grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "IRGC104119" from the experiment "Genome-wide patterns of nucleotide polymorphism in domesticated rice".

E.g., Germplasm "IRGC9542", RA4969, Basmati 1, Marker/locus RM22.

Items 1 to 25 of 100.       of 4 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
Oryza barthii-RA2740 IRGC104119     RA2740 STS012 AAAGGTTTCAAGTACAAAAGTCGAAGAGCTCCAAGTAGATGTGGCGTCTA
TGGATGTTGAAATCTCTGCGTTAATGAAGCTATTTAGAAAAATAACAGAA
AATGACCGAGCCCCTTACTCGAGGGAGAGAGCCGATGATTCATCTTTGGA
ATGTGAACCGGTTCAACTTGACGTAAGCTCATTTTTTCCTTGTTATAGTT
TCCTTTCGCTCTTCAACCCAAAGTACATCATGTAGTTTTACCACCTCTTT
GATGAGCGATTGTTTTT-CCTCAATACAATTGGCTAAACGTCCTACTTGA
TATGGGCAGGATATGGTTGGTGACATCGACATGGAGAAGATGGAGCAGGA
AATGTCTGCATACGCTACAGCTCTCGCTGCCGCGAAAGACAATCCTACTG
A
View all "STS012" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS065 TCTTTAAACATGCTTGCGCCAACTGCAAGCCAGCTTTTGCACACCATGAA
TTGTATATATGCTGTGAAAGGGTAGTCCTCAATAGGTAAACTGGATGCTA
TAGACCCATCCAAAACATTTTCCCCCTTCCATTAGGATATTATCCTGGAA
AAAACAAGTAGTGCTCGGTCCGAATTAGAAAAAGCAGAGATAACGATCAT
ACAATATGCTTGTCAGTGCTTCTTGTGCTCTACTTTTGCAGAAAGTTCAT
GTCCAGATACATTTAGTTTTGTTGATACATTTATTTTTGCTCTCCATAGC
TTGCTGTATAGACTTGTGTATGAGCTAAGACTTGG-TTTTTACCCCTTCT
ATTCTGTTTATAATGCCTATCCAGAATTTATAAATCTGTGTAATCCTTTG
TACCCTTTGGTTGTAGGTTTACATCAGAC
View all "STS065" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS059 TACAGTGAATTTGATCCATTACACCTCTCCTCTGACCTCTGCAGATTCAA
CCTCTGGTCATACTGAGCTATCTTTGCCAGAGGAAATTAATTCACATGGT
GGCATATCAGCTTCTAGTGGTGAGACATGCTTGGATCCTGAACATTTATT
GGATGTAAATGTGCTTCATTACCAGCTTTATGTTCAGAAAATTTTGTCTG
AAAGTTTAGCTTCTACTAGTTTTTAGTTTCTCATTCTTTTCCATATTGTC
ATGTCATAATTTTTGTAGGCTGTTCCCTTCTCTACATGTCTTACTAATTT
TATCTTGGATTGTTCATTACGCAGAGACTGGCAATCATGATTCCAGCCTG
GAGGAGTTTTGGGCTAATCTTTTAGAGTCATCTATAAAAAACGACCCAAA
AGTTGTTACTTCTGCCTGCGGTGGGATTTTTGACAAAGCTATGACAATTG
ATATTACTGTTGTAGAGTTATAATCCTGCTTATTGTATAAAACAGGTGGT
T
View all "STS059" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS096 ACCCCCTACTTCATCTGCTCCTCCAATGGTACACAATTCCTCAGTTTTGA
TTTAATATGCTCATATTTTGATTTTTCAATATGTGACCCAAGTGAGATGT
TATCATCAACTGAATATGGCAGTTTTGTCTGCACAATAATTCTCACCCAT
GTTCTTGATTGCACTGAATTTTCTGCTTTCTTAGCTTAAATGAAACCTTG
TC--ATGTGCTTTTACATATTCCATTTTCATAACCATAAGTGCAATCTAT
AATTTCAAATTATAGGTGCAAATATAATTTAGAGTAGCTCCCGGTGCTAA
CATGGGCATATTTGCAACATTCTGTTGATCTTATGG----AAT----ATG
AATAGCTTGAATTGAATATTGTGTTCTGTTCTCAGTATAGTGCAACCAGT
GTCCCAGTCAGTGGAGACAACAATGTTGTCCATAAGGCTGAGGATGTTGT
CAGCACCATGCTTGCTAAGGGGTTCACCCTGGGGAAAGATGCCGTTGGCA
AGGCAAAAGCTTTTGATGAGAAGC
View all "STS096" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS036 GGCCCCCACCGACAACCTCACCGTCCTCCGCCAAAAGTTCGCCGCCCTCA
ACCTCAACGACGTCGACCTCGTCGCCCTCTCAGGTACTCGTATCACTTCT
CCGGCGAACTCAATTTCA-----GTTCTGCCGTCATGCCCGCCGGAGCTG
ACGACGACGACAATAATGCGAAATGCAGGTGGGCACACGTTCGGGAGGGT
GCAGTGCCAGTTCGTGACGGACAGGCTGTACAACTTCAGCAACACGGGGA
GGCCGGACCCCACCATGGACGCCGCCTACCGGAGCTTCCTGTCGCAGCGG
TGCCCGCCCAACGGGCCGCCGGCGGCGCTCAACGACCTGGACCCGACGAC
GCCGGACACCTTCGACAACCACTACTACACCAACATCGAGGTCAACCGCG
GCTTCCTCCAGTCGGACCAGGAGCTCAAGTCGGCGCCGGAGGCGACCGGG
ACGACGGCGCCCATCGTCGACCGCTTCGCCACCAGCCAGGCCGCCTTCTT
CCGCAGCTTCGCGCAGTCCATGATCAACATGGGCAACCTCTC
View all "STS036" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS001 CCGCCGAGGAGATGGTCGTCCTCTCCGGCGCCCACACCGTCGGCCGCTCC
TTCTGCTCCTCCTTCCTCGCCCGCATCTGGAACAACACCACCCCCATCGT
ACGTACATAG----------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
CTCCATCGCCGTCGA------------CCTCGCC----------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
---------------------------GCCATT-GACCATCTCGCCATTG
ACG-GCGGCTCACATG---GCGGCGGCCGGTGTGTTCGATCGTGTGCAGG
TGGACACGGGGCTGAGCCCGGGGTACGCGGCGCTGCTGAGGGCGCTGTGC
CCGTCGAACGCGAACGCGTCGACGCCGACGACGACGGCGGTGGACCCGAG
CACGCCGGCGACGCTGGACAACAACTACTACAAGCTGCTGCCGCTCAACC
TGGGGCTCTTCTTCTCCGACAACCAGCTGCGGGTGAACGCGACGCTGAGC
GCGTCGGCAAGCAGCTTCGCGGCGAACGAGACGCTGTGGAAGGAGAAGTT
CGTCGCCGC
View all "STS001" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS123 GATGCATCATACACATTTGGCATAATTGGTTCGTCTTTTTTTTT-CTCAA
GTATTTTTTT-GTTAACAGCATGTGTCATCGAATTACTTTGGATCTCTGC
AACATCTCTTCTAGGATTTTACCTAGGTTGCATGAGTCATATAAGATAGA
TCTCAACAAGATTATACTATCAGAAGGACTGGAAACACATCCTCTGTTCT
TGTCAAACATCCTAGCTTTAGGATAAGGGAATACATGAAC----------
--------GGAAAAAATGGGGATCAATGACTTCATGGAAAGAACCACTAT
GTCAAGATATGGTTATAGTG---------TCCAAGCTTGTTGATACTAAA
GTCTTCTGGCTGTGCTTTGCTAGGTGATCTGGGGCAGACATTTAATTCCC
TCTCAACCCTTCAACATTATGAGAAAACCGAAGGTCAAACTGTTTTATTT
GTTGGGGATTTGTCATATGCTGATAGATATCAACATAATGACGGTGTTCG
TTGGGATTC
View all "STS123" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS109 CGACGTCGAGGACGCTGGTGCTCGCCAACTCCGCGCCGGTGCTCGCCGGG
CAGCGCCGGTACGCCGTCAACGGCGTGTCGTTCGTCGTCCCCGACACGCC
GCTCAAGCTCGTGGACAACTACAACATCGCCAATGTCATCGGCTGGGACA
GCGTCCCGGCGAGGCCCGACGGCGCGGCGCCGCGTTCCGGGACGCCGGTG
GTGAGGCTCAACCTGCACGAGTTCATCGAGGTGGTGTTCCAGAACACGGA
GAACGAGCTGCAGTCTTGGCATCTCGATGGATATGACTTCTGGGTTGTTG
GGTAAGCTACATTCCCATCAACCACTGAAACTTTCACACATTTCAGTTGC
ATCAATTCTCAGATGAACATCAACATGAGAAAGATCTGTTCATTCACCTT
TGATGATTTCTTTCTCTGATAAATGGATTCAGGTATGGCAATGGTCAGTG
GACTGAGAATCAGCGAACAACCTACAACTTGGTTGACGC
View all "STS109" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS110 TGATGAGAAGAAAGGTACATGCA--ACAAATTAACAATATGATCGATCGA
CGATAACGAACTGAATGGGAAGATTATTTCCTTAGTTATATATACCCACA
CAAATAATTCAATATGTATTGATCGGTCAATCGATCTGTAATTAATTAAT
TTGATCTGTTTTTGTTGAGTATAGTTCGGCTGATGAGGAACCGCTCGCTG
ACCAGGGAGGAGGTGGACGCGTTCTGGAGGCGCCAGCAACGGAAGCAGCC
ACCGTCGTCGTCGACGTCGTCGGAGCCCAACGCCACCACCTCGCCGCTCG
CCTCTCCCCGCGCCGCCGCCAACGTCGTCTCGCCGCTCGCATCACCCCGC
GCCGCCGGCGACATCTCGCCGCTCGCCGCCTCTCCCGGCCGCGCGGTATG
TAATTAAACTAATTAAACATGCATCGATATAT--------TCTTGGACTG
AATTAATCAATTAATATAATTAATTCTCTCATGCAGCAGCAGGAGATGAG
TAGTAGTCGTTGCACGTTGG
View all "STS110" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS031 ATTGCCCAGCCAAAGGTTAGAACTTGTTTACCAGTTTGCATTTTGTTTGG
TATCAACTGTCATTATTAGTGGAAAATATTCACCTTTGATTTTTACAGGG
TGTCCTTCTTTACGGACCTCCGGGTACAGGAAAAACGCTACTAGCTCGGG
CAGTTGCTCATCACACCGACTGTACCTTTATTAGGGTGTCAGGTTCCGAG
TTGGTTCAGAAGTATATTGGAGAGGGTTCCAGAATGGTTCGTGAACTATT
TGTGATGGCCAGGTAAACATTTTCTGTTGATGATACATTGAAATTTACCA
TATATTCAATGGGATCTGAAAATCCTTCATTGGGAAGGATGCTTGCATTG
CTTTACACTATTCAGTAGGCTGACGTCTTTGGTTTGAATTTTGACAGAGA
GCATGCACCATCCATAATCTTTATGGATGAAATAGACTCCATTGGATCTG
CTAGAATGCAGTCAGGATCTGGGGGT
View all "STS031" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS024 TTCTTTTATAAGGTAATTCTAATTTTGTCCTGAAATGCATTAATTATTTA
CTCTACTTGTATTGCTAGCTAGCTAGCTAACAACATCATCGTGCTCTTCT
TGTTAGCTTTTCTCAAATGGCATGAAAGAATCTGATCAGAGGCATGCTAC
TCTTAGAATAACTGCTTCAGGTAATTCTGTAGTTCATTGTTCATTGTTTG
TTTCTGTTTGACAAAAACTATAATTTCTGCACAACCCTATGACTGTCTGT
AACGTTTTTCTTTATATTGCTGATATGATCAGTTTTGGTGGAACTTAAAG
CTTATATCGATCTGATATTTAATAGTCCTGAATATTTATTCAAATTGATA
TTCTAGAATTCAATGTTGTGCATTTTCCTATATCATCTCTCAAGAATTAT
CAAGAAGTGTATGCTTCATTTGAAACTTCTCCAAATGAGAATAAGGGAGA
TTTTTCTGCTATTTGATTTTCTTGTAAACAGAT--AGCTTTTATCTGATC
ATTGTATGCCTATCTGAAACAGA
View all "STS024" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS079 GGTTCAGTATATCTCCATTTGGGAACAATGCTCCTGCTACTGAGGTGGAT
AAATCACTCTTCAATGTAAAAGTGATCACAGGCCCAAAGAAATCTACAGA
GCAAAAGCTTTCAAATGGGTCTCCACAAAATGTAGTGCACCTGGACATAT
TCAAAGGTAATTCCCCTGAGCTTTTGACTTGGATCATTCAGTTGTAGTTG
AACATATAATAGAATGAGGCGTTTTGGTTTGTCTTGTGAATTGGTGGGAT
AAACAGTTGGTTTTTAATGCAAGATGTAAAGTTGAAGTCTAGTAGTGTTT
GTTTTGCAATTTGCAACGCTCATTTTTGATGCTATCTTATCTTCTGTCTC
CGCGCTCTTTATTTTGTTACAGGAACAAAAGGAGGGGATGTGTGTGAGGA
TGAAGGGATGGTGAAAGATTGCCATCCATTCAGAAAGGGGAGGGATGAAA
TATCTCTAAAACCCATAGAAGTGAGGAAGAAAGTTGGGGGTGGACAGTCA
TGCTCGGATGCAGAGATCGA
View all "STS079" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS003 TTCTGGGAATAAAGAAGACAACACCAGCTATCGCATCAGCCATGCCAAAC
TTGAGCCCTGGACTCATCTTCATCATTGCGGCTTGTTTCAGGTATAGTAG
TAGCTGCTTATAGATGAAGCTGCAATTGATGACCTACCTAAGATATATAC
ATTTACCTGAATTATTACATATACTTAAGGTTGGAGAAGTTTGACAAGGG
ATGCAAGTACACAAGAGCCAAGATACTGGGAACGTTGGTGTGCTTGGTGG
GAGCTATGGCCATGAGCTTCTTGCAGAGTCCCGTTTCGTCTTCTCCACAA
CTCACAACAACTAGTTACTATGACTGGATCCTTGGTTGCTTCTACCTTTT
CCTGGCAGTAGTTGTTCTCTCTATCTACACGGTGCTCCAGGTAATCATCA
ATTACTACTAATTCACTCACTCTACATACATGCATG----TAGTTTCATT
GTTAGCTAGCTGCTCATGGATTACTGAAACTTGCAACAATATATACTCAT
GGTATTATTCAGGCAGCGACGTTGGTGAGCTTCCCTGC
View all "STS003" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS125 ACGGTGGCGATATTTGGTCTAGGAGCTGTAGGCCTTGCTGTGAGTGTCTG
AACTCACCTTGAATGTTCTCAATTACAATGAGAGATCCATCTAATTACTC
TACATATTGTCTGATTAGGCCGCAGAAGGTGCAAGGATTGCAGGAGCGTC
AAGGATCATTGGCATTGACCTGAACGCCAACAGATTTGAAGAAGGTAAAA
TCCTCTTGATTTACCAGATCATCAGTTTGTTTGATGGTCTTTTAAAGTCA
TCTTATATATTTTGTATATCTTCAGCTAGGAAATTTGGTTGCACTGAATT
TGTGAACCCAAAGGACCATGACAAGCCAGTTCAGCAGGTATGTATGTTTC
CTTACATCAGGAAAAGGAAAATCTGTATCACTTGATTGTACTGATACAGT
GTGTTATGGTAATTTAGGTACTTGCTGAGATGACCAATGGCGGAGTTGAC
CGCAG
View all "STS125" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS080 CCTTTCTTATGCTTTCTCGGCACTTTTTAGGAAATTGAGTACATTTTATT
CTCTGTAAAACTAGGATAGCAGACAGCTTTTTCGATTCATTTTGTTGTCA
ATTTTCTGAAGGATGTTTCCTTTTCAGGCATTGACACCCCACATGCAAAC
ACTGGTGGAAGATATATCAAGTCCAAAGGCTGGGAGTTTGTTGGGACCTG
CTTTGGGTGATCAGCAACAAGGGAACTTCTCCACTCATCTTTGGAAAACT
GCTTTCCAAGATGCCTTCAGCAGAATATGTCCTCTTCGTGCTGGTGGACA
TGAGTGTGGATGCTTACCAGTGTTGGCAAAACTGGTATGTTTAATCATTG
ATATTTAATTTGAGAAGAATAATCATTTTTGTGAAGTTTATGCATGAGTT
GTTTTATTATTGTCAGGTGATGGAGCACTGTGTAGCTCGTTTAGACGTT
View all "STS080" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS038 TCCAGCGCCTTTCAAGCCCCCATCCGGGGGTAGCACTAGTGATATCGTCG
AAGCTTCTGGCACAGCAAAACCTGGGGAAGTTGTTTCTGCCGCAGAGAGC
AATGTTGCTTCCAATGTGAACAGCACCATCTCTAGGCCTGTGCCCCCACG
GCCTTGGCAGCAGCAAGGATACGGAAATTCTTATGGAGGTAATCATTAAT
TCTGTAATCGCATAATCAGATACACTTAGTGGCTCAGAATCTTAACCTCT
CGATCAAAATGCAGGTTATGGCTCCAGTATGTATGGTTCGCTTGGTGGGT
TTGGTGGACCTTATAGTAGCGGCGGACTTTACGGAAATAACATGTATTCA
AGTTATGGAGGAGGTTATGGGGGTATGTATGGAAGTTCTGGAATGTACGG
TGGGTCCATGTATAATAGCGGGATGGGAGGTCCCTATGGTGGCTATGGTA
TGGGCATGGGTGCTTACAACCAAGGTCCAAATTCATTTGGGCCACCAGCA
CCACCCC
View all "STS038" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS058 CTCACAGTATCTGACATAGCATCCCACATCCAGGTCCAGATTTCTATTTG
TAGACTAATCACACTCTTATTGTACTACATATAGTTCACTTTCACATCTA
TGATCTGTTCACTGAACCTCTCAGCTAGGCTGTAGTATTATGAACGATGA
TATTTCATCACATTTCATTAATAGCTCCTGTCCTTACTCCTTACCCATGT
AGCCATGTTTATGGGTTTTTCTTGAATGTAGCACGAGATTGAGTATGGAG
GTGACAATGCATTAACTTCACCGAGATCGCAACACGCATTCCAGAATCTC
CAAGCTCCAATGCACATCCCCAACACAAGCACGCAGCAGCCGCCATCTTG
TTCAATCACACCATCAAACCCTTCCAAGGACTCTATGATATTTTCGAAAG
CGCTATCCAGCCCTGTCCGGCAAAACCTGCAACTGTACCATGTACAGCAA
GGCGGTGACACAGGATGCTTTGCAGATGGCATTTTTTGCCCTGGAAACCG
TGACTCGGATCCTGCAGCATCAAATGATTCGTCGGT
View all "STS058" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS094 ACAAGTTGAGGGTGGAGATCGGGAATTTGCCCGAGGAGAAAATGGGGAAT
GTGCTACAGATTGTGCAGAAGAGGAATACCGATCCGGCGCTAATGGGAGA
GGTCGTTGAGCTTGATTTCGACGAAATGGATGTCGAGACGCTGTGGGAGC
TCGATCGATTTGTGGTCAATTGCAAGAAGGCGCTCAGCAAGAGCCGGAGG
ACTGTCGCGATGAACGGTGATGCTGTTGATGCGACTGCTATTGTTCCAAT
TGAGGACGATACCGTGCAGGTGAATGTGCATCATCAGCCTGCGGTGGTTG
AAATTGGGAACTCGGTATGGCAATGTTGCAATCCTTTGTTCTGTGTGATG
ACTAATGCTTGAATTGTGTTCTCATGTTTTGTTTATGTTGCACTTTTGCA
GGAGAATGACATGCCGGAGAAGAGGGTTTCAGAGGTTGATATGGTTGATG
AGTATGTTGATATTGGCGATGAGATGCC
View all "STS094" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS037 CCCACGAATTCATGAAAAATTCCCAGGTTCAGAATCTATACTTTCATTAT
CTAAATTTAGAAACCAACTGCTGTATAAGACTATAAGATTCAACATAAAT
TGCATAATCTTTCTTGAAGGTTGTAAGGAATCATCCTGGTGACCAAAGTT
ACTGGCATCGCCATAGATCAAAGGGTTCTTGGACTCTTTCCTCTGCAGAC
AATGGGTGGGCTGTGTCTGACACTACAGCAGAAGCACTGAAGGTCATTAT
GTTCTTTGTTCTTTTCCTGGTTACTAATGTAGGCAAATGAGGTATAAAAC
TAGTGTCATATTAATCCAGTCCTAATCGGTGACAGCACATCGAAGAAGCT
CATGCATATAAAAAATATTGGCCTTGATATATTCCCAATTCTGCATAATT
TCTATTATGTCTACCCTAGAAATCTTACATAATTTCATTTCCAGGCTGTA
TTGTTGCTGACAAAGATATCTAGTAGCATGGTTGGGGATCCCATTGAAAG
AGAAAG
View all "STS037" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS087 CCTCCAGCTTCAAAGGAAGTCGTTGCGAATCTACCAGTTGTAACCGTGAC
GGAAGAAATCATAGCTAGATTGGGCAAAGAGACTCAGTGTGCTGTTTGCC
GGGAGAGCTTGCTGGTGGACGACAAGATGCAGGAGCTACCGTGCAAGCAT
CTTTTCCACCCTCCATGCCTCAAGCCATGGCTGGTAATGTCCACATAACC
CCTTTGAATGATCTGAAAGTAGCCTCGACGCATCGTTACAACTCGGTGTA
GCTGAACATTATACCCATCATGGTTGTGTTGTGTTGCACGCAGGACGAGA
ACAACTCCTGCCCGATCTGCCGGCACGAGCTGAGGACGGACGACCATGTG
TACGAGAGCCGGAAGGAGCGGGAGCGAGAAGAGGAGGAAGACAGGAAGGG
CGCCGCGA
View all "STS087" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS103 GGTTAATACCTGGCTTCAAAGGCAAGGGCATTTCAACATACTGCATAAGA
AGCATTCTGTAAGTACTCTAGCCCAAACTGGCATGTAAAGAAAGTTAAGT
TCAGTAATCAACCTAACCTGGAATGCAGGTTACCTTGCCAGATCAATTCA
TCGAAGGGCTGTCAAGTGCTTGTTTGCAAGGACGAGCACAGATTGTTCCA
GATCCGGAAGTGCTGTCCAAAGACAGCAGTTCCTTAATTTTCTATTTGGA
TGGAGCACATAGCCCAGAAAGTATGGAAATTTGCGCGAAGTGGTTTTCCT
GTGTTACAAGAAAGGATGAACAACAACCAGGCCCTTTGGATCAGCTACAT
ATTGGCACCAATTCTAGGAAGGTATGCCTTGCAGTTGCAGTGAGCCAGTG
AGAGGTCTCTCTCTCTCTC------------TGTCTGTGTGTGTGTGTGT
GTGTG--------------------------------GCTCATATCATTG
TTCTTTCTTTCTTATGAGCAGTCTTTGTTTGTGATCCTTGCAG
View all "STS103" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS018 GTGTATTTTGCTCATTGCACGTCAGAGATGATATTCATTACTCATTTGCT
CACAGAACAACCTGAGAAACTTGCTGGCCCTCTGCTGGCTGATACTTATG
TTACTCTCCTGAAAGGTCGCAATGCGTGGTATGGGCAAATGCTAGCGAAG
GGAGAACTGAGCCCTGACATGGGCGACAGCATCAAGGGGAAGGGGATGAT
TCAGGTTATCTCATAAAACTACTCATTATTTTCCCCGAAAGTTATATGAA
TTTTGAGCGTATTTTTGAAGAATGCTGGAAGTCAAAACTTGCAAAAGATA
TCACATCATCCTGGATATAACCTGTTCACTTTTCACTATACAGGGTATCT
CTGCTGTTGGTGCATTTTTTGAGCTTCTCAGTCAACCCAGCTTAAGTGTG
CAACACCCAGAGGAAAATAAGCAAGTTGCAC
View all "STS018" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS028 GTGAACACCGGTTTCCTTTCCTTGTTAAGGTACAAGGACCCAAGACTATG
ATACTAGTTGTAATTATTCTTTTCAAATTTCCTGTAAGGCTGTAACTGTT
ACAACCCTGGCAGGTTAATAATTGGAATAGGTTCAATTGCAACAGTGGAG
GAACTCTTGTTGAGAAGTGCTGCCATTTTTTTGATTTGATGAGATTGTTT
GCAGCTGCAAACCCTGTTCGTGTGATGGCTTCTGGAGCCATTGATGTCAA
CCACAAGGATGAAGTTTATGATGGGAAGGTCAGGTTAATTGACTACAAGA
TCGCTGTTTTATAAGCTGGATGGCATTTTCACTCGTGTGATTATTTTTAA
GCTTATAAAGGCTATATTTATAAGCTGCAGGGCATTTTTTGTGCTTATCG
GGTTATGGTGGTCTCAATTTAAACAGCAGTCCCTGATTTTAAGTTCTTTC
TCAATGCAGGTTCCAGATATTATAGACAATGCATATGTAATAGTAGAATT
TGATAATG
View all "STS028" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS057 CCACTGAGCTACAGGGGAGCGGATATATTTGTGCTGGCATTCTCACTGAT
CAGCAGAGCAAGCTATGAGAATGTTCTCAAGAAGGTAGGTACTATACTCC
ATTTAGTTCAGTTTGGACTCAAAATGTCTGAACATCTGACAACATGAGGA
TAGTGACCACAGATACTGTACCAAGAACTTTACCTTTCCTTGTGACAATG
ACATTTTTAGACCACCTTTGACCAATATTCTTCACATTTTTCTTCTTTAC
AGATATATACTATATGTGCATATGATTTTCACTGGAATATTCTGAGCTAA
TGTTATCTTTTTCTGTTTCTGATCATGCAGTGGATGCCGGAGCTTCGCCG
GTTCGCACCGAATGTTCCAATTGTTCTTGTTGGGACCAAGTTAGGTTTGT
ACCGGATGCAACATTAACTCAACAAAGCTCAGTGCCACTTCCTTTTGCAG
GCTTGTTTCAATGCTCTTAGGTTTTAACCGTGCTTGCTTCCAATTGTTCA
GATCT
View all "STS057" genotypes
Oryza barthii-RA2740 IRGC104119     RA2740 STS056 CCATTATTATTGCTTCGTTCGAACTTCCAGTGGAATGTGGCACAACCTTG
ATGATAACCAGGTCTAGCATGATATTTGCCATTACGTGAAGCTTTACTGT
TTCATTTTTAGTTGATAGTTGATAGTCATATCACAACCTTCCATTAGCTG
CTTAATTGGCTATTTTATTTTAATCTTGCGCTTGGCCATATGTATGTGAG
GGAGTACAGTGACTCTAGTGCATGGTGGATGCTACTTTATTCCTCTCACT
AATTCAGCAGACTTTAGCTTCCCTTGTACTGATCCTTGTGGACAACTTCA
GGTACGCCAAGTCCGTGAGGCAGATGTATTGAGACAGAAAGCATATATGT
TATTTTATGTACGTGACAGAGTTGGGAATCCAACTCCACGCAAGGATAAT
ATCACTGCTAATATGCCAGCCAAGAGAACAATACCTGAAAAGATCTCAGG
TCTGAGTGGTATGATCCAGAGCGGCGTAATTGAAGCAAAATTGAATGGTT
CCT
View all "STS056" genotypes
[ Download ]