grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "W1963" from the experiment "Genome-wide patterns of nucleotide polymorphism in domesticated rice".

E.g., Germplasm "IRGC9542", RA4969, Basmati 1, Marker/locus RM22.

Items 26 to 50 of 100.       Previous | of 4 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
Oryza rufipogon-RA4792 W1963     RA4792 STS032 GGCCTCTGGTGTCCCCATCAAGTTGATGAGTGTGCAGAGTGATGATCTTC
TCACCAAGGTGCAGATACAAGATTTCAATTTCATGCATTACACATGGACA
CATAATCTCACACAAGATTCGACTTGGTTTGATTCTACATGGTTTTAATC
TTCACTCTCCATAATGTACAGATATCGAGAGTTGGAGACACCTCATCTGC
AACTGTCAATTCAGGGTTGTTGCCTGATCTGTCAAATGCAACCTTGGAGG
ATTACCAAGGCTATAACACTGAGGTGGTGAAGGCAGCCCGACTTTGGTAC
AGCTCCATAGGAGGAGAAATGCCACTGGAGATCACTCCTAAAGTAGGTGA
CACAAAACTAGGATTTGCAATCAGCCGTACTGAGGAGGTAAGCTTTCTGT
CGCCACTTCCAGAATATCGACAATATTATGCTTCATCAATTAAGAACAAA
AGAGTTATACATCAAACATTCCATGACACAATGTTTCTTTCAGGGTTTTA
TCTACATATCTTCAGTGTT
View all "STS032" genotypes
Oryza rufipogon-RA4792 W1963     RA4792 STS033 TATCTGAGAGGTTGGATGTGTGTGATTTTTGCTTTGTTTTCTGTTACATT
GTTCATGAATTAGGTCTAACTAGCTTTCATGTGGTATTTGGAATGTCAGG
TTTATGGGGATCAGAGCTGCCATGGTCACCAATTGCCCCCTTGTTAGTTC
TTTTGCAGCAAATCTTGGTTTTCATGTATCCGGGACTGAAGATTTAGTTG
CACAATCTGGATCTTCCGCTGCTTCTAAGGAGGCTGGAATTATTTCCCAG
GCGTTAAGTCTGCTTGGATTTTCAGAGGGGAATGTTCAGGAGACATCTGA
ATTTGATCTGGTGTTTCTGCATGTTGCCATGGAGAATACAAACAGCAAGT
TGGGAAAATTGGGAATGAAGACTGATCTAAATCGGCTTGATAAATTAGTT
GGTGCAATCATGGAAGCGGCGCCCATAAGTTCAGCTATCGCCTCCCGTAT
TCTTGTATCTGTGATGTTGA
View all "STS033" genotypes
Oryza rufipogon-RA4792 W1963     RA4792 STS034 ATGAGTACCACAGGTACAGACACGAACGCATTAAGCCCATTCATCTCATG
GCAATCCTCTGTAATGATCTGCTTAACATCTTCTGTTCATTTCTGACAGT
TTTGTCCATGGAAGACTGCCCTACGAGAACATCAAGCCGGACCCTGTCCT
GAAGCACATTCTCAAGAACCTGCGCATCCGCAAACTCGTGAGTTCCTCCA
GACCAGAATCGAAA-CC-AATCTCACATGTCTCATGTAATCGTGTTTTGG
TTCTGAACTGGCACGCGTCGTTGCAGATATTCACCAACGGCGACAAGGAC
CACGCCGTGAGAGCCCTCAAGAGGCTGGGGCTGGAGGACTGCTTCGAGGG
GATCATCTGCTTCGAGACCCTCAACCCGCCGTGCCCGTCGCCGCCGTGCG
ACGGGGAGGCCAGCATCTTCGACATCGCCGGACACTTCTCCATGCCCGGC
GCCGCCGCCGACGAGCTTCCCAGGACACCCGTCCTCTGCAAGCCCAACGT
CGACGCCATGGAGGAGGCCCTCAGGATCG
View all "STS034" genotypes
Oryza rufipogon-RA4792 W1963     RA4792 STS035 AGAAGACCAAGGATGGCAAGCCCTTCGTCGATGTCCTCAAGGAGGGTGGT
GTCCTCCCGGGCATCAAGGTGGACAAGGGCACCATCGAGGTTGCCGGCAC
CGAGAAGGAGACCACCACCCAGGGCCATGATGACCTTGGCAAGAGATGCG
CCAAGTACTACGAGGCTGGTGCCCGCTTCGCCAAGTGGCGCGCCGTCCTC
AAGATCGGCCCCAACGAGCCGTCGCAGCTCGCCATTGATCTGAATGCGCA
GGGCCTCGCTCGCTACGCCATCATCTGCCAGGAGAACGGGCTGGTGCCGA
TCGTCGAGCCCGAGATCCTTGTTGATGGCCCTCACGACATCGACCGCTGC
GCCTACGTCTCGGAGGTGGTCCTCGCTGCGTGCTACAAGGCCCTCAACGA
GCACCATGTCCTCCTCGAGGGTACCCTCCTCAAGCCCAACATGGTCACCC
CAGGCTCTGACGCCAAGAAGGTGTCTCCCGA
View all "STS035" genotypes
Oryza rufipogon-RA4792 W1963     RA4792 STS036 GGCCCCCACCGACAACCTCACCGTCCTCCGCCAAAAGTTCGCCGCCCTCA
ACCTCAACGACGTCGACCTCGTCGCCCTCTCAGGTACTCGTATCACTTCT
CCGGCGAACTCAATTTCA-----GTTCTGCCGTCATGCCCGCCGGAGCTG
ACGACGACGACAATAATGCGAAATGCAGGTGGGCACACGTTCGGGAGGGT
GCAGTGCCAGTTCGTGACGGACAGGCTGTACAACTTCAGCAACACGGGGA
GGCCGGACCCCACCATGGACGCCGCCTACCGGAGCTTCCTGTCGCAGCGG
TGCCCGCCCAACGGGCCGCCGGCGGCGCTCAACGACCTGGACCCGATGAC
GCCGGACACCTTCGACAACCACTACTACACCAACATCGAGGTCAACCGCG
GCTTCCTCCAGTCGGACCAGGAGCTCAAGTCGGCGCCGGAGGCGACCGGG
ACGACGGCGCCCATCGTCGACCGCTTCGCCACCAGCCAGGCCGCCTTCTT
CCGCAGCTTCGCGCAGTCCATGATCAACATGGGCAACCTCTC
View all "STS036" genotypes
Oryza rufipogon-RA4792 W1963     RA4792 STS037 CCCACGAATTCATGAAAAATTCCCAGGTTCAGAATCTATACTTTCATTAT
CTAAATTTAGAAACCAACTGCTGTATAAGACTATAAGATTCAACATAAAT
TGCATAATCTTTCTTGAAGGTTGTAAGGAATCATCCTGGTGACCAAAGTT
ACTGGCATCGCCATAGATCAAAGGGTTCTTGGACTCTTTCCTCTGCAGAC
AATGGGTGGGCTGTGTCTGACACTACAGCAGAAGCACTGAAGGTCATTAT
GTTCTTTGTTCTTTTCCTGGTTACTAATGTAGGCAAATGAGGTATAAAAC
TAGTGTCATATTAATCCAGTCCTARTCGGTGACAGCACATCGAAGAAGCT
CATGCATATAAAAAATATTGGCCTTGATATATTCCCAATTCTGCATAATT
TCTATTATGTCTACCCTAGAAATCTTACATAATTTCATTTCCAGGCTGTA
TTGTTGCTGACAAAGATATCTAGTAGCATGGTTGGGGATCCCATTGAAAG
AGAAAG
View all "STS037" genotypes
Oryza rufipogon-RA4792 W1963     RA4792 STS038 TCCAGCGCCTTTCAAGCCCCCATCCGGGGGTAGCACTAGTGATATCGTCG
AAGCTTCTGGCACAGCAAAACCTGGGGAAGTTGTTTCTGCCGCAGAGAGC
AATGTTGCTTCCAATGTGAACAGCACCATCTCTAGGCCTGTGCCCCCACG
GCCTTGGCAGCAGCAAGGATACGGAAATTCTTATGGAGGTAATCATTAAT
TCTGTAATCGCATAATCAGATACACTTAGTGGCTCAGAATCTTAACCTCT
CGATCAAAATGCAGGTTATGGCTCCAGTATGTATAGTTCGCTTGGTGGGT
TTGGTGGACCTTATAGTAGCGGCGGACTTTACGGAAATAACATGTATTCA
AGTTATGGAGGAGGTTATGGGGGTATGTATGGAAGTTCTGGAATGTACGG
TGGGTCCATGTATAATAGCGGGATGGGAGGTCCCTATGGTGGCTATGGTA
TGGGCATGGGTGCTTACAACCAAGGTCCAAATTCATTTGGGCCACCAGCA
CCACCCC
View all "STS038" genotypes
Oryza rufipogon-RA4792 W1963     RA4792 STS040 AAGAACTAATGGAGAAGGTGTGCCCTTGATTCAACCTTTATATTAGACTA
GTTCTATGATATGCTTGCTTTATTGTCTATTTATGGATGATGAGTGTACT
TTAGCCGGCGTTAGTTAATGGATATCTTGTGATAACAGGAAATCTTGTTA
TGACAATCAACTGCTGATGGTGATATTGGTATCCTGTGGTATACATCTTT
AGATTGCTAGCCACATTGTGATTATGATCTAAATTAGAAAATTTGCTGCA
CAAAGTAGAATGATGATTTTGGACATAGTAATTTGTTAATTCTTTGCACC
AATACATCCATTGTTGATATGATGATATCTACTTCTGTTTCAGGAATGAT
TTGATGCCTTTGTATTTAGTGGCAAAGCTACCAACCACATGATTTAACTG
TTGTTTTTGGCATGTATTCAGACAGGATTTGACATGGATGATGTAGTAAG
GAAGTACATTCGATACACACTGAATGAAAAA
View all "STS040" genotypes
Oryza rufipogon-RA4792 W1963     RA4792 STS042 AGGTGGATTCCAATGGTGAAATGGTGAGGACTTGTTGTGCAAACTGAGCC
TAGATTACTGCCATATACGTGTTCCTAAAACTTATGCATTGTGCTCTTAT
AATCACTGTGCTGATATGGTAGCATGTGTTGGTGTATAATT--CAATAAA
TGCTGTATAGCAACTAGCAATAGTCTTTTGATTATAATTTATCCCTATTG
GTTGGGTATAGCTGTGCATCTTTAACTATTAGAATTGTGAATTCGCAAAC
AACTTGTTAATACAGCTAATTGGTAGAATATATCTTGGAATTAGTTATAT
GTTGAGAAATCGAAAAGGAATATGAATATTTCCTGCTCAAAGTACAAACT
ACATACTTCAAAACTTTTAAGAAGTGGTCTTTCAGTTATGCCCAATTAAC
TAGGTGTCTCAACTGTTATTATGTGAAGGGGCAACAGGTTGATAAGTCAA
GATGCGAAAGGTTAATCCAATTGCCTATTGTTCAGTCCATTTATGGTGCA
ATGAGTAATCAGGAATTGCTGGAAGCTCAAGAGCAAGAATCACAACTTGC
TTATCA
View all "STS042" genotypes
Oryza rufipogon-RA4792 W1963     RA4792 STS043 AGATTATGGAGAGTGTGAAGATATGCATGGCGAAGGCACTTGACAAAGCT
GCAGCTGATGGTCATAATATGGATGTTGGACTGAAGGCCATTGGTATTAC
AAATCAGAGGGAAACCACTGTTATGTGGAGCAAATCCACAGGCCTTCCTC
TATACAATGCCATTGTATGGATGGATGCTCGCACAAGCCCCATTTGCAGG
TCTTCCCTTTGTCCATCATGTTT-GACATATCAGTGTTATATAGTGCAGT
TTTCTCATAATGTTTGACCTTTCAGGAGATTGGAAAGTGATCTTTCTGGT
GGTAGAACCCACTTTGTCAAGACATGTGGATTGCCAATCAGTACCTATTT
CAGTGCTTTGAAGGTGTTATGGTTGATCGAAAATGTGGATGCCGTCAAGA
ATGCAGTCCGAGCTGGTGATGCCTTATTTGGCACAATTGACACCTGGTTA
ATCTGGAACCTCACAGGAGGCATTGGCGGGACAGATCGTGATGGAAATAA
AGTATTTGGGCAC
View all "STS043" genotypes
Oryza rufipogon-RA4792 W1963     RA4792 STS044 AGTCGCTGGGAAACCCGGCGACGCTGTCGACGTGGTCCCTGGCGTCGGCG
GACTGCTGCGAGTGGGACCACGTCCGGTGCGACGAGGCCGGGCGCGTGAA
CAACGTCTTCATCGACGGCGCCAACGACGTCCGCGGCCAGATCCCGTCCG
CCGTGGCGGGGCTGACGGCGCTCATGTCGCTGTCGCTGTTCCGCCTCCCG
GGCCTCTCCGGCCCCATCCCGGCGTGCCTCACCGCGCTCTCCAACCTCCA
GTTCCTCACCATCTCCCACACCAACGTCTCCGGCGTCATCCCGGACTCGC
TCGCGCGGATCCGCAGCCTCGACTCCGTCGACCTCTCCCACAACAGCCTG
ACCGGCCCCATCCCGAACTCCTTCTCCGACCTCCCGAACCTCCGGTCGCT
TGACCTCCGCAGCAACAAGCTGACGGGTTGCATCCCGGCGGGGCTCGTGC
AGGGGCAGTTCAG
View all "STS044" genotypes
Oryza rufipogon-RA4792 W1963     RA4792 STS045 GCTTGTGGTCCTTACCTCTGTTAAGAGGCAGAACTCGGGTGGATGGGCCT
TTCTGCAGCCATTCACGATCAAGATGTGGACCGTCACTGGACTGTTCTTT
CTTATCATAGGGACAGTAGTTTGGATGCTTGAACATAGAATCAATGATGA
ATTCCGTGGCCCTCCTGCGAAACAGCTTATTACTGTGTTCTGGTAAGGCT
ATAATTTCGTCAGTTTGTATTTATCGC-GTGTACAATTCCTGCAAATATC
ATTCCATGTTTTCTGTCACCATTATCCAGATTCTTGGACGATGAACTGGT
TTTATTTGCCTGACACTTCATGTTCTACTTACTTTGCAGGTTCAGTTTCT
CAACTCTGTTTTTCGCACACAGTGAGTGAAACG-ACAGCTTGTCACATTC
TCGACATTTTCAATAACCATGATGGAATTTTCCAGCTCATAGGAGCTACT
CTTTCTTCTATGTTTATACAGGAGAGGACACCAGGAGCACTCTCGGCC
View all "STS045" genotypes
Oryza rufipogon-RA4792 W1963     RA4792 STS046 NNNNNNNNNNNNNNGGCGAGGTTCGCGGCGATCCACAAGGTGTTCGGCGC
CAGCAACGCCTCCAAGCTCCTCTCCCACCTCCCCGTCGCCGACCGCTGCG
AGGCCGTCGTCACCATCACCTACGAGGCCCAGGCCAGGCTCCGCGACCCC
GTCTATGGCTGCGTCGCCCAAATCTTCGCCCTCCAGCAGCAGGTACTATT
TCATTTCATGGATGAGAATGAGATGATCTCGTCGCTGCTCGATCGATCGA
TCGATCGATCGCCTCTCGGATTTGTGACTGATTCGTTCGATGCTACATAC
AGGTCGCGATCCTGCAAGCGCAGCTGATGCAGGCGAGGGCGCAGCTGGCG
TGCGGCATCCAGAGCAGCTCGCACTCTCCGGTGAGCTGGCCGGACAGCGG
CAGCATCAGCGCGCTACTCCGGCAGGACATGGCGAGAAGGCCGCCCGGCG
GCGCCCTCGACGACTGCTTCGGCGGCGGCGGCGCGCTGCTGCCGGAGCTC
ATGGCGGCCG
View all "STS046" genotypes
Oryza rufipogon-RA4792 W1963     RA4792 STS047 GACGCCGGGCTGTACATGATCCTGCGCATTGGGCCGTTCATCGCCGCAGA
ATGGACCTTCGGGTTTGCCTCTTCGTTATACTGATGCAGTGTCACGATTG
GTTGTAGTTGTGCAGAATTATGGTGATTCGATTTCTCTGGGTTGATGGGT
TTATCCGTTTATGTGTGCGTGGATGTACAGGGGCGTGCCGGTGTGGCTGC
ATTACGCGCCCGGGACGGTGTTCCGGACGAACAATGAGCCGTTCAAGGTG
TGGCGGGCTTGTGAATTTCGTGGCGTTTTATTTGGGGAGTTTGCAAGTTT
GGTGATGGTTATACTGACATTTACTTACGCAGTCTCACATGAAGAGATTC
ACGTCGTACATTGTGGATATGATGAAGAAAGAGCAATTCTTCGCTTCGCA
GGGTGGGCACATCATCCTAGCTCAGGTCTGGACATTGTCATACTAATCCT
AATTGGGGCGCTGAAACATCAATCTGTTTCTATCAACTTTGAGATAGGTG
TACTTCACAATTGACGGCAGAATTGGTGCACTGTAGGTTGAAAATGAATA
View all "STS047" genotypes
Oryza rufipogon-RA4792 W1963     RA4792 STS048 NNNNNNNNNNNNNNNNNNNNCCATGATTTTAGCCTATTTTTGGCTATTCC
TGGGTAAGGATCCCTCTCTAGTATTTCCTTTTCACAGCATGCACCCACAA
CATAAGTCAACTATGTGCTATCAACCTGAACATTACCATCTGGGCTGGCC
TGTTGTGTATTTTAGCAAAACCAAGCATGA---ATGCATGAATCGTATGC
TGTACTGCTGTGTAGGTGCAAAACTGGAAAGCACACAACTGAGAAACCAA
TCACAAAAGCAGTTCCTACTAAACCATCAAAGGCAGTTCCAGTCCAGACT
TCGAAGCAGAGTGTGGGAGCTGACACTTGCTCAAGGTGCCGTCAAGGTTT
CTTTTGCTCTGACCATGGTGAGTTTCTGTCTATAAGCATAATGCTTGGAT
ACAACTGATTGATCCCCTATTTGGGTGTAAC-------------------
-AGCTGATTGTTTCGTTATTATTTTAACGACTGACATCCCTATGCATTTT
TATGTGTTGATAGAATAAATCGTAACTTTTAATTTAACAGATTATGCACT
GCTATTT
View all "STS048" genotypes
Oryza rufipogon-RA4792 W1963     RA4792 STS049 NNNNNNNNNNNNNNGCCCCTCTTTTAAAAGCCTACCTTGAAGATTCAAAG
AAGATACCCTCAAATTCAGATAACCTGAGTACTAGCACTGGCCAATCTGG
GGTAAGTGAAATGGTTCTATATAATTATTTGAAGTCAATGCTGACCTCCT
AATATGAAGTCTCTACTCTGTAAGTGGTATGTCCACAGGGCATTCTGAAA
TATGTTGATCAGTGCTTCTTGGTGGTATCATACTACTGTACCCCTGATTG
CATGCTAGCAATGCATTTGATCCTTTTAGTCTCCAGAGGCAATTTCTTTC
AAGTGGTGCACTTGTTTCTTATACCAAATTAGAGGGTCTAATATTACTTC
TGTTGCAGAGCAATGCCAATAAGAAGGAGCAGTCTGCACTGCGGGCTGTT
ATAAAGTGTGTTGAGGACCACAAACTCGAAGCTGAGTTTCCATTGGAGGA
TCTCCGTGAGCGGCTG
View all "STS049" genotypes
Oryza rufipogon-RA4792 W1963     RA4792 STS050 TGGTAAGTTGAACATTATTCCATGGCAACCTATATTTGTTTCGATCCATA
GAGTTTGCTGATGAGAAAAGAGTCAATATTTGACCATCAATTTAAACTAG
ATAATGCTGGTAGATGGAAACATTCATGTTTGCAAGAACCACTGGGGAAT
GCACCAGAATGTTTTCTGTATTC--AG------TGTCATTTCTTAGTACT
GTTGCATCCTTTGCCTTATTAAATATTAT--GCAACTGATTGCCAATTAT
GTATCTTCTTTGTCCAATTCTCTGCCCTGTTATTTTGATAGATGAGTTTA
TTTTTTCTACTTTTTGGCTTCCTTTGTTTGTATGCCGCTTGGAATCTAAT
TATGTAAGCTGCTGATGATATTTCACATTACAGCAAAGTGCGATGTTCCA
ACTCAGGATAATAAGTGGCATTTCTTCGCTGCTCGTGACAGAAAGTATCC
TAACGGTTCTCGGTCAAATAGGGCAAC
View all "STS050" genotypes
Oryza rufipogon-RA4792 W1963     RA4792 STS051 CCTTTCTTGACAGATGCTTTGACAAAGTTTCAGGTAAAGCTTTCCATGAA
CAAAAATACAATCTGTTTATGGTTTCATTGATCAGAGGTAATGGAAATGT
TCTACAAATATTGTTACACACTATTGACCTGGGGTCAGGGGATATTTTAC
CATCTCCTTTATGGAGGACAACCGAACCTTACAATAAACAAAGAAAAGTG
TAACTGAAGAAGTTCATTTGTTTTACAATGTATTCTTCCATCATCTCAAT
TGAAATATGCTATGCTTGTTCTTGGATGAAAAGAGAAATGTCCATTAGCC
ATATGATAAGTTATTTGCTGCTTTTGGTTGGTGTCTGAACATATTATATG
CTTTCGACTTATTAAGACAACTGCTTTTGTTTGTGATTTTCTTCTTGTCC
TTGTTGGTCCAAACTGCCAGTACTTAAA-CACGCACTGCATCCTGCATGA
ATGTTTTCTTATGAGATAACTTGATTTCATTATTTTGTAGGACCCTGCAG
AGGCTGACAAGTTAATGAAAAT
View all "STS051" genotypes
Oryza rufipogon-RA4792 W1963     RA4792 STS052 AGTACGACGCAACGGCCGCACCACACGGTGCAGACTACCACAAGTGCAGA
GAAGAAGTAGTGAAGTTACTGAAGGTGAATGCGCCCTGCGAAACCAAGAA
CTGCAGCTTCAATGGCGTCTGGAACGGTGGTGGCGGAGCAGGGCAGGATG
ACCTCTACGTTGCGTCCGCCTTCTACTACATAGCCTCCCATGTACGTCGT
GATTACTTAATTAATTAGCCAACTAAATTATTTAACTTCTCAGGCATGCT
TCAGACTGGCTACTAGCTAACTAGTTATGTAAATATATACCCCTAAATAT
GTGCATTTAATTGTTTGTGTAATTATGTTACATATACAAATTAATACTTT
TACCTGATAATTTTATCTCCAATGCATACATTTTGATCGGACCGGGATAA
AGGTTGGGTTCATCAACAGCGATGCACCCAGTGCGAAGTCAACCCCTGCA
ACGTTTAAGGCTGTTGCAGAAAAGGTTTGTAAACTGAGTGTCAAAGAAGC
AAAAGTAGAATACCCC
View all "STS052" genotypes
Oryza rufipogon-RA4792 W1963     RA4792 STS053 CCGAGCGCATGAGGGATTGCTTAAGAAATCTTAAGCAGCAGAACAAGGTA
GCATGTAGTTTTAACTTGAAATCATCTTCTATGTTACTCATATTTGTCAG
GCAGATTGACACATATCCTTCATTGCAT----GTGAATACAGATGCAACT
GTAAAGACTTGAGAATTCTATTGTTTGTTGAAACTATACCAAAAATTGTG
TTCTCCCTGTAGTTTTAGAGTGGAATCATTCAATGCTGATATAATCATAT
TATATGTTTGGTATTCAATTTGACCCAATTATGGGCCGTTTTTGCAACAG
GATGACGATGCTAAAGTGAAGAGGGCTTTTCAAACACTCCTTACCTACAT
TGGCAATGTAGCTAAAAATCCTGACGAGGAGAAATTCAGGAAGATCAGAC
TGTCCAACGCTACATTTCAGGTGAAAATAATTACTGTACATATTGACCTG
GTAAAATGATCCGCTGTTATCCTTTCAAGAACAACACGCGACTGATAATC
TGTTTCGGTACAATGCAGGAGAGGGTTGG
View all "STS053" genotypes
Oryza rufipogon-RA4792 W1963     RA4792 STS054 TTTTGTTACATTTTCGGATCCATCTGTTATTGACAAGGTTCTGCAAGATG
AACACACTATAGATGGAAGAACAGTAAGCCTTCTATGTATCACTTCACCA
AAGTATGCAAAGCTTGCTGTAGAGTCTGTTCTCATTTGTCTGTCATACAT
TTTGATCTATCAAGGTTGAAGTTAAAAGGACTGTCCCGAGGGAGGAAATG
TCGTCGAAAGATGGTCCTAAAACGAGAAAAATCTTTGTTGGTGGTATTCC
ACCATCTCTTACTGAAGGTAGCCAGCAGAACTAAGTTGTTTCCTTTTTAC
AAGCAAAAATATATTTGTATTCTAGAAAACAATGGCTTGAATACTCTAAA
TAATGTTATGTCTTGATAAATATGATTGTCATGAAACTTCCAGATAAATT
GAAGGAGCATTTCTCTTCATATGGGAAGGTAGTTGAGCATCAGATAATGC
TTGACCATGGCACTGGGCGGTCACGAGGCTTTGGCTTTGTCACATTTGAA
AATGAGGACGCT
View all "STS054" genotypes
Oryza rufipogon-RA4792 W1963     RA4792 STS055 CGACATGGCACTGCATTTCTGTGAGCGTTACAAGTCAGTTCTTTGCATCT
TATGTGAATGGGCTTGATATGTTATATAATTCTCTCTTCTT-TTTTTT--
GCAACTTCTTATTTACATCTCAAAACTGAAAATATTATAAATACTCTACT
CAACTGAAATCCTCAGATGGAAGTTCTAATGTTGATGTTGAAAGGTGTCT
CAAAGTTGGGTCACTGTAATGATTATGATTAGGTTCTGTTTTACAGTAGT
ACTTACCATTCTATTTATTTGCAGGCTAATGGTTCTTAGAATCAGTTCAA
AATTTGAACTGAGAAGATTTTGCCGTACTACAGGGTCCATTGCACTTGTA
AGTTCTGATCTCAAGCTTTTGTTCAATTGCACAGTAGTATGTATATGCTG
ATGCATGTGCTCTTTCAAAAACAGTTGAAACTCAGCCGACCAAATGCGGA
TGAATTAGGA
View all "STS055" genotypes
Oryza rufipogon-RA4792 W1963     RA4792 STS056 CCATTATTATTGCTTCGTTCGAACTTCCAGTGGAATGTGGCACAACCTTG
ATGATAACCAGGTCTAGCATGATATTTGCCATTACGTGAAGCTTTACTGT
TTCATTTTTAGTTGATAGTTGATAGTCATATCACAACCTTCCATTAGCTG
CTTAATTGGCTATTTTATTTTAATCTTGCGCTTGGCCATATGTATGTGAG
GGAGTACAGTGACTCTAGTGCATGGTGGATGCTACTTTATTCCTCTCGCT
AATTCAGCAGACTTTAGCTTCCCTTGTACTGATCCTTGTGGACAACTTCA
GGTACGCCAAGTCCGTGAGGCAGATGTATTGAGACAGAAAGCATATATGT
TATTTTATGTACGTGACAGAGTTGGGAATCCGACTCCACGCAAGGATAAT
ATCACTGCTAATATGCCAGCCAAGAGAACAATACCTGAAAAGATCTCAGG
TCTGAGTGATATGATCCAGAGCGGCGTAATTGAAGCAAAATTGAACGGTT
CCT
View all "STS056" genotypes
Oryza rufipogon-RA4792 W1963     RA4792 STS057 CCACTGAGCTACAGGGGAGCGGATATATTTGTGCTGGCATTCTCACTGAT
CAGCAGAGCAAGCTATGAGAATGTTCTCAAGAAGGTAGGTACTATACTCC
ATTTAGTTCAGTTTGGACTCAAAATGTCTGAACATCTGACAACATGAGGA
TAGTGACCACAGATACTGTACCAAGAACTTTACCTTTCCTTCTGACAATG
ACATTTTTAGACCACCTTTGACCAATATTCTTCACATTTTTCTTCTTTAC
AGATATATACTATATGTGCATATGATTTTCACTGGAATATTCTGAGCTAA
TGTTATCTTTTTCTGTTTCTGATCATGCAGTGGATGCCGGAGCTTCGCCG
GTTCGCACCGAATGTTCCAATTGTTCTTGTTGGGACCAAGTTAGGTTTGT
ACCGGATGCAACATTAACTCAACAAAGCTCAGTGCCACTTCCTTTTGCAG
GCTTGTTTCAATGCTCTTAGGTTTTAACCGTGCTTGCTTCCAATTGTTCA
GATCT
View all "STS057" genotypes
Oryza rufipogon-RA4792 W1963     RA4792 STS058 CTCACAGTATCTGACATAGCATCCCACATCCAGGTCCAGATTTCTATTTG
TAGACTAATCACACTCTTATTGTACTACATATAGTTCACTTTCACATCTA
TGATCTGTTCACTGAACCTCTCAGCTAGGCTGTAGTATTATGAACGATGA
TATTTCATCACATTTCATTAATAGCTCCTGTCCTTACTCCTTACCCATGT
AGCCATGTTTATGGGTTTTTCTTGAATGTAGCACGAGATTGAGTATGGAG
GTGACAATGCATTAACTTCACCGAGATCGCAACACGCATTCCAGAATCTC
CAAGCTCCAATGCACATCCCCAACACAAGCACGCAGCAGCCGCCATCTTG
TTCAATCACACCATCAAACCCTTCCAAGGACTCTATGATATTTTCGAAAG
CGCTATCCAGCCCTGTCCGGCAAAACCTGCAACTGTACCATGTACAGCAA
TGCGGTGACACAGGATGCTTTGCAGATGGCATTTTTTGCCCTGGAAACGG
TGACTCGGATCCTGCAGCATCAAATGATTCGTCGGT
View all "STS058" genotypes
[ Download ]