grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "IRGC104119" from the experiment "Genome-wide patterns of nucleotide polymorphism in domesticated rice".

E.g., Germplasm "IRGC9542", RA4969, Basmati 1, Marker/locus RM22.

Items 1 to 25 of 100.       of 4 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
Oryza barthii-RA2740 IRGC104119     RA2740 STS082 GCCGGATGTTCATCATCAACGCCGGTCAAGGATTCAGGCTTCTCTGGAAC
ACCGTCAAGTCCTTCCTCGATCCCAAGACCACAGCCAAGATCCATGTAAT
CCAATCCATCCACTATCTTTTTTATCTCAATGTCACATCGATCATTGCGT
AATTAAGCTACATTTGATCAATTTGCAACTAAACATTACATAATGTTTGC
ATTTATGTGCCTTGTTTTAACCAGGTCCTAGGCAACAAGTACCAGAGCAA
GCTGCTGGAAGTGATTGATCCCAGGTCTGAGCATGAACCTTCTAGAGTTG
TTCGTTCCTGCTTCTATGCAAATGCAAATGGAATCACCTTGAGTATTTAT
ATTAAAGCTGCTA--ATATCATTATTAAAAAGAACAAGATTGAGCAGCGT
GTTGAGCTCACTCCCTGTTATTTCGAGACAGC
View all "STS082" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS075 ACTCACATCTACTCAAGGTAGAGTACTCAATTTCTCATTGCTTTCACAGT
GATTTCACTGCTACTAGTGCCATGATCAGGCATTGCAATTTGCAAACCAC
ATTGGAGCTCCTGTAGATTAAATCTACTACTGGTAGTAGCTCATTGCCAT
TTGGTATTTTGATCATGATCCACAGAGGAGGAAGTCTTCTTCTTTTTCTT
GCAAGCCAAGCTCAGCAGCAGCTGACAAGGGATCATATGAAGAGGACTCC
TACTTTGAAGCACCC---TCACACTGCATGGGCAGGCCGGCTCCTGATTC
CTCTCCTGACCCTCTTCTCTCCCAGTTCATCTGCTGCAGCCTCGCTCCTC
CTGTCGATTCGCCGCGCCGCAGCGAAGCCGATGCCGAGGGCCATGGTTCA
TCTTCCTCAGATGATCAAAAAAGGTAAGAATTGTGCAGTTGGTGCTGTTG
GAGCAGCCTGAAATTTGGTAACAATTGTGCTGAATCTGAACAATGCTGAC
TGATCCAAATGCAATCTTTGATGCTTGCAGGAGAG
View all "STS075" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS007 AAAGATTTTCTGTCAGTTCCTGCGGCAGAAATGACTCATCTTCGGCCTTA
CAAAAATCAGGTGACAACCATGTTGCCTGCCAATCAGGACAACCACCTCT
GGCTGTGCATACTGAGCTCCAACATGACACTTCTATTGTAATATCCAGTG
GTGAAGAGAAGGTCCTTTTTGACCTTAATGTGCCAGCTGAAAGCATTGAC
ATGGAATCAACAATAACCAGTAATAGTTTTAGAGATAAGCTAGTGAAAAA
TGATGGAAGTGAAGAAACAGTAACCGATCATTCTTTCTCCAAGAGAAACG
GTGTGCATGCTGAAACTTCTATAGAAGAACGAACTGTTGGAGAACATCAT
ATATCAGTCAGCAAGGATGGAAACACCACATTTTTCCAAGAATCAATAAA
TAATGAAATTGATAAGGCGCAGTCTTCAGACCTTATAAGTGTTAGCAGCA
AACATTTGATTGCAGAAACTCCTCATGTTGACAATATTGTGTGTCCAGAA
CTGCGAGCATCTCCTGATGGA
View all "STS007" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS049 NNNNNNNNNNNNNNGCCCCTCTTTTAAAAGCCTACCTTGAAGATTCAAAG
AAGATACCCTCAAATTCAGATAACCTGAGTACTAGCACTGGCCAATCTGG
GGTAAGTGAAATGGTTCTATATAATTATTTGAAGTCAATGCTGACCTCCT
AATATGAAGTCTCTACTCTGTAAGTGGTATGTCCACAGGGCATTCTGAAA
TATGTTGATCAGTGCTTCTTGGTGGTATCATACTACTGTACCCCTGATTG
CTTGCTAGCAATGCATTTGATCCTTTTAGTCTCCAGAGGCAATTTCTTTC
AAGTGCTGCACTTGTTTCTTATACCAAATTAGAGGGTCTAATATTACTTC
TGTTGCAGAGCAATGCCAATAAGAAGGAGCAGTCTGCACTGCGGGCTGTT
ATAAAGTGTGTTGAGGACCACAAACTCGAAGCTGAGTTTCCATTGGAGGA
TCTCCGTGAGCGGCTG
View all "STS049" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS085 CCATTATGGTGTTGGAATTAAAGGGAAGGAACCCTCAGATTGTGGTGGGT
AAGAGATGGTGGTAGTGGAAACATATCAAAGTGTGGTGCTATTGACTAGA
GAAAAGTTGATGCAGGAAGGAAAAAA--CTGGAGATTGTGGCGGAGGGTT
GGGTTTGGTTTGGCTTTGGCCGGGGATAATAAATGATGGAGCTGTAGCCT
GTAGAATTAGGCCTTGTTTAGTTCCCAAAACAAAAACTTTTCACCCATCA
CATCAAATATTTGGACACATGCGTGGAGTATTAATTATGGACAAAAAGAA
AAACCAATTACACAGTTTACGTGTAAATTGTGAGATGAATCTTTTAAGCC
TAATTGCGCCATGATTTGACAATGTGGTGCTACAGTAAACATTTGCTAAT
GACGGATTAATTAGGCTTAATAAATTTGTCTCGCAGTTTCCTAGCGGAAT
CTGTAATTTGTTTTGTTATTAGACTACGTTTAATACTTCAAATGTATATC
CGTATATCCGATGTGACAACCAAACCCGAAAATTTTC
View all "STS085" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS058 CTCACAGTATCTGACATAGCATCCCACATCCAGGTCCAGATTTCTATTTG
TAGACTAATCACACTCTTATTGTACTACATATAGTTCACTTTCACATCTA
TGATCTGTTCACTGAACCTCTCAGCTAGGCTGTAGTATTATGAACGATGA
TATTTCATCACATTTCATTAATAGCTCCTGTCCTTACTCCTTACCCATGT
AGCCATGTTTATGGGTTTTTCTTGAATGTAGCACGAGATTGAGTATGGAG
GTGACAATGCATTAACTTCACCGAGATCGCAACACGCATTCCAGAATCTC
CAAGCTCCAATGCACATCCCCAACACAAGCACGCAGCAGCCGCCATCTTG
TTCAATCACACCATCAAACCCTTCCAAGGACTCTATGATATTTTCGAAAG
CGCTATCCAGCCCTGTCCGGCAAAACCTGCAACTGTACCATGTACAGCAA
GGCGGTGACACAGGATGCTTTGCAGATGGCATTTTTTGCCCTGGAAACCG
TGACTCGGATCCTGCAGCATCAAATGATTCGTCGGT
View all "STS058" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS081 AGGGGATAACTATTGCACTAATGTGATGACCAAGGTCGATTATTTAGAGC
ATGATTCCATGGATGATCAGGCATTGTTTTTGCATGAAAAGAACTTATTT
GTTCCAGAAGGAAGGAGCTCAGACAATTATAATAATGATGCTGCATCAAG
CAATCCACTTATGTGTGATGGTGTTGGTGGAAAAGAATTGGATGATGACT
CCTCCAGTTTGAAGGTATGTGCTTTTGTCTAATTATTCCATTGACAAAGG
GATAATATTGATTCAACACCTTTTAAGTGTTTCTTTACTGAGTGTTTCCA
TGCTTAATGAAAGACAGAAAGCTAACCTTTTTCCCCTTGCAGGGTACACA
TACTGTAAAGTTTGATGGCCAGCTCACCAGCTCTAACGCAACTACTTCAT
CGAGTAAACCTGATCAGCTTTTCTGGATAAATGGCTACATTTGTTCCATT
TGTGGATTTGAACTACCTCCAGGTTTTGAGGAGGAGAGACAAGAACATTC
AGATTTCCACTTGGCTGAAA
View all "STS081" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS094 ACAAGTTGAGGGTGGAGATCGGGAATTTGCCCGAGGAGAAAATGGGGAAT
GTGCTACAGATTGTGCAGAAGAGGAATACCGATCCGGCGCTAATGGGAGA
GGTCGTTGAGCTTGATTTCGACGAAATGGATGTCGAGACGCTGTGGGAGC
TCGATCGATTTGTGGTCAATTGCAAGAAGGCGCTCAGCAAGAGCCGGAGG
ACTGTCGCGATGAACGGTGATGCTGTTGATGCGACTGCTATTGTTCCAAT
TGAGGACGATACCGTGCAGGTGAATGTGCATCATCAGCCTGCGGTGGTTG
AAATTGGGAACTCGGTATGGCAATGTTGCAATCCTTTGTTCTGTGTGATG
ACTAATGCTTGAATTGTGTTCTCATGTTTTGTTTATGTTGCACTTTTGCA
GGAGAATGACATGCCGGAGAAGAGGGTTTCAGAGGTTGATATGGTTGATG
AGTATGTTGATATTGGCGATGAGATGCC
View all "STS094" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS118 ATCCTCCTCTGTCGATGATTCAGTGACATCTGTAGATTTCTTCCTAGGAG
AGGTCTGGCATTCTTTTCATGCAAAATCTATTGCACCATCTGCCAAATGA
ACATGAATTTACCGATGTTATGCTTCTTACATATACATGTTTGGTCGTTA
TGATGCAGGCCCTTGATTCCTTCAAGGCTGAAAGTGAGTCTGAGCTTAAC
TTGTCAGCTGGAGACATTGTTATTGTCCGGAAGGTAATATACCTCTGCTG
TCCATGTTTTGTAATCTTCAACTGAGTTGCCGATATTGTTCCGATGTTTC
TAAATACAAGTTCCTGGCAGCTAACATATCATAATTGAGCTGTCAGTAAT
CTAATGTGGTCTTGTCCGAACACAGATATCAACCAATGGTTGGGCAGAAG
GCGAATGCAAGGGAAAAGCAGGATGGTTCCCACATGGTTATATCGAAAGA
CGAGAG
View all "STS118" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS012 AAAGGTTTCAAGTACAAAAGTCGAAGAGCTCCAAGTAGATGTGGCGTCTA
TGGATGTTGAAATCTCTGCGTTAATGAAGCTATTTAGAAAAATAACAGAA
AATGACCGAGCCCCTTACTCGAGGGAGAGAGCCGATGATTCATCTTTGGA
ATGTGAACCGGTTCAACTTGACGTAAGCTCATTTTTTCCTTGTTATAGTT
TCCTTTCGCTCTTCAACCCAAAGTACATCATGTAGTTTTACCACCTCTTT
GATGAGCGATTGTTTTT-CCTCAATACAATTGGCTAAACGTCCTACTTGA
TATGGGCAGGATATGGTTGGTGACATCGACATGGAGAAGATGGAGCAGGA
AATGTCTGCATACGCTACAGCTCTCGCTGCCGCGAAAGACAATCCTACTG
A
View all "STS012" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS073 AGTTATTGTGGATTCCTCTGATCCAATAGGTGATTTGATAATCATGTGTG
AGTTTTTGTGTTTGTCATTGATCTATATCATCAAAATAATCCTGCCTAAC
CACTTATCCAGGACCGGCTCAAGAGCTTTTCGAGAAGCCTTTCTTCCAGT
CAGTTGCCAGAGCTTTGCGTCCTGGTGGTGTTGTATGTACCCAGGCAGAG
AGCATATGGTTGCATATGCATATTATTGAAGATATTGTAGCTAATTGTCG
CCAAGTTTTTAAAGGCTCAGTGAATTATGCTTGGACAACAGTACCAACAT
ACCCTAGGTATGCTAACTGATTATTTACATGTGGCTGAATTGATATTTCC
TTAGTTCCTAAGCTAACCATGCTTCCAATGCAGTGGTGTTATT
View all "STS073" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS005 TCCTCAGTTCCTCCAAGTCCTCCTTACAGAGTAACTGGCATGTATGGAAC
ACCTAGATATCCTGCAGAGAAATCGGTGCTATTGAAAAAGAATAATGTGA
TTCATCGGCAAGGCGTCGGTCGATCCGAAGGCGACGCAAACATGAACCAC
ACCGGCAAAGGAACTGTGGATAAGTGGCTTCAAATGCTCATGGAGGATCA
GCAGCAGCAAGAAGATCCTGCAGCAGCATATCATTCTTCTGAAGATCACA
ACACTGCTGATGAAATCGCTTCAGACGAGCACCAAATGCAAAGCAGAATT
GATGATAAGAGCTGCAGGAATGAGATCACCGAATGCTCCGATGAGATCGT
CGAGGTCGGTGGCGAGGGTGCTACTGAGCAGCAGGACAGGTGCAGGAACA
GCTTTGAGATCAAGGAGAGGGGAGAGGAGAAGAAGATCTGGTTCCCAAGG
TCTGACAGCTCCAGGGGTTTCAGGTCTCTG
View all "STS005" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS065 TCTTTAAACATGCTTGCGCCAACTGCAAGCCAGCTTTTGCACACCATGAA
TTGTATATATGCTGTGAAAGGGTAGTCCTCAATAGGTAAACTGGATGCTA
TAGACCCATCCAAAACATTTTCCCCCTTCCATTAGGATATTATCCTGGAA
AAAACAAGTAGTGCTCGGTCCGAATTAGAAAAAGCAGAGATAACGATCAT
ACAATATGCTTGTCAGTGCTTCTTGTGCTCTACTTTTGCAGAAAGTTCAT
GTCCAGATACATTTAGTTTTGTTGATACATTTATTTTTGCTCTCCATAGC
TTGCTGTATAGACTTGTGTATGAGCTAAGACTTGG-TTTTTACCCCTTCT
ATTCTGTTTATAATGCCTATCCAGAATTTATAAATCTGTGTAATCCTTTG
TACCCTTTGGTTGTAGGTTTACATCAGAC
View all "STS065" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS093 TTACTCTTCTCCTTCCATTGTTCTGGCCGCAAGGGGTCATAATGGAGGCA
GGGTCATATTTGATGATTATCGTGAAGCGTATTATTGGCTTCGTCAGAAC
ACTCCTTCTGATGCAAAGATTATGTCATGGTGGGATTATGGATACCAAAT
CACAGCTATGGGGAACAGAACTGTTATTGTTGATAACAACACATGGAATA
ATACACATATAGCTACAGTTGGGCGTGCAATGTCATCCTATGAAGATGAA
GCGTATGAGATAATGCAGTCACTGGATGTGAATTATGTGCTTGTCGTATT
TGGTGGTGTTACTGGTTATTCTTCAGATGACATTAACAAGTAAGTTTATC
CACTGAATCTAGAGCAAATTTTAATAAATCGATGTTATTGGTTTTATTCG
AATTAGTATTGAACATTTTTTTA-AAAACTGAACTACAAAATGGATTCTT
ACTTAGCTGCTTATTTCCAGGTTCTTATGGATGGTGC
View all "STS093" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS059 TACAGTGAATTTGATCCATTACACCTCTCCTCTGACCTCTGCAGATTCAA
CCTCTGGTCATACTGAGCTATCTTTGCCAGAGGAAATTAATTCACATGGT
GGCATATCAGCTTCTAGTGGTGAGACATGCTTGGATCCTGAACATTTATT
GGATGTAAATGTGCTTCATTACCAGCTTTATGTTCAGAAAATTTTGTCTG
AAAGTTTAGCTTCTACTAGTTTTTAGTTTCTCATTCTTTTCCATATTGTC
ATGTCATAATTTTTGTAGGCTGTTCCCTTCTCTACATGTCTTACTAATTT
TATCTTGGATTGTTCATTACGCAGAGACTGGCAATCATGATTCCAGCCTG
GAGGAGTTTTGGGCTAATCTTTTAGAGTCATCTATAAAAAACGACCCAAA
AGTTGTTACTTCTGCCTGCGGTGGGATTTTTGACAAAGCTATGACAATTG
ATATTACTGTTGTAGAGTTATAATCCTGCTTATTGTATAAAACAGGTGGT
T
View all "STS059" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS037 CCCACGAATTCATGAAAAATTCCCAGGTTCAGAATCTATACTTTCATTAT
CTAAATTTAGAAACCAACTGCTGTATAAGACTATAAGATTCAACATAAAT
TGCATAATCTTTCTTGAAGGTTGTAAGGAATCATCCTGGTGACCAAAGTT
ACTGGCATCGCCATAGATCAAAGGGTTCTTGGACTCTTTCCTCTGCAGAC
AATGGGTGGGCTGTGTCTGACACTACAGCAGAAGCACTGAAGGTCATTAT
GTTCTTTGTTCTTTTCCTGGTTACTAATGTAGGCAAATGAGGTATAAAAC
TAGTGTCATATTAATCCAGTCCTAATCGGTGACAGCACATCGAAGAAGCT
CATGCATATAAAAAATATTGGCCTTGATATATTCCCAATTCTGCATAATT
TCTATTATGTCTACCCTAGAAATCTTACATAATTTCATTTCCAGGCTGTA
TTGTTGCTGACAAAGATATCTAGTAGCATGGTTGGGGATCCCATTGAAAG
AGAAAG
View all "STS037" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS014 CCGGAGGAGGACGAGAAGCTGTTCAACCACATCAGCCGCTATGGCGTCGG
CTGCTGGAGCTCCGTCCCAAAGCTCGCCGGTACGCCCATCGATCAGTGTA
TGCATTAGTAACCAAAAT----GGCAAACTGACAAGCTAAGCTAAACTTG
GGTTAATTA--ATCACTTCTTTTCTCCTGAATAATAATGCTAATTGCTTA
CATCAATGTGTTTATAGTATTTCAGTTTATTATTTCATCAATTTCTGTCC
TGCTGCATAATGCTCACT------ATAGAAATGTGTTTATATC-------
----------------------------------------GTAATTTAGT
TGCTATAACTCTCTCTTTGTATCTCTC----ACTCTCTGACAGTGTGTGA
ATAATATAATGTGTGTTGCTGAGTTGCTGTGTACAGGATTGGAGAGGTGT
GGCAAGAGTTGCAGGCTGAGATGGATCAACTACCTGAGGCCTGATCTCAA
GAGAGGCAGCTTCTCCCAGCAGGAGGAGGAGCTCATCATCAG
View all "STS014" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS099 AAAACTTTTACAGATCTCTTCGATTACTTCCCCTTGACAGCATTGGTGTG
TATTCAGCATTTTCATATGTATATGCCAACATCCTTCCCACATTACCTAG
TGAATCTGACAGAAGCTGTTCATTTGTTCTGTAGGTCGAGTCAGAAATAT
TTTGCCTGCATGGTGGATTATCGCCATCCATTGAGACACTTGATAACATA
CGTAACTTCGATCGTGTCCAAGAAGTTCCCCATGAAGGGCCCATGTGTGA
TCTTCTGTGGTCTGATCCAGACGATCGATGTGGTTGGGGTATTTCTCCTC
GAGGTGCTGGATACACCTTCGGGCAGGTAACATTTTATATAAGAAAAAGA
AT--CT--ATATTTAGCTGTGCACCTCATGTTCATCGACTTATCAATTCT
ATCATTTCAGGATATATCAGAGCAGTTCAACCATACCAATAATTTAAGAC
TTATTGCTAGAGCTCACCAGTT
View all "STS099" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS119 TCGCCAACCCCGGCGACGCCCTGCTCATCCCTACCCCTTACTACCCCGGG
TAAGCCACTGTTCCATTGCCATTGCCAT------GCATCTAGCTAGCTTG
GGATCGATCGAGCAGAGTGGCAGGCTGAGCTGACATCCATGGCGTGCAGG
TTTGACAGGGACTTGAGGTGGAGGACGGGGGTGAACATCGTGCCGGTGCG
GTGCGACAGCGCGAACGGGTTCCAGGTCACGGTCGCCGCGCTCCAGGCGG
CGTACGACGAGGCCGCCGCGGCGGGGATGCGCGCCCGCGCCGTCCTGATC
ACCAACCCCTCCAACCCGCTCGGCACCACGGTCAGGCGCAAGGTGCTCGA
CGACATCCTCGACTTCGTGTCGCGCAACGACATCCACCTCATCTCCGACG
AGATCTACTCCGGCTCCGTCTTCGCCGCGCCGGACCTCGTCAGCGTGGCG
GAGCTCGTCGAGGCGCGCGGCGGCGACGGCATCGCCGGCCGCGT
View all "STS119" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS032 NNNNNNNNNNNNNNCCATCAAGTTGATGAGTGTGCAGAGTGATGATCTTC
TCACCAAGGTGCAGATACAAGATTTCAATTTCATGCATTACACATGGACA
CATAATCTCACACAAGATTCGACTTGGTTTGATTCTACATGGTTTTAATC
TTCACTCTCCATAATGTACAGATATCGAGAGTTGGAGACGCCACATCTGC
AACTGTCAATTCAGGGTTGTTGCCTGATCTGTCAAACGCAACCTTGGAGG
ATTACCAAGGCTATAACACTGAGGTGGTGAAGGCAGCCCGACTTTGGTAC
AGCTCCATAGGAGGAGAAATGCCACTGGAGATCACTCCTAAAGTAGGTGA
CACAAAACTAGGATTTGCAATCAGCCGTACTGAGGAGGTAAGCTTTCTGT
CGCCACTTCCAGAATATCGACAATATTATGCTTCATCAATTAAGAACAAA
AGAGTTATACATCAAACATTCCATGACACAATGTTTCTTTCAGGGTTTTA
TCTACATATCTTCAGTGTT
View all "STS032" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS050 TGGTAAGTTGAACATTATTCCATGGCAACCTATATTTGTTTCTATCCATA
GAGTTTGCTCATGAGAAAAGAGTCAATATTTGACCATCAATTTAAACTAG
ATAATGCTGGTAGATGGAAACATTCATGTTTGCAAGAACCACTGGGGAAT
GCACCAGAATGTTTTCTGTATTCTTAGTACTGTTGTCATTTCTTAGTACT
GTTGCATCCTTTGCCTTTTTAAATATTAT--GCAACTGATTGCCAATTAT
GTATCTTCTTTGTCCAATTCTCTGCCCTGTTATTTTGATAGATGAGTTTC
TTTTTTCTACTTTTTGGCTTCCTTTGTTTGTATGCCGCTTGGAATCTAAT
TATGTAAACTGCTGATGATATTTCACATTACAGCAAAGTGCGATGTTCCA
ACTCAGGATAATAAGTGGCATTTCTTCGCTGCTCGTGACAGAAAGTATCC
TAACGGTTCTCGGTCAAATAGGGCAAC
View all "STS050" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS087 CCTCCAGCTTCAAAGGAAGTCGTTGCGAATCTACCAGTTGTAACCGTGAC
GGAAGAAATCATAGCTAGATTGGGCAAAGAGACTCAGTGTGCTGTTTGCC
GGGAGAGCTTGCTGGTGGACGACAAGATGCAGGAGCTACCGTGCAAGCAT
CTTTTCCACCCTCCATGCCTCAAGCCATGGCTGGTAATGTCCACATAACC
CCTTTGAATGATCTGAAAGTAGCCTCGACGCATCGTTACAACTCGGTGTA
GCTGAACATTATACCCATCATGGTTGTGTTGTGTTGCACGCAGGACGAGA
ACAACTCCTGCCCGATCTGCCGGCACGAGCTGAGGACGGACGACCATGTG
TACGAGAGCCGGAAGGAGCGGGAGCGAGAAGAGGAGGAAGACAGGAAGGG
CGCCGCGA
View all "STS087" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS046 NNNNNNNNNNNNNNNNNNNGGTTCGCGGCGATCCACAAGGTGTTCGGCGC
CAGCAACGCCTCCAAGCTCCTCTCCCACCTCCCCGTCGCCGACCGCTGCG
AGGCCGTCGTCACCATCACCTACGAGGCCCAGGCCAGGCTCCGCGACCCC
GTCTATGGCTGCGTCGCCCAAATCTTCGCCCTCCAGCAGCAGGTACTATT
TCATTTCATGGATGAGAATGAGATGATCTCGTCGCTGCTCGATCGATCGA
TCGATCG----CCTCTCGGATTTGTGACTGATTCGATCGATGCTACATAC
AGGTCGCGATCCTGCAAGCGCAGCTGATGCAGGCCAGGGCGCAGCTGGCG
TGCGGCATCCAGAGCAGCTCGCACTCTCCGGTGAGCTGGCCGGACAGCGG
CAGCATCAGCGCGCTACTCCGGCAGGACATGGCGAGAAGGCCGCCCGGCG
GCGCCCTCGACGACTGCTTCGGTGGCGGCGGCGCGCTGCTGCCGGAGCTC
ATGGCGGCCG
View all "STS046" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS043 AGATTATGCAGAGTGTGAAGATATGCATGGCGAAGGCACTTGACAAAGCT
GCAGCTGATGGTCATAATATGGATGTTGGACTGAAGGCCATTGGTATTAC
AAATCAGAGGGAAACCACTGTTATGTGGAGCAAATCCACAGGCCTTCCTC
TATACAATGCCATTGTATGGATGGATGCTCGCACAAGCCCCATTTGCAGG
TCTTCCCTTTGTCCATCATGTTT-GACATATCAGTGTTATATAGTGCAGT
TTTCTCATAATGTTTGACCTTTCAGGAGATTGGAAAGTGATCTTTCTGGT
GGTAGAACCCACTTTGTCGAGACATGTGGATTGCCAATCAGTACCTATTT
CAGTGCTTTGAAGGTGTTATGGTTGATCGAAAATGTGGATGCCGTCAAGA
ATGCAGTCCGAGCTGGTGATGCCTTATTTGGCACAATTGACACCTGGTTA
ATCTGGAACCTCACAGGAGGCATTGGCGGGACAGATCGTGATGGAAATAA
AGTATTTGGGCAC
View all "STS043" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS021 TGGTTCCAGTCACTATGACATTGAGGTGGCACCCCGCCGGTTGGAAAGCT
TGATAATTTCTAGCGGTGAGGTCATCTACTCACTTGAGTTCTCATACATT
GACCACAGTGGGCAGCAGCACACATCAGGCACATGGGGCGGCTATGGCCC
AAATAAAGGGAACAAACGTACTCAGGTGACTATGAATCTTATTATTCAAT
TCTTGCATTTTTCTTCTAGATAAAATGATTGGTATACATTCATTATCTCT
GC-------TAGTGAAATTTATAATAGGTTTATTAGTAGTGTTATGTTAT
TTTGGAACTTCTCTTGCAGATTCAGCTTGGTCTTATAGAGTATGTAACAG
AAGTTTGTGGGACAATCGGACCATTTGATAGGGCACCCACTTGTGTTATT
ACATCGCTTACGTTTATCACTAACAAGGGAAGCTACGGACCTTTTGGAGA
AGTAAGAGGGACTCCTTTCCACATCCTAGTGCAGGACAATGGCAGCATTG
TTGGTTTTTTTGCGCGTGN
View all "STS021" genotypes
[ Download ]