grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "IRGC104119" from the experiment "Genome-wide patterns of nucleotide polymorphism in domesticated rice".

E.g., Germplasm "IRGC9542", RA4969, Basmati 1, Marker/locus RM22.

Items 1 to 25 of 100.       of 4 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
Oryza barthii-RA2740 IRGC104119     RA2740 STS068 GCCACGCGGACGGGGCTCAGGCCGTCGTCGTCGCGCGGCAACCGCGCCCC
GACGTCGTTCCGGTACGCCAACGTCAGCGCCGGCGATCTCCCGGCGAGCG
TCGACTGGCGCGGCAAGGGCGCCGTCAACCCCGTCAAGGACCAAGGCGAT
TGCGGTAAGCGTGCGTGGTGTTCGTCCCATTTTGCGTGAGGTGGCGTTCG
CCGCCATGGCGAGCTGAGAGCGTT---------CCTGCGTGCGTGTGCAG
GGTGTTGCTGGGCGTTCTCGGCGGTGGCGGCCATGGAGGGCGCGGTGAAG
CTGAGCACGGGGAAGCTGGTGTCGCTGTCGGAGCAGCAGCTGGTGTCGTG
CGACGTCAAGGGCGAGGACCAGGGCTGCGAGGGCGGGCTCATGGACGACG
CGTTCGACTTCATCATCAAGAACGGCGGCCTCGCCGCGGAGTCCGACTAC
CCGTACACGGCGAGCGACGACAAGTGCGCCACC
View all "STS068" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS055 CGACATGGCACTGCATTTCTGTGAGCGTTACAAGTCAGTTCTTTGCATCT
TATGTGAATGGGCTTGATATGTTATATAATTCTCTCTT----TTTTTT--
GCAACTT---ATTTACATCTCAAAACTGAAAATATTGTAAATACTCTACT
CAACTGAAACCCTCAGACGGAAGTTCTAATGTTGATGTTGAAAGGCGTCT
CAAAGTTGGGTCACTGTAATGATTATGATTTGGTTCTGTTTTACAGTAGT
ACTTACCATTCTATTTATTTGCAGGCTAATGGTTCTTAGAATCAGTTCAA
AATTTGAACTGAGAAGATTTTGCCGTACTACGGGGTCTATTGCACTTGTA
ATTTCTGATCTCAAGCTTTTGTTCAATTGCACAGTAGTATGTATATGCTG
ATGCATGTGCTCTTTCAAAAACAGTTGAAACTCAGCCGGCCAAATGCGGA
TGAATTAGGA
View all "STS055" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS027 GTGAACACCGGTTTCCTTTCCTTGTTAAGGTACAAGGACCCAAGACTATG
ATACTAGTTGTAATTATTCTTTTCAAATTTCCTGTAAGGCTGTAACTGTT
ACAACCCTGGCAGGTTAATAATTGGAATAGGTTCAATTGCAACAGTGGAG
GAACTCTTGTTGAGAAGTGCTGCCATTTTTTTGATTTGATGAGATTGTTT
GCAGCTGCAAACCCTGTTCGTGTGATGGCTTCTGGAGCCATTGATGTCAA
CCACAAGGATGAAGTTTATGATGGGAAGGTCAGGTTAATTGACTACAAGA
TCGCTGTTTTATAAGCTGGATGGCATTTTCACTCGTGTGATTATTTTTAA
GCTTATAAAGGCTATATTTATAAGCTGCAGGGCATTTTTTGTGCTTATCG
GGTTATGGTGGTCTCAATTTAAACAGCAGTCCCTGATTTTAAGTTCTTTC
TCAATGCAGGTTCCAGATATTATAGACAATGCATATGTAATAGTAGAATT
TGATAATG
View all "STS027" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS082 GCCGGATGTTCATCATCAACGCCGGTCAAGGATTCAGGCTTCTCTGGAAC
ACCGTCAAGTCCTTCCTCGATCCCAAGACCACAGCCAAGATCCATGTAAT
CCAATCCATCCACTATCTTTTTTATCTCAATGTCACATCGATCATTGCGT
AATTAAGCTACATTTGATCAATTTGCAACTAAACATTACATAATGTTTGC
ATTTATGTGCCTTGTTTTAACCAGGTCCTAGGCAACAAGTACCAGAGCAA
GCTGCTGGAAGTGATTGATCCCAGGTCTGAGCATGAACCTTCTAGAGTTG
TTCGTTCCTGCTTCTATGCAAATGCAAATGGAATCACCTTGAGTATTTAT
ATTAAAGCTGCTA--ATATCATTATTAAAAAGAACAAGATTGAGCAGCGT
GTTGAGCTCACTCCCTGTTATTTCGAGACAGC
View all "STS082" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS075 ACTCACATCTACTCAAGGTAGAGTACTCAATTTCTCATTGCTTTCACAGT
GATTTCACTGCTACTAGTGCCATGATCAGGCATTGCAATTTGCAAACCAC
ATTGGAGCTCCTGTAGATTAAATCTACTACTGGTAGTAGCTCATTGCCAT
TTGGTATTTTGATCATGATCCACAGAGGAGGAAGTCTTCTTCTTTTTCTT
GCAAGCCAAGCTCAGCAGCAGCTGACAAGGGATCATATGAAGAGGACTCC
TACTTTGAAGCACCC---TCACACTGCATGGGCAGGCCGGCTCCTGATTC
CTCTCCTGACCCTCTTCTCTCCCAGTTCATCTGCTGCAGCCTCGCTCCTC
CTGTCGATTCGCCGCGCCGCAGCGAAGCCGATGCCGAGGGCCATGGTTCA
TCTTCCTCAGATGATCAAAAAAGGTAAGAATTGTGCAGTTGGTGCTGTTG
GAGCAGCCTGAAATTTGGTAACAATTGTGCTGAATCTGAACAATGCTGAC
TGATCCAAATGCAATCTTTGATGCTTGCAGGAGAG
View all "STS075" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS019 TAGCAAATCATTCCAGTTGGGTATCAGCTTTGCTGGTGGTTACATTGCCG
GTGTCTTCTGTGCTATTGTTTCTCACCCGGCAGATAATCTAGTCTCTTTC
CTGAACAATGCCAAGGGTGCTACAGTGGGTGATGTGAGTTTATTACTTAT
TACAATGCTCTGGTATTAATGCATTGTGGTGCTTTGCTTTTGAAGTTTTG
TTGATGAACAACTGATTACAGTTATGTATTTCTGTAGGCTGTTAAGAAGC
TTGGTCTCTGGGGTCTATTCACTCGTGGACTGCCCCTACGTATTGTCATG
ATCGGTACCCTTACTGGAGCTCAATGGGGAATTTATGATGCATTCAAAGT
CATGGTTGGATTGTAAGTATCTTTCTTTATTATTACTGTCATTAGAACAG
CGTCATTATCTTTCGATTGAATCAGTAAATTGAGAATTCACTTTATAATT
TAACAGGCCAACTACCGGTGGTGTTACGCCAGCACCAGCCACTTC
View all "STS019" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS029 CCGGCGAGGGTGCCCCGGCGGCTGACCGCCGCCGAGCTCCTGCCGGTGAC
CCCGACTCCCCCCGCCGCCGAGAGGAGAACCACCCGGAAGCGCAAGTCCG
ACGTCGACTTCGAGGCGGAGTTCGAGCTTTTCGAG------------GAC
GACGACGACGACGATGAGTTCGAGCTTTCCGACGATGGCGACGAGAGTTT
GGCCGTGTCATGTGTGTCGTCCCCCAAGTCGAAGGCAGTACCTTCGTTTT
CTTGTACGATGAGATGGAGAAATCTTGCCTGCTTTCTTGAAGGATTTTCA
CCTGACGACAACCTGAACTTTACACGATTTCTTCTCCTGCTGTTGATTTC
ATCGATCGCCGGCGGCAGTTTCGTCGGATGTCTCCTCGAGCTCCAGGCCG
CGGCGGCGCGTGGCGGCGGCGGCGGCCGGTCGTCGGAAGGCGAGCAAGAA
GAG---------CAAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNN
View all "STS029" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS122 ACGGCTTCATGAACTTCATGCACCGCGACGAGGAGGTCGACTACTTCCCA
TCCCGCTACGATCCTGCCAAGCACGCCCCCCGCTACCCCATCCCCTCCGC
CACCCTCACCGGCCGCCGCGAGAAGGTAATTCTGTTGATTGATTTGCGTT
TGGGTTTTACATTTCACTATATTTTCTTTCTTAATTACTACTTCCCCCGT
TTCAGATTATAAGACGTTTTAATTTTAGTCAATCTCAAACTATAAGTTTA
ACTAAGTTTATAGATAAATATAGTAATAATTACAACACCAAATTAGTTTC
ATTAAATC--------TATAGTTCAATATATTTGTTATGGGTTAAAAATG
TTACTATTTTTTATATAAACTTAGTTAAATTTAAAA----TTAAACT--A
TCAAAGTTAAAACGATTTATAATCTGAAACGG-GGAAGTAGTAATAGCTA
GTCAATTTATTAACTGGTTTTGATCGATCGGGTTGC-GAGTGCAGGTGGT
GAT
View all "STS122" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS017 CATTTCTTTCTGCTAAACTTTGCAAGACTCGTCCCCTGGTAGTAGCAGCA
GCTATGGAGGTCTCGAAGGAAGCCCCTTCTGCTGACTTTGCCAATCGCCA
GCCTTCCAAAGGTTGTTGCTGAGAACTCCATCTTATTAAATTGATTGATA
TGCCTCTGCGGGTTGCACTGTTTCCAGTTCTAAATTTAATATAACTTTTG
TCCTTGCATGATTCTGTTAGGGGTTCTTGAGACATGGTGCAATGCCGATG
CAGTGTGTTTTGATGTTGATAGCACGGTCTGCTTGGATGAGGGTATTGAT
GAACTCGCTGATTTCTGTGGGGCTGGGAAGGCTGTTGCTGAGTGGACTGC
AAAGTAAATAACATGTTATGAACATTAGTTTTGAAGTGTGTTTGTTGCTT
AGTGCATAAAATTCATTCAGGATGCTCATTGGTTTAATATTCTTAGGGCA
ATGACAGGAAC
View all "STS017" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS117 AGGAAGAAGATCAGAGTCTTGGTACGTT---CATCAGAAGAATGCTATAG
AGAGAATGGAAGTGATTCAGCTTAGCTTACTGTTTTTGTGTTTGTTT-TG
TTCAGATGCTGACACTGTCAACGGAGAGGTTCATGAATATTCAGAGGGAG
GCCCCTGCGGAGTTCCAGCAGTATCTGGTCCAGGTCACCAAGTACCAGGC
TGCACAGAATTGCAAGGTAGTACGTACGTAAAATATAATTGAACTGGTCG
GTGCATCTAACTCAATCATGATGTCTT------------ACGACGGCGAT
GTCGGTCGTCGCAGACGTGGATCGTGGGGAAGTGGCTGTCGCCGAGGGAG
CAGCGGTGGGCGCCGGCGGGGACGCACTTCCACCAGTTCGTGGTGCCGCC
GATCATCGGGTTCCGGCGGGACTGCACGTACGGGAAGCTCGCCGCGATGA
GGCTGCCGGAGGACGTGGAGGGGCTGGGGACGTGCGAGTACACCATGGGC
CGCGGCGTCGTGCACGCGTGCCACGCCGGCGGCGTC
View all "STS117" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS036 GGCCCCCACCGACAACCTCACCGTCCTCCGCCAAAAGTTCGCCGCCCTCA
ACCTCAACGACGTCGACCTCGTCGCCCTCTCAGGTACTCGTATCACTTCT
CCGGCGAACTCAATTTCA-----GTTCTGCCGTCATGCCCGCCGGAGCTG
ACGACGACGACAATAATGCGAAATGCAGGTGGGCACACGTTCGGGAGGGT
GCAGTGCCAGTTCGTGACGGACAGGCTGTACAACTTCAGCAACACGGGGA
GGCCGGACCCCACCATGGACGCCGCCTACCGGAGCTTCCTGTCGCAGCGG
TGCCCGCCCAACGGGCCGCCGGCGGCGCTCAACGACCTGGACCCGACGAC
GCCGGACACCTTCGACAACCACTACTACACCAACATCGAGGTCAACCGCG
GCTTCCTCCAGTCGGACCAGGAGCTCAAGTCGGCGCCGGAGGCGACCGGG
ACGACGGCGCCCATCGTCGACCGCTTCGCCACCAGCCAGGCCGCCTTCTT
CCGCAGCTTCGCGCAGTCCATGATCAACATGGGCAACCTCTC
View all "STS036" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS007 AAAGATTTTCTGTCAGTTCCTGCGGCAGAAATGACTCATCTTCGGCCTTA
CAAAAATCAGGTGACAACCATGTTGCCTGCCAATCAGGACAACCACCTCT
GGCTGTGCATACTGAGCTCCAACATGACACTTCTATTGTAATATCCAGTG
GTGAAGAGAAGGTCCTTTTTGACCTTAATGTGCCAGCTGAAAGCATTGAC
ATGGAATCAACAATAACCAGTAATAGTTTTAGAGATAAGCTAGTGAAAAA
TGATGGAAGTGAAGAAACAGTAACCGATCATTCTTTCTCCAAGAGAAACG
GTGTGCATGCTGAAACTTCTATAGAAGAACGAACTGTTGGAGAACATCAT
ATATCAGTCAGCAAGGATGGAAACACCACATTTTTCCAAGAATCAATAAA
TAATGAAATTGATAAGGCGCAGTCTTCAGACCTTATAAGTGTTAGCAGCA
AACATTTGATTGCAGAAACTCCTCATGTTGACAATATTGTGTGTCCAGAA
CTGCGAGCATCTCCTGATGGA
View all "STS007" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS008 TTAAGCGGGCAATTGCAACGAGCATTTGTCACAGGTACACGCTTCCTCTA
CATGTATATTTTGTGTGTCTTATATCTAGTATTTCAGTTACACCTTACAC
CATGACCCATCAATCTTTTATCCCAGGTGTACCTTCATTGAAACGGTCTG
AGCTGGAAGCAGCATGTGAGGATTTCAGCAATATAATTGGTTCTACATCT
AGTTGCATGTTGTACAAGGGAACTTTATCAAGTGGAGTTGAAATAGCAGT
TTTGACAAGTTCAACAGAATCCGGGAAGGAATGGTCAAAAGAATGCGAGT
CACAGTACAGAAAAAAGGTAACATGTGCTCATAACTTTTAGGATATCCCC
TAAAATACAAATATGTTTTCTGTGGTGCAAATGACTTTTCTCAGAAATGT
GCGTATGCTTTTGCTCATCTTTACGGTGAGAATG-CTGAAATGGTTATGA
TTTCAGATCACAAATTTATCCAAAGTTAGCCATAAGAACTTTATGAATCT
GCTCGGCTATTGTGAAGAAGAG
View all "STS008" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS049 NNNNNNNNNNNNNNGCCCCTCTTTTAAAAGCCTACCTTGAAGATTCAAAG
AAGATACCCTCAAATTCAGATAACCTGAGTACTAGCACTGGCCAATCTGG
GGTAAGTGAAATGGTTCTATATAATTATTTGAAGTCAATGCTGACCTCCT
AATATGAAGTCTCTACTCTGTAAGTGGTATGTCCACAGGGCATTCTGAAA
TATGTTGATCAGTGCTTCTTGGTGGTATCATACTACTGTACCCCTGATTG
CTTGCTAGCAATGCATTTGATCCTTTTAGTCTCCAGAGGCAATTTCTTTC
AAGTGCTGCACTTGTTTCTTATACCAAATTAGAGGGTCTAATATTACTTC
TGTTGCAGAGCAATGCCAATAAGAAGGAGCAGTCTGCACTGCGGGCTGTT
ATAAAGTGTGTTGAGGACCACAAACTCGAAGCTGAGTTTCCATTGGAGGA
TCTCCGTGAGCGGCTG
View all "STS049" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS085 CCATTATGGTGTTGGAATTAAAGGGAAGGAACCCTCAGATTGTGGTGGGT
AAGAGATGGTGGTAGTGGAAACATATCAAAGTGTGGTGCTATTGACTAGA
GAAAAGTTGATGCAGGAAGGAAAAAA--CTGGAGATTGTGGCGGAGGGTT
GGGTTTGGTTTGGCTTTGGCCGGGGATAATAAATGATGGAGCTGTAGCCT
GTAGAATTAGGCCTTGTTTAGTTCCCAAAACAAAAACTTTTCACCCATCA
CATCAAATATTTGGACACATGCGTGGAGTATTAATTATGGACAAAAAGAA
AAACCAATTACACAGTTTACGTGTAAATTGTGAGATGAATCTTTTAAGCC
TAATTGCGCCATGATTTGACAATGTGGTGCTACAGTAAACATTTGCTAAT
GACGGATTAATTAGGCTTAATAAATTTGTCTCGCAGTTTCCTAGCGGAAT
CTGTAATTTGTTTTGTTATTAGACTACGTTTAATACTTCAAATGTATATC
CGTATATCCGATGTGACAACCAAACCCGAAAATTTTC
View all "STS085" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS080 CCTTTCTTATGCTTTCTCGGCACTTTTTAGGAAATTGAGTACATTTTATT
CTCTGTAAAACTAGGATAGCAGACAGCTTTTTCGATTCATTTTGTTGTCA
ATTTTCTGAAGGATGTTTCCTTTTCAGGCATTGACACCCCACATGCAAAC
ACTGGTGGAAGATATATCAAGTCCAAAGGCTGGGAGTTTGTTGGGACCTG
CTTTGGGTGATCAGCAACAAGGGAACTTCTCCACTCATCTTTGGAAAACT
GCTTTCCAAGATGCCTTCAGCAGAATATGTCCTCTTCGTGCTGGTGGACA
TGAGTGTGGATGCTTACCAGTGTTGGCAAAACTGGTATGTTTAATCATTG
ATATTTAATTTGAGAAGAATAATCATTTTTGTGAAGTTTATGCATGAGTT
GTTTTATTATTGTCAGGTGATGGAGCACTGTGTAGCTCGTTTAGACGTT
View all "STS080" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS024 TTCTTTTATAAGGTAATTCTAATTTTGTCCTGAAATGCATTAATTATTTA
CTCTACTTGTATTGCTAGCTAGCTAGCTAACAACATCATCGTGCTCTTCT
TGTTAGCTTTTCTCAAATGGCATGAAAGAATCTGATCAGAGGCATGCTAC
TCTTAGAATAACTGCTTCAGGTAATTCTGTAGTTCATTGTTCATTGTTTG
TTTCTGTTTGACAAAAACTATAATTTCTGCACAACCCTATGACTGTCTGT
AACGTTTTTCTTTATATTGCTGATATGATCAGTTTTGGTGGAACTTAAAG
CTTATATCGATCTGATATTTAATAGTCCTGAATATTTATTCAAATTGATA
TTCTAGAATTCAATGTTGTGCATTTTCCTATATCATCTCTCAAGAATTAT
CAAGAAGTGTATGCTTCATTTGAAACTTCTCCAAATGAGAATAAGGGAGA
TTTTTCTGCTATTTGATTTTCTTGTAAACAGAT--AGCTTTTATCTGATC
ATTGTATGCCTATCTGAAACAGA
View all "STS024" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS063 TGGTATTTCATCTACTTTATCTGCCTACGAAACTCTGTTGCTCAGAGGAT
ATGATGTGGGCTCAGTTATTTTGGAAGATCGTGGCTTGTCAAATGACAGA
TTCCTGCTTTCATACTTGAGAAAGAGGTGATTAATGCCTTTCTGTTCATG
GTCAAATCACTCTGGAAGTGTGAAGGAGCATAGAAGCATCTCTTTTATTT
GAATTATATTATCCTGTTAATAATGATT---TCAGTCTTTCATCTGGATA
TATTATAAACCTACTGCAACTTGCTTGTAATGTTGTTGTATTTCAATGTA
TGACTGATGTGTGCTATTTCTGTTATTTAGGGTACCTGTGCATGTCCTGC
CACCAATTCCAGAGGATCCCAAAGATGACCTAACTGATTGGTTTTCTGAG
TCATCCTCAGCTTTTAGTTCACTTAAAGATAGTCTGCAATCTTTTCATTC
AAGAAGAATTCAAAGGCTAAACAGTATGCAGAGAAAATCAAAGGATTTGT
TGTGG
View all "STS063" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS078 AAGGTCAGGCATCTCTTCGGCGTGTGCTTGTTGGTTACTCATTTCGTGAC
TCAGAAGTTGGATATTGCCAGGTAGGCATAAAGCAATGCTTTTCAAATGT
AACTGTTTTATAGAGAAGCTCCATTACTAACACCATGCTATGCAGGGTTT
AAATTATGTAGCTGCATTGTTGTTGCTTGTTATGAAGACAGAGGAAGATG
CATTCTGGATGCTTGCTGTACTACTGGAAAATGTACTTGTCAATGATTGC
TATACTGATAATCTTTCTGGATGCCATGTCGAGCAGAGAGTTTTCAAAGA
CCTCCTAGCTAAAAAGTGCCCCAGGTATTTCCCCCCCGTTATGTTTATGG
CTTTTATGCTATGATTTTTCATCAGTCGCTGGCAATAACAAGCATTACCA
TT-ATAAGATGATTGTGAATCATTGGATTACCCAAATGATGCAGGATTGC
TGCTCATCTTGAAGCAATGGGGTTTGATGTTTCTCTTGTTGCCACAGAAT
GGTTCTTGTG
View all "STS078" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS121 GACTTCCGAAAAGGCCGGCGCCTCCGAGATTTGGCCGGAAATTGACGGAA
TCGCAAAAGGTAAGCTCAAGATAGTTCTGTTTGCTTCTCAGAGCTTATGC
TGCCTGCAATCGTCTGCTCTTTCCAACTTTTAAGCCTCAACCTGCAAAGT
TGTGAATTGTCACAGGCTAGAGCAACACACATTTGCCTTGATTGTGGATA
CATATACTTCCTTCCCAAGCCTTTCGAAGAACAGGTAAGATTCACTTCAA
TTCTTTCACAGAGAATCAGTCTTTTGGCACTCACAGCCCGCAAAATCAGG
TGTATCCAACAATTCAACTAGTGCTTTTTATCCATTTCAGCCTGATGAAT
ATGGCTGCCCACAATGCAACGCACCAAAGAAGCGGTTCGCGAAATATGAT
GCAGAAACCGGGAGGGCGATTGGTGGTGCGCTACCACCTATTACAGTGAT
CGTCAGTTTGATAATCGGCAT
View all "STS121" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS009 GGTTGTTGACTATTCCTTTGGAGGTTATAGCTACATTAAGTGTGAGGCAG
TCCTAGAAGAGAACAAAATATGTGGGCATATTGGGCACCTTGATTGTGCT
CTCCGTACTTTTATGGCTGGAACAGTTGGAGGATGTATTGACTTGGACAT
GCAGTATTGTTGCAGACGTTGTGATAACAAAACGAACTTAATGCTGCACG
TAGAAAAATTCTTGGAAATATGCCAATCTCTTCAATCAAGGGATGACATT
GAACCTATCCTGAATACTGGCTTATGCCTAGTGCGTGGTTCAAGACAAAC
AAGAGCAAAAAGCTTGGAGAGCATTATGAGATCAGCAATGGCAAAGGTAT
GGTCAGTTTTATTTTTTT-AGCCACTTGTAGAAACTTCCATTTTGGTCAC
CATTTATCTTCTTTTTGATCTCTTATAAGTAGTTTGTGGCTATGCACTGA
TGGTTTACAACTATATGCAGCTAAAGTGTGGGGTTGATCTTGCTGAAGTT
View all "STS009" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS058 CTCACAGTATCTGACATAGCATCCCACATCCAGGTCCAGATTTCTATTTG
TAGACTAATCACACTCTTATTGTACTACATATAGTTCACTTTCACATCTA
TGATCTGTTCACTGAACCTCTCAGCTAGGCTGTAGTATTATGAACGATGA
TATTTCATCACATTTCATTAATAGCTCCTGTCCTTACTCCTTACCCATGT
AGCCATGTTTATGGGTTTTTCTTGAATGTAGCACGAGATTGAGTATGGAG
GTGACAATGCATTAACTTCACCGAGATCGCAACACGCATTCCAGAATCTC
CAAGCTCCAATGCACATCCCCAACACAAGCACGCAGCAGCCGCCATCTTG
TTCAATCACACCATCAAACCCTTCCAAGGACTCTATGATATTTTCGAAAG
CGCTATCCAGCCCTGTCCGGCAAAACCTGCAACTGTACCATGTACAGCAA
GGCGGTGACACAGGATGCTTTGCAGATGGCATTTTTTGCCCTGGAAACCG
TGACTCGGATCCTGCAGCATCAAATGATTCGTCGGT
View all "STS058" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS101 GAGATGTCAGAGAAGCCAACGTTGGCATCGCCCCTGAGCTTGCCGGCGTG
ATCGCCGACGAGGTCGACATCATCGTCAACTCAGCAGCAAACACCACTTT
CGACGAGAGGTTTTGTCATTCTCTGAACTGCAGTGTTGCTCCAAAGATGA
GTTCTTAATTGGATCACTTCATGTATAATAAGCATATGAATTGATCACTG
TTGCTGCATTTGGTTCGATTTTGCAGGTACGATGTTGCAATGGACATCAA
CACCGTAGGGCCATTCAGGATAATGAGCTTCGCGCAGCGGTTTCGGAGGC
TGAAGCTGTTCTTGCAAGTGTCAACAGGTCAGAAATGCATGTCAAATGAA
AAGCTCTTGTGCTGAAAACTTGCACTGAAATT-ACCTCCAAAAACCTTAG
ATATATCTCTCTACTGTGGATTTTGAATTTCATGTTTGGCAATCAGCATA
TGTGAACGGACAGAGGCA
View all "STS101" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS053 CCGAGCGCATGAGGGATTGCTTAAGAAATCTTAAGCAGCAGAACAAGGTA
GCATGTAGTTTCAACTTGAAATCATCTTCTATGTTACTCATATTTGTCAG
GCAGATTGACACATATCCTTCATTGCAT----GTGAATACAGATGCAACT
GTAAAGACTTGAGAATTCTATTGTTTGTTGAAACTATACCAAAAATTGTG
TTCTCCCTGTAGTTTTAGAGTGGAATCATTCAATGCTGATATAATCATAT
TATATGTTTGGTATTCAATTTGACCCAATTATGGGCCGTTTTTGCAACAG
GATGACGATGCTAAAGTGAAGAGGGCTTTTCAAACACTCCTTACCTACAT
TGGCAATGTAGCTAAAAATCCTGACGAGGAGAAATTCAGGAAGATCAGAC
TGACCAACGCTACATTTCAGGTGAAAATAATTACTGTACATATTGACCTG
GTAAAATGATCCACTGTTATCCTTTCGAGAACAACACGCGACTGATAATC
TGTTTCGGTACAATGCAGGAGAGGGTTGG
View all "STS053" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS081 AGGGGATAACTATTGCACTAATGTGATGACCAAGGTCGATTATTTAGAGC
ATGATTCCATGGATGATCAGGCATTGTTTTTGCATGAAAAGAACTTATTT
GTTCCAGAAGGAAGGAGCTCAGACAATTATAATAATGATGCTGCATCAAG
CAATCCACTTATGTGTGATGGTGTTGGTGGAAAAGAATTGGATGATGACT
CCTCCAGTTTGAAGGTATGTGCTTTTGTCTAATTATTCCATTGACAAAGG
GATAATATTGATTCAACACCTTTTAAGTGTTTCTTTACTGAGTGTTTCCA
TGCTTAATGAAAGACAGAAAGCTAACCTTTTTCCCCTTGCAGGGTACACA
TACTGTAAAGTTTGATGGCCAGCTCACCAGCTCTAACGCAACTACTTCAT
CGAGTAAACCTGATCAGCTTTTCTGGATAAATGGCTACATTTGTTCCATT
TGTGGATTTGAACTACCTCCAGGTTTTGAGGAGGAGAGACAAGAACATTC
AGATTTCCACTTGGCTGAAA
View all "STS081" genotypes
[ Download ]