACTTCGAGGCGGAGTTCGAGCTTTTCGAG------------GAC
GACGACGACGACGATGAGTTCGAGCTTTCCGACGATGGCGACGAGAGTTT
GGCCGTGTCATGTGTGTCGTCCCCCAAGTCGAAGGCAGTACCTTCGTTTT
CTTGTACGATGAGATGGAGAAATCTTGCCTGCTTTCTTGAAGGATTTTCA
CCTGACGGCAACCTGAACTTTACACGATTTCTTCTCCTGCTGTTGATTTC
ATCGATCGCCGGCGGCAGTTTCGTCGGATGTCTCCTCGAGCTCCAGGCCG
CGGCGGCGCGTGGCGGCGGCGGCGGCCGGTCGTCGGAAGGCGAGCAAGAA
GAG---------CAAGTACAGGGGCGTCCGGCGCCGGCCGTCGGGGAGGT
TCGCGGC
View all "STS029" genotypes
[ Download ]