grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "R15(b)" from the experiment "Genome-wide patterns of nucleotide polymorphism in domesticated rice".

E.g., Germplasm "IRGC9542", RA4969, Basmati 1, Marker/locus RM22.

Items 51 to 75 of 102.       Previous | of 5 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
Oryza rufipogon-RA4828 R15(b)     RA4828 STS051 CCTTTCTTGACAGATGCTTTGACAAAGTTTCAGGTAAAGCTTTCCATGAA
CAAAAATACAATCTGTTTATGGTTTCATTGATCAGAGGTAATAGAAATGT
TCTACAAATATTGTTACACACTATTGACCTGGGGTCAGGGGATATTTTAC
CATCTCCTTTATGGAGGACAACCGAACCTTACAATAAACAAAGAAAAGTG
TAACTGAAGAAGTTCATTTGTTTTACAATGTATTCTTCCATCATCTCAAT
TGAAATATGCTATGCTTGTTCTTGGATGAAAAGAGAAATGTCCATTAGCC
ATATGATAAGTTATTTGCTGCTTTTGGTTGGTGTCTGAACATATTATATG
CTTTCGACTTATTAAGACAACTGCTTTTGTTTGTGATTTTCTTCTTGTCC
TTGTTGGTCCAAACTGCCAGTACTTAAA-CACGCACTGCATCCTGCATGA
ATGTTTTCTTATGAGATAACTTGATTTCATTATTTTGTAGGACCCTGCAG
AGGCTGACAAGTTAATGAAAAT
View all "STS051" genotypes
Oryza rufipogon-RA4828 R15(b)     RA4828 STS055 CGACATGGCACTGCATTTCTGTGAGCGTTACAAGTCAGTTCTTTGCATCT
TATGTGAATGGGCTTGATATGTTATATAATTCTCTCTTCTTCTTTTTTTN
GCAACTTCTTATTTACATCTCAAAACTGAAAATATTATAAATACTCTACT
TGACTGAAATCCTCAGATGGAAGTTCTAATGTTTATGTTGAAAGGTGTCT
CAAAGTTGGGTCACTGTAATGATTATGATTAGGTTCTGTTTTACAGTAGT
ACTTACCATTCTATTTATTTGCAGGCTAATGGTTCTTAGAATCAGTTCAA
AATTTGAACTGAGAAGATTTTGCCGTACTACAGGGTCTATTGCACTTGTA
AGTTCTGATCTCAAGCTTTTGTTCAATTGCACAGTAGTATGTATATGCTG
ATGCATGTGCTCTTTCAAAAACAGTTGAAACTCAGCCGACCAAATGCGGA
TGAATTAGGA
View all "STS055" genotypes
Oryza rufipogon-RA4828 R15(b)     RA4828 STS109 CGACGTCGAGGACGCTGGTGCTCGCCAACTCCGCGCCGGTGCTCGCCGGG
CAGCGCCGGTACGCCGTGAACGGCGTGTCGTTCGTCGTCCCCGACACGCC
GCTCAAGCTCGTGGACAACTACAACATCGCCAATGTCATCGGCTGGGACA
GCGTCCCGGCGAGGCCCGACGGCGCGGCGCCGCGTTCCGGGACGCCGGTG
GTGAGGCTCAACCTTCACGAGTTCATCGAGGTGGTGTTCCAGAACACGGA
GAACGAGCTGCAGTCTTGGCATCTCGATGGATATGACTTCTGGGTTGTTG
GGTAAGCTACATTCCCATCAACCACTGAAACTTTCAGAT-TTTCAGTTGC
ATCAATTCTCAGATGAACATCAACATGAGAAAGATCTGTTCATTCACCTT
TGATGATTTCT--CTCTGATAAATGGATTCAGGTATGGCAATGGTCAGTG
GACTGAGAATCAGCGAACAACCTACAACTTGGTTGATGC
View all "STS109" genotypes
Oryza rufipogon-RA4828 R15(b)     RA4828 STS066 CGAGGATGCTTCTAAAGCTGGTACGCATTCTTCTGCATAATCCAGAAAAG
CYTCCTCACTTCAATTCTTTAGCAATRTCTATAACACGGGATGTGAAAAA
ATAGCATTTTCGATGAATKATCAAATATCAAAATTCATATTYAAAAGCAT
TAAGGTAGAGAACTTATTCCATTTTTCGTTGCCAAGAATAGAATTGTTMT
TAATTTGACTGTCTGCAAATGCATTTAGAAAGCAGTAAATAAATTWATTT
TTRTCTGTTATTCTATTCAAACTTTATACCTTGCTGCACTGTACACTAGT
ACAKCATSTTTGATTTTAGCGTGTCTTTGYTTTTTCTCTTCGAGATTATT
GGAGCTTACAAGATTGCTTTGTCTCTGCTTTACAGAGCATAAGTCTGGTC
AACAGATGGGGTATCAGGCTGCATATCCTCCATGGGCAATGCATCCTCCA
CCTTACCATATGCAAGGAATGCCTTACTATCCTGGGCCGTACTACCCTCC
ATATCCTCCAGTGGATGACCCC
View all "STS066" genotypes
Oryza rufipogon-RA4828 R15(b)     RA4828 STS083 CGCAGAGGTTCGACGGCATCGACGTCCACGACCGATACGCCAACCGCAAC
ACCGTCTTCTTCGACGTGAG--------------------------ATAT
A--ATCTTTCAAAATCCAGAGCAAATCACGATCGATCGAGCAATGTGACT
GAAATTTTGTGT--TG-G--------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
-----------------------------------------TTCTTGGTG
AGATCATCAGATCAACATGAAGGGGCTTGATGGGATCCAGGGCCCGGTGT
ACGTCGGGACAGGGTGCGTGTTCAGGCGGCAGGCGCTGTACGGATACAAC
CCTCCCAAGGGACCCAAGAGGCCCAAGATGGTGACCTGCGACTGCTGCCC
TTGCTTCGGGAGGAAGAAGCGGAAGCACGGCAAGGACGGCCTCCCGGAGG
CCGTCGCCGCCGACGGCGGTGAGCTCCCAAATTCAGAGCTAAGAAAGAAA
TTTTGGTGTGTGAAAATTTTCAGCTGATGGAATAATGCAAGTTTGTATGT
GGTGGATCAGGG
View all "STS083" genotypes
Oryza rufipogon-RA4828 R15(b)     RA4828 STS058 CTCACAGTATCTGACATAGCATCCCACATCCAGGTCCAGATTTCTATTTG
TAGACTAATCACACTCTTATTGTACTACATATAGTTCACTTTCACATCTA
TGATCTGTTCACTGAACCTCTCAGCTAGGCTGTAGTATTATGAAYGATGA
TATTTCATCACATTTCATTAATAGCTCCTGTCCTTACTCCTTACCCATGT
AGCCATGTTTATGGGTTTTTCTTGAATGTAGCACGAGATTGAGTATGGAG
GTGACAATGCATTAACTTCACCGAGATCGCAACACGCATTCCAGAATCTC
CAAGCTCCAATGCACATCCCCAACACAAGCACGCAGCAGCCGCCATCTTG
TTCAATCACACCATCAAACCCTTCCAAGGACTCTATGATATTTTCGAAAG
CGCTATCCAGCCCTGTCCGGCAAAACCTGCAACTGTACCATGTACAGCAA
GGCGGTGACACAGGATGCTTTGCAGATGGCATTTTTTGCCCTGGAAACCG
TGACTCGGATCCTGCAGCATCAAATGATTCGTCGGT
View all "STS058" genotypes
Oryza rufipogon-RA4828 R15(b)     RA4828 STS077 CTGGTGAAGCAACAGAACAGATTATTAGGCAAGTAGAGAAGATGACTAGA
AATATTGAGCGCGCTTCTCGTGCTAGCAAGGTAATGCCTGTACTGCTGTA
TGCATATATATTGCAGCATTAATAAATTTGGCATTTGCTTTTTTAGTTTT
CCTTGGTTATGCACGTTCCTTTGAGGAATGTTAAAGTGTTCTTTTATTTA
TAGGATGAACCTTCAACGTTGGATATGCCTTACGGAGATGTTAGTCGGAA
ATATCCTGCTGCCAGATCAAGTGATGCTTTTGCTACAGCTGATGGCATAG
CTAAAAGAGCAAGATTTGATACCTCTGCTGCTTTAAACCCACCATTTCAG
GGAGCATCTGATTATTCTAATATGCAGGTTGACAATGAAGCGAATGTGGA
TCATTCCTCTGATCCAGCTYTCTTGAATTGTGATATGTCTCCTGTTGAGA
AGATGATTGAAATGA
View all "STS077" genotypes
Oryza rufipogon-RA4828 R15(b)     RA4828 STS047 GACGCCGGGCTGTACATGATCCTGCGCATTGGGCCGTTCGTCGCCGCAGA
ATGGACCTTCGGGTTTGCCTCTTCGTTATACTGATGCAGTGTCACGATTG
GTTGTAGTTGTGCAGAATTATGGTGATTCGATTTCTCTGGGTTGATGGGT
TTATCCGTTTATGTGTGCGTGGATGTACAGGGGCGTGCCGGTGTGGCTGC
ATTACGTGCCCGGGACGGTGTTCCGGACGAACAATGAGCCGTTCAAGGTG
TGGCGGGCTTGTGAATTTCGTGGCGTTTTATTTGGGGAGTTTGCAAGTTT
GGTGATGGTTATACTGACATTTACTTACGCAGTCTCACATGAAGAGATTC
ATGACGTACATTGTGGATATGATGAAGAAAGAGCAATTCTTCGCTTCGCA
GGGTGGGCACATCATCCTAGCTCAGGTCTGGACATTGTCATACTAATCCT
AATTGGGGTGCTGAAACATCAATCTGTTTCTATCAACTTTGAGATAGGTG
TACTTCACAATTGACGGCAGAATTGGTGCACTGTAGGTTGAAAATGAATA
View all "STS047" genotypes
Oryza rufipogon-RA4828 R15(b)     RA4828 STS011 GACTTCAGTTTATCACCTTTGCTAGCAGCACAATCAATGACAAAATATAA
CTCAGCTGCACCAACTACTACTGGACCAGCAATCTCCATGCAAGAGGTAA
TTTAACTACGCTGGTTCACTTTCTCATGGTGTTTTCTCTGGATTCATATT
TCATAGAAGTATAACTTTAGGAAGAAAAAGGCTCCACATCCTTTCTTTAT
TTGAAAGATGAATTTACAAGGGTGTGATGGTGTTGGAATTTTTTATTTTG
TGTGCATATACAGTTAATCATTCAGCAACAAGTAATCTCTAGTTCTCTAA
TTTTCTTCACACACATGTACATATTTGTTTCAGACTCTGAAGCCAGGAGT
TTTCTCCAACGCTCAATCTACCCAAAATCTTCCAAGTACTAGTATAGCAA
CGGGGCCTCCTCTCCCTCAGCAATTAGTCCACCCTTACTCTCAGCCTACT
GTACCACTGGCGCCTTTTGCGAATATGATTGGTTATCCGTATTTGGCACA
GAACTACCCTGCTGCTTACCTACCATCAG
View all "STS011" genotypes
Oryza rufipogon-RA4828 R15(b)     RA4828 STS121 GACTTCCGAAAAGGCCGGCGCCTCCGAGATTTGGCCGGAAATTGACGGAA
TCACAAAAGGTAAGCTCAAGATAGTTCTGTCTGCTTCTCAGAGCTTATGC
TGCCTGCAATCGTCTGCTCTTTCCAACTTTTAAGCCTCAACCTGCAAAGT
TGTGAATTGTCACAGGCTAGAGCAACACACATTTGCCTTGATTGTGGATA
CATATACTTCCTTCCCAAGCCTTTCGAAGAACAGGTAAGATTCACTTCAA
TTCTTTCACAGAGAATCAGTCTTTTGGTACTCACAGCCCGCAAAATCAGG
TGTATCCAACAATTCAACTAGTGCTTTTTATCCATTTCAGCCTGATGAAT
ATGGCTGCCCACAATGCAACGCACCAAAGAAGCGGTTCGCGAAATATGAT
GCAGAAACCGGGAGGGCGATTGGTGGTGCGCTACCACCTATTACAGTGAT
CGTCAGTTTGATAATCGGCAT
View all "STS121" genotypes
Oryza rufipogon-RA4828 R15(b)     RA4828 STS101 GAGATGTCAGAGAAGCCAACGTTGGCATCGCCCCTGAGCTTGCCGGCGTG
ATCGCCGACGAGGTCGACATCATCGTCAACTCAGCAGCAAACACCACTTT
CGACGAGAGGTTTTGTCATTCTCTGAACTGCAGTGTTGCTCCAAAGATGA
GTTCTTAATTGGATCACTTCATGTATWATAAGCATATGAATTGATCACTG
TTGCTGCATTTGGTTCGATTTTGCAGGTACGATGTTGCAATGGACATCAA
CACCGTAGGGCCATTCAGGATAATGAGCTTCGCGCAGCGGTTTCGGAGGC
TGAAGCTGTTCTTGCAAGTGTCAACAGGTCAGAAATGCATGTCAAATGAA
AAGCTCTTGTGCTGAAAACTTGCACTGAAATT-ACCTCCAAAAACCTTAG
ATATATCTCTCTACTGTGGATTTTGAATTTCATGTTTGGCAATCAGCATA
TGTGAACGGACAGAGGCA
View all "STS101" genotypes
Oryza rufipogon-RA4828 R15(b)     RA4828 STS023 GAGCAACTCAGGGTATAGATAATCTGAAAACAAACCACTTGAATCCCATG
ATGAAAACCATTTCACACTTCGAGTTTACTGATGATCTGTTCACTTCTGC
AGAAAGAACATTTTGATATCAGGAAAGGTAAAGCGCCCGAAGATGCCATY
GACTGGAATGATTTCAAGTCCATGACCTTCACTCGAGCTGTAAGTTTGAT
GATGATAAACTCAGAAAGCAGCCACAGTAACAGTGTAGTCTGATCATGAT
GAACTCATGGGCACTTTTACTATGCAGGTTATCTTYGAGACATTAAGATT
AGCTACAGTTGTGAATGGGCTGCTGAGGAAAACTACCCAAGATGTTGAAA
TGAATGGTGAGATATGCATGATATATAYGCTGCTGCAATTAGCATCTTTT
TGATAAATCTTTGGATAGCCCTAATGCAGTGCTTATTTGTTTCTTCCAGG
GTATGTTATCCCAAAAGGTTGGAGAATATATGTTTACACAAGGGAAATAA
ATTA
View all "STS023" genotypes
Oryza rufipogon-RA4828 R15(b)     RA4828 STS016 GAGCGGAGTTACCATCAATGGGAAGCGAGCGGTCGTGGTTGGCCGCAGCA
ACATTGTCGGGCTACCTGTATCCCTGCTTCTTCTGAAGGCGGATGCGACC
GTATCCATTGTTCACTCCCGGACCCCAAACCCTGAAAGTATTGTCCGTGA
AGCAGACATTGTCATTGCAGCGGCTGGCCAGGCTATGATGGTACATTGTT
CTACCACCAAATTATGACATGGTTCATCACAAT--------CCA----CT
GCCCAGTTCTAACTGCAGATTTCTTGGTTGCCAGATCAAAGGAGACTGGA
TCAAACCAGGCGCTGCTGTCATCGACGTTGGGACGAACTCCATCAGTGAC
CCAACCAGGAAATCGGGGTACAGACTCGTCGGCGATGTGGATTTCGCAGA
GGTGAGCAAGGTTGCTGGTCACCTGACTCCAGTCCCAGGTGGCGTTGGCC
CCATGACGGTGGCGATGTTGCTGAAGAACACGG
View all "STS016" genotypes
Oryza rufipogon-RA4828 R15(b)     RA4828 STS123 GATGCATCATACACATTTGGCATAATTGGTTCGTCTTTTTTTTT-CTCAA
GTATTTTTTT-GTTAACAGCATGTGTCATCGAATTACTTTGGATCTCTGC
AACATCTCTTCTAGGATTTTACCTAGGTTGCATGAGTCATATAAGATAGA
TCTCAACAAGATTATACTATCAGAAGGACTGGAAACACATCCTCTGTTCT
TGTCAAACATCCTAGCTTTAGGATAAGGGAATACATGAAC----------
--------GGAAAAAATGGGGATCAATGACTTCATGGAAAGAACCACTAT
GTCAAGATATGGTTATAGTG---------TCCGAGCTTGTTGATACTAAA
GTCTTCTGGCTGTGCTTTGCTAGGTGATCTGGGGCAGACATTTAATTCCC
TCTCAACCCTTCAACATTATGAGAAAAGCGAAGGTCAAACTGTTTTATTT
GTTGGGGATTTGTCATATGCTGATAGATATCAACATAATGACGGTGTTCG
TTGGGATTC
View all "STS123" genotypes
Oryza rufipogon-RA4828 R15(b)     RA4828 STS068 GCCACGCGGACGGGGCTCAGGCCGTCGTCGTCGCGCGGCAACCGCGCCCC
GACGTCGTTCCGGTACGCCAACGTCAGCACCGGCGATCTCCCGGCGAGCG
TCGACTGGCGCGGCAAGGGCGCCGTCAACCCCGTCAAGGACCAAGGCGAT
TGCGGTAAGCGTGCGTGGTGTTCGTCCCATTTTGCGTGAGGTGGCTTTCG
CCGCCATGGCGAGCTGAGAGCGTTGTGCTGCGTCGTGCGTGCGTGTGCAG
GGTGTTGCTGGGCGTTCTCGGCGGTGGCGGCCATGGAGGGAGCCGTGAAG
CTGGCCACGGGGAAGCTGGTGTCGCTGTCGGAGCAGCAGCTGGTGTCGTG
CGACGTCAAGGGCGAGGACCAGGGCTGCGAGGGCGGGCTCATGGACGACG
CGTTCGACTTCATCATCAAGAACGGCGGCCTCGCCGCGGAGTCCGACTAC
CCGTACACGGCGAGCGACGACAAGTGCGCCACC
View all "STS068" genotypes
Oryza rufipogon-RA4828 R15(b)     RA4828 STS082 GCCGGATGTTCATCATCAACGCCGGTCAAGGATTCAGGCTTCTCTGGAAC
ACCGTCAAGTCCTTCCTCGATCCCAAGACCACAGCCAAGATCCATGTAAT
CCAATCCATCCACAATCTTTTCGATGTCAATGTCACATCGATCATT-CGT
AATTAAGCTACATTTGATCAATTTGCAACTAAACATTACATAATGTTTGC
ATTTATGTGCCCTGTTTTAACCAGGTCCTAGGCAACAAGTACCAGAGCAA
GCTGCTGGAAGTGATTGATCCCAGGTCTGAGCATGAACCTTCTAGAGTTG
TTCGTTCCTGCTTCTATGCAAATGCAAATGGAATCACCTTGAATATTTAT
ATTAAATCTGCTA--ATATCATTATTAAAAAGAACAAGATTGAGCAGCGT
GTTGAGCTCACTCCCTGTTATTTCGAGACAGC
View all "STS082" genotypes
Oryza rufipogon-RA4828 R15(b)     RA4828 STS045 GCTTGTGGTCCTTACCTCTGTTAAGAGGCAGAACTCGGGTGGATGGGCCT
TTCTGCAGCCATTCACGATCAAGATGTGGACCGTCACTGGACTGTTCTTT
CTTATCATAGGGACAGTAGTTTGGATGCTTGAACATAGAATCAATGATGA
ATTCCGTGGCCCTCCTGCGAAACAGCTTATTACTGTGTTCTGGTAAGGCT
ATAATTTCGTCAGTTTGTATTTATCGC-GTGTACAATTCCTGCAAATATC
ATTCCATGTTTTCTGTCACCATTATCCAGATTCTTGGACGATGAACTGGT
TTTATTTGCCTGACACTTCATGTTCTACTTACTTTGCAGGTTCAGTTTCT
CAACTCTGTTTTTCGCACACAGTGAGTGAAACG-ATAGCTTGTCACATTC
TCGACATTTTCAATAACCATGATGGAATTTTCCAGCTCATAGGAGCTACT
CTTTCTTCTATGTTTATACAGGAGAGGACACCAGGAGCACTCTCGGCC
View all "STS045" genotypes
Oryza rufipogon-RA4828 R15(b)     RA4828 STS036 GGCCCCCACCGACAACCTCACCGTCCTCCGCCAAAAGTTCGCCGCCCTCA
ACCTCAACGACGTCGACCTCGTCGCCCTCTCAGGTACTCGTATCACTTCT
CCGGCGAACTCAATTTCA-----GTTCTGCCGTCATGCCCGCCGGAGCTG
ACGACGACGACAATAATGCGAAATGCAGGTGGGCACACGTTCGGGAGGGT
GCAGTGCCAGTTCGTGACGGACAGGCTGTACAACTTCAGCAACACGGGGA
GGCCGGACCCCACCATGGACGCCGCCTACCGGAGCTTCCTGTCGCAGCGG
TGCCCGCCCAACGGGCCGCCGGCGGCGCTCAACGACCTGGACCCGACGAC
GCCGGACACCTTCGACAACCACTACTACACCAACATCGAGGTCAACCGCG
GCTTCCTCCAGTCGGACCAGGAGCTCAAGTCGGCGCCGGAGGCGACCGGG
ACGACGGCGCCCATCGTCGACCGCTTCGCCACCAGCCAGGCCGCCTTCTT
CCGCAGCTTCGCGCAGTCCATGATCAACATGGGCAACCTCTC
View all "STS036" genotypes
Oryza rufipogon-RA4828 R15(b)     RA4828 STS032 GGCCTCTGGTGTCCCCATCAAGTTGATGAGTGTGCAGAGTGATGATCTTC
TCACCAAGGTGCAGATACAAGATTTCAATTTCATGCATTACACATGGACA
CATAATCTCACACAAGATTCGACTTGGTTTGATTCTACATGGTTTTAATC
TTCACTCTCCATAATGTACAGATATCGAGAGTTGGAGACACCACATCTGC
AACTGTCAATTCAGGGTTGTTGCCTGATCTGTCAAATGCAACCTTGGAGG
ATTACCAAGGCTATAACACTGAGGTGGTGAAGGCAGCCCGACTTTGGTAC
AGCTCCATAGGAGGAGAAATGCCACTGGAGATCACTCCTAAAGTAGGTGA
CACAAAACTAGGATTTGCAATCAGCCGTACTGAGGAGGTAAGCTTTCTGT
CGCCACTTCCAGAATATCGACAATATTATGCTTCATCAATTAAGAACAAA
AGAGTTATACATCAAACATTCCATGACACAATGTTTCTTTCAGGGTTTTA
TCTACATATCTTCAGTGTT
View all "STS032" genotypes
Oryza rufipogon-RA4828 R15(b)     RA4828 STS092 GGGTGGCATGGCCCGTATCCTGAACGCAAAACATTTTGAGAGGTTGAGTG
GCTATCTGGAGGATAATAGGGTGGCAGCTTCTGTAGTGCACGGTGGTTAC
ATGGACCCCAAGAAACTGTAAGTTCTGAAAACC-----------------
-----------TGTTGGCCAAGCGTCTGCACACAATTGGTCCCGCACGAT
TTCATTCCCAATTGCTTGCAGGAATATTGAGCCAACCTTACTGCTAAATC
CTCCTGCTGATTCTGATGTCATGACCGAGGAGGTATTTGGCCCGATTCTM
CCAATCATCACGGTACGCACTGACAACGATTGCATAGT-TTCTGGGTGGA
TGATTTCACATACATCTGCAACCTACGACTGAACCAATTTGATCATCCGT
TTGCAGGTAAAGAAGATCGAGGATTGCATCGCGTATTTAAAGTCCAAGCC
GAAACCGATTGCGATGTACGCCTTCACCAA
View all "STS092" genotypes
Oryza rufipogon-RA4828 R15(b)     RA4828 STS103 GGTTAATACCTGGCTTCAAAGGCAAGGGCATTTCAACATACTACATAAGA
AGCATTCTGTAAGTACTCTAGCCCAAACTGGCATGTAAAGAAAGTTAAGT
TCAGTAATCAACCTAACCTGGAATGCAGGTTACCTTGCCAGATCAATTCA
TCGAAGGGCTGTCAAGTGCTTGTTTGCAAGGACGAGCACAGATTGTTCCA
GATCCGGAAGTGCTGTCCAAAGACAGCAGTTCCTTAATTTTCTATTTGGA
TGGAGCACATAGCCCAGAAAGTATGGAAATTTGTGCGAAGTGGTTTTCCT
GTGTTACAAGAAAGGATGAACAACAACCAGGCCCTTTGGATCAGCTACAT
ATTGGCACCAATTCTAGGAAGGTATGCCTTGCAGTTGCAGTGAGCCAGTG
AGAGGTCTCTCTCTCTCTCTCTC--------TGTGTGTGTGTGTGTGTGT
GTG----------------------------------GCTCATATCATTG
TTCTTTCTTTCTTATGAGCACTCTTTGTTTGTGATCCTTGCAG
View all "STS103" genotypes
Oryza rufipogon-RA4828 R15(b)     RA4828 STS079 GGTTCAGTATATCTCCATTTGGGAACAATGCTCCTGCTACTGAGGTGGAT
AAATCACTCTTCAATGTAAAAGTGATCACAGGCCCAAAGAAATCTACAGA
GCAAAAGCTTTCAAATGGGTCTCCACAAAATGTAGTGCACCTGGACATAT
TCAAAGGTAATTCCCCTGAGCTTTTGACTTGGATCATTCAGTTGTAGTTG
AACATATAATAGAATGAGGCGTTTTGGTTTGTCTTGTGAATTGGTGGGAT
AAACAGTTGGTTTTTAATGCAAGATGTAAAGTTGAAGTCTAGTAGTGTTT
GTTTTGCAATTTGCAACGCTCATTTTTGATGCTATCTTATCTTCTGTCTC
TGCGCTCTTTATTTTGTTACAGGAACAAAAGGAGGGGATGTGTGTGAGGA
TGAAGGGATGGTGAAAGATTGCCATCCATTCAGAAAGGGGAGGGATGAAA
TATCTCTAAAACCCATAGAAGTGAGGAAGAAAGTTGGGGGTGGACAGTCA
TGCTCGGATGCAGAGATCGA
View all "STS079" genotypes
Oryza rufipogon-RA4828 R15(b)     RA4828 STS009 GGTTGTTGACTATTCCTTTGGAGGTTATAGCTACATTAAGTGTGAGGCAG
TCCTAGAAGAGAACAAAATATGTGGGCATATTGGGCACCTTGATTGTGCT
CTCCGTACTTTTATGGCTGGAACAGTTGGAGGATGTATTGACTTGGACAT
GCAGTATTGTTGCAGACGTTGTGATAACAAAACGAACTTGATGCTGCACG
TAGAAAAATTCTTGGAAATATGCCAATCTCTTCAATCAAGGGATGACATT
GAACCTATCCTGAATACTGGCTTATGCCTAGTGCGTGGTTCAAGACAAAC
AAGAGCAAAAAGCTTGGAGAGCATTATGAGATCAGCAATGGCAAAGGTAT
GGTCAGTTTTATTTTTTT-AGCCACTTGTGGAAACTTCCATTTTGGTCAC
CATTTATCTTCTTTTTGATCTCTTATAAGTAGTTTGTGGCTATGCACTGA
TGGTTTACAACTATATGCAGCTAAAGTGTGGGGTTGATCTTGCTGAAGTT
View all "STS009" genotypes
Oryza rufipogon-RA4828 R15(b)     RA4828 STS104 GTACTAACAAATTACTACATAACCATCATCATTCTTTTTCCTAACATACA
AAGATGATAAGTCATATTTTTGT-GTACCAGTTCTTTGATCACGCAATTG
GTATCAATGTTCCAAGGTCCCGGTTCCTACCAGTGAAGGCAACATCAGAT
TTGCAGCTAGTACAGGTCTGTATGACACTCTGAGTAAACTTTTTAGGGTA
ACACTCATT----C----TAACTTAACTGTTTCACCCTTGCAGTCTGATC
TATATACCTTGGTTGATGGCTTTGTTACACGCAACCCGGCCAGAACAAAC
CCATCGAATCCCTCAATTGAACTGGGTCCAGAGTTCAAGAAGGTATAGTT
CCTTCCAACATTATTTCCTCATGCAAAAGCTTTAATTTAGTTCATGAGTT
CAAATGAAATTAACTGATCCTTCTTCGCATAATGGCAGGTCGGGTGTTTC
CTTGGTCGCTTCAAGTCAATCCCC
View all "STS104" genotypes
Oryza rufipogon-RA4828 R15(b)     RA4828 STS018 GTGTATTTTGCTCATTGCACGTCAGAGATGATATTCATTACTCATTTGCT
CACAGAACAACCTGAGAAACTTGCTGGCCCTCTGCTGGCTGATACTTATG
TTACTCTCCTGAAAGGTCGCAATGCGTGGTATGGGCAAATGCTAGCGAAG
GGAGAACTGAGCCCTGACATGGGCGACAGCATCAAGGGGAAGGGGATGAT
TCAGGTTATCTCATAAAACTACTCATTATTTTCCCCGAAAGTTATATGAA
TTTTGAGCGTATTTTTGAAGAATGCTKGAAGTCAAAACTTGCAAAAGATA
TCASATCATCCTGGATATAACCTGTTCACTTTTCACTCTACAGGGTATCT
CTGCTGTTGGTGCATTTTTTGARCTTCTCAGTCAACCCAGCTTAAGTGTG
CAACACCCAGAGGAAAATAAGCAAGTTGCAC
View all "STS018" genotypes
[ Download ]