grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "IRGC6663" from the experiment "Genome-wide patterns of nucleotide polymorphism in domesticated rice".

E.g., Germplasm "IRGC9542", RA4969, Basmati 1, Marker/locus RM22.

Items 1 to 25 of 204.       of 9 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
Mudgo IRGC6663 indica   RA5282 STS070 AAAAACAGAAGTGTGGTTACATTTGGTGAGCTTAAGGGACTGAAAAGATA
CAGCTCAGTGTTCAAGGATACTGAAATTAACGACTTAATGGAAGCAGTAA
GTGGTCACTGTTATTGCAAAATACGATGCAAA-A-TGTACTGTAGCACAC
--AAACCATATACATGGTATCTGTAGTATATAGACTGGATATTGTTTGTC
AACCTTTTGATCATGCTGCTTTTCAGAATTCTGTATTGTTTTGAATGTGT
GTGAAAAGTCGGGGCCAACACATTCATGTCAAAAGATTACTTAAACCATT
GGTTTAGTTGAAATGGAGTATGTCATGCATCTGTGATGAAATACTGTCTT
CATTGCAGAACTGATTTATATATTTTAACCTTTTTGAGTACTACTTCAGG
CTGATGACACCACCTCCACCATCAACTGGGAAGAGTTTATTGCTGCAGCA
GTGTCTCTTAATAAAATAGAACGTGAGAAACACTTGATGGCAGCCTTTAC
ATAC
View all "STS070" genotypes
Mudgo IRGC6663 indica   RA5282 STS070 AAAAACAGAAGTGTGGTTACATTTGGTGAGCTTAAGGGACTGAAAAGATA
CAGCTCAGTGTTCAAGGATACTGAAATTAACGACTTAATGGAAGCAGTAA
GTGGTCACTGTTATTGCAAAATACGATGCAAA-A-TGTACTGTAGCACAC
TTAAACCATATACATGGTATCTGTAGTATATAGACTGGATATTGTTTGTC
AACCTTTTGATCATGCTGCTTTTCAGAATTCTGTATTGTTTTGAATGTGT
GTGAAAAGTCGGGGCCAACACATTCATGTCAAAAGATTACTTAAACCATT
GGTTTAGTTGAAATGGAGTATGTCATGCATCTGTGATGAAATACTGTCTT
CATTGCAGAACTGTTTTATATATTTTAACCTTTTTGAGTACTACTTCAGG
CTGATGACACCACCTCCACCATCAACTGGGAAGAGTTTATTGCTGCAGCA
GTGTCTCTTAATAAAATAGAACGTGAGAAACACTTGATGGCAGCCTTTAC
ATAC
View all "STS070" genotypes
Mudgo IRGC6663 indica   RA5282 STS049 AAAAATTCCCCCCAGCCCCTCTTTTAAAAGCCTACCTTGAAGATTCAAAG
AAGATACCCTCAAATTCAGATAACCTGAGTACTAGCACTGGCCAATCTGG
GGTAAGTGAAATGGTTCTATATAATTATTTGAAGTCAATGCTGACCTCCT
AATATGAAGTCTCTACTCTGTAAATGGTATGTCCACAGGGCATTCTGAAA
TATGTTGATCAGTGCTTCTTGGTGGTATCATACTACTGTACCCCTGATTG
CATGCTAGCAATGCATTTGATCCTTTTAGTCTCCAGAGGCAATTTCTTTC
AAGTGGTGCACTTGTTTCTTATACCAAATTAGAGGGTCTAATATTACTTC
TGTTGCAGAGCAATGCCAATAAGAAGGAGCAGTCTGCACTGCGGGCTGTT
ATAAAGTGTGTTGAGGACCACAAACTCGAAGCTGAGTTTCCATTGGAGGA
TCTCCGTGAGCGGCTG
View all "STS049" genotypes
Mudgo IRGC6663 indica   RA5282 STS049 AAAAATTCCCCCCAGCCCCTCTTTTAAAAGCCTACCTTGAAGATTCAAAG
AAGATACCCTCAAATTCAGATAACCTGAGTACTAGCACTGGCCAATCTGG
GGTAAGTGAAATGGTTCTATATAATTATTTGAAGTCAATGCTGACCTCCT
AATATGAAGTCTCTACTCTGTAAATGGTATGTCCACAGGGCATTCTGAAA
TATGTTGATCAGTGCTTCTTGGTGGTATCATACTACTGTACCCCTGATTG
CATGCTAGCAATGCATTTGATCCTTTTAGTCTCCAGAGGCAATTTCTTTC
AAGTGGTGCACTTGTTTCTTATACCAAATTAGAGGGTCTAATATTACTTC
TGTTGCAGAGCAATGCCAATAAGAAGGAGCAGTCTGCACTGCGGGCTGTT
ATAAAGTGTGTTGAGGACCACAAACTCGAAGCTGAGTTTCCATTGGAGGA
TCTCCGTGAGCGGCTG
View all "STS049" genotypes
Mudgo IRGC6663 indica   RA5282 STS099 AAAACTTTTACAGATCTCTTCGATTACTTCCCCTTGACAGCATTGGTGTG
TATTCAGCATTTTCATATGTATATGCCAACATCCTTCCCACATTATCTAG
TGAATCTGACAGAAGCTGTTCATTTGTTCTGTAGGTTGAGTCAGAAATAT
TTTGCCTGCATGGTGGATTATCGCCATCCATTGAGACACTTGATAACATA
CGTAACTTCGATCGTGTCCAAGAAGTTCCCCATGAAGGGCCCATGTGTGA
TCTTCTGTGGTCTGATCCAGACGATCGATGTGGTTGGGGTATTTCTCCTC
GAGGTGCTGGATACACCTTCGGGCAGGTAACATTTTATATAAGAAAAAGA
AT--CTCTATATTTAGCTGTGCACCTCATGTTCATCGACTTATCAATTCT
ATCATTTCAGGATATATCAGAGCAGTTCAACCATACCAATAATTTAAGAC
TTATTGCTAGAGCTCACCAGTT
View all "STS099" genotypes
Mudgo IRGC6663 indica   RA5282 STS099 AAAACTTTTACAGATCTCTTCGATTACTTCCCCTTGACAGCATTGGTGTG
TATTCAGCATTTTCATATGTATATGCCAACATCCTTCCCACATTATCTAG
TGAATCTGACAGAAGCTGTTCATTTGTTCTGTAGGTTGAGTCAGAAATAT
TTTGCCTGCATGGTGGATTATCGCCATCCATTGAGACACTTGATAACATA
CGTAACTTCGATCGTGTCCAAGAAGTTCCCCATGAAGGGCCCATGTGTGA
TCTTCTGTGGTCTGATCCAGACGATCGATGTGGTTGGGGTATTTCTCCTC
GAGGTGCTGGATACACCTTCGGGCAGGTAACATTTTATATAAGAAAAAGA
AT--CTCTATATTTAGCTGTGCACCTCATGTTCATCGACTTATCAATTCT
ATCATTTCAGGATATATCAGAGCAGTTCAACCATACCAATAATTTAAGAC
TTATTGCTAGAGCTCACCAGTT
View all "STS099" genotypes
Mudgo IRGC6663 indica   RA5282 STS061 AAAAGTGTGATGGATTTCTTCTGCCTAATGCAGGTTGGTTAACATCACGA
AGGAAAAATACTAACTGAAGAGATGTAATAGATTGGATTATTCAAACATA
ATGTCAGCTGCAGCTTTAATACTGTTTCAGTTATCATTGATCTTACATTT
TTATCTGGATTTAACATCTGTAGGAAACAAAGGTTATACATGCCAGAAAT
GTAGCACTTCTAGAGATGGGGAAGAGTTACAAAAGATGGCTAGCGATGTA
CTACTATTATCTGACAAAGTCTCTTCCTTAGTTTCATCTGGAAGTATCCT
TTTTCACTATTACTAGATGCTATCTGAGGCAAATGTATATAATTGATTGC
ATCATATTGTTTTGTGATTTT--GTAAAATGCTACCTTAACTTTGGGCAG
TAGATAACAGTGAGGTAGGTTCTATGTACAAGACCATTGAAGAGCTAGAG
CGGAAGCTTTACCATCCTTTGT
View all "STS061" genotypes
Mudgo IRGC6663 indica   RA5282 STS061 AAAAGTGTGATGGATTTCTTCTGCCTAATGCAGGTTGGTTAACATCACGA
AGGAAAAATACTAACTGAAGAGATGTAATAGATTGGATTATTCAAACATA
ATGTCAGCTGCAGCTTTAATACTGTTTCAGTTATCATTGATCTTACATTT
TTATCTGGATTTAACATCTGTAGGAAACAAAGGTTATACATGCCAGAAAT
GTAGCACTTCTAGAGATGGGGAAGAGTTACAAAAGATGGCTAGCGATGTA
CTACTATTATCTGACAAAGTCTCTTCCTTAGTTTCATCTGGAAGTATCCT
TTTTCACTATTACTAGATGCTATCTGAGGCAAATGTATATAATTGATTGC
ATCATATTGTTTTGTGATTTT--GTAAAATGCTACCTTAACTTTGGGCAG
TAGATAACAGTGAGGTAGGTTCTATGTACAAGACCATTGAAGAGCTAGAG
CGGAAGCTTTACCATCCTTTGT
View all "STS061" genotypes
Mudgo IRGC6663 indica   RA5282 STS120 AAACAAGTTGGTGTTTTGACAGGTCATTTAGATGGGATTACATTTATTGA
TAGCCGTGGAGATGGGCATTATTTTATTTCAAATTGCAAGGATCAAACTA
TTAAACTATGGGACATCAGGAAAATGTCGTCCACTGTGAAAGAGTAAATA
CAGCTCTTGCTTTTGCATGATTATTCCTCTAAACCAAACCACTTTTT--A
TGCTTGAATCTTAAACGCAACATATTGTAAGCAAGTAGGAAATGCTAAAA
TCAAAATCTGCCTTTGACTAGATCTGCTTGGCCTGATTTGTCCAAGATCT
TGTCTACATGCCTGACCCAAAGTCCAAAATATAAAATAGGCTAAAGTTAT
TCGACAGAAATACTATTTTTACTTGTAGTTTGTTTTTGCAGCTGCACACC
AAAAGCATATGAATGGGATTACAGATGGATGACATATCCCTCAGAAGCCC
GATATTTCAA
View all "STS120" genotypes
Mudgo IRGC6663 indica   RA5282 STS120 AAACAAGTTGGTGTTTTGACAGGTCATTTAGATGGGATTACATTTATTGA
TAGCCGTGGAGATGGGCATTATTTTATTTCAAATTGCAAGGATCAAACTA
TTAAACTATGGGACATCAGGAAAATGTCGTCCACTGTGAAAGAGTAAATA
CAGCTCTTGCTTTTGCATGATTATTCCTCTAAACCAAACCACTTTTT--A
TGCTTGAATCTTAAACGCAACATATTGTAAGCAAGTAGGAAATGCTAAAA
TCAAAATCTGCCTTTGACTAGATCTGCTTGGCCTGATTTGTCCAAGATCT
TGTCTACATGCCTGACCCAAAGTCCAAAATATAAAATAGGCTAAAGTTAT
TCGACAGAAATACTATTTTTACTTGTAGTTTGTTTTTGCAGCTGCACACC
AAAAGCATATGAATGGGATTACAGATGGATGACATATCCCTCAGAAGCCC
GATATTTCAA
View all "STS120" genotypes
Mudgo IRGC6663 indica   RA5282 STS030 AAACATAAGTCTTCAACCCTCAGGATTGTTGGATATGTTCTTCTAGCTAT
TGTCCTGTTTATAGTTACAGTGCTGCTGGTAATATTTTGCCTGTCCAAGT
ACCAAGAGAGACAGTCAAGACGTGATTATACAACAAGTCAGGTGGGGAGG
GTTCATCAGAGGGTTGAAGAGCCGAAAGTTAAGCAAGCTTCAGTGCAGTC
AAGGAATGATGCCAAAAAAGGTCAACAATTAATTTATATATTCTGTAATA
TATTTCTGATTATATTTTATTTGTTTTATATCACAGCATATTGATGTTCT
ATTAACAGGATCAACAGAGGTTCCTGAACGGAGGCAGGTTCGTGAAATAA
ATTTGGCGGTACCAGGTATAGATGCTTGTAAATCTGATCTATCAGGTCTT
TTAGTACTGTAATACTATTCACATTTTTAAGTTCAGATGTATAAAATAAC
TATTCAATTGCTGGCAGCTGCTCT
View all "STS030" genotypes
Mudgo IRGC6663 indica   RA5282 STS030 AAACATAAGTCTTCAACCCTCAGGATTGTTGGATATGTTCTTCTAGCTAT
TGTCCTGTTTATAGTTACAGTGCTGCTGGTAATATTTTGCCTGTCCAAGT
ACCAAGAGAGACAGTCAAGACGTGATTATACAACAAGTCAGGTGGGGAGG
GTTCATCAGAGGGTTGAAGAGCCGAAAGTTAAGCAAGCTTCAGTGCAGTC
AAGGAATGATGCCAAAAAAGGTCAACAATTAATTTATATATTCTGTAATA
TATTTCTGATTATATTTTATTTGTTTTATATCACAGCATATTGATGTTCT
ATTAACAGGATCAACAGAGGTTCCTGAACGGAGGCAGGTTCGTGAAATAA
ATTTGGCGGTACCAGGTATAGATGCTTGTAAATCTGATCTATCAGGTCTT
TTAGTACTGTAATACTATTCACATTTTTAAGTTCAGATGTATAAAATAAC
TATTCAATTGCTGGCAGCTGCTCT
View all "STS030" genotypes
Mudgo IRGC6663 indica   RA5282 STS007 AAAGATTTTCTGTCAGTTCCTGTGGCAGAAATGACTCATCTTCGGCCTTA
CAAAAATCAGGTGACAACCATGTTGCCTGCCAATCAGGACAACCACCTCT
GGCTGTGCATACTGAGCTCCAACATGACACTTCTATTGTAATATCCAGTG
GTGAAGAGAAGGTCCTTTTTGACCTTAATGTGCCAGCTGAAAGCATTGAC
ATGGAATCAACAATAACCAGTAATAGTTTTAGAGATAAGCTAGTGAAAAA
TGATGGAAGTGAAGAAACAGTAACCGATCATTCTTTCTCCAAGAGAAACG
GTGTGCATGCTGAAACTTCTATAGAAGAACGAACTGTTGGAGAACATCAT
ATATCAGTCAGCAAGGATGGAAACACCACATTTTTCCAAGAATCAATAAA
TAATGAAATTGATAAGGCGCAGTCTTCAGACCTTATAAGTGTTAGCAGCA
AACATTTGATTGCAGAAACTCCTCATGTTGACAATATTGTGTGTCCAGAA
CTGCGAGCATCTCCTGATGGA
View all "STS007" genotypes
Mudgo IRGC6663 indica   RA5282 STS007 AAAGATTTTCTGTCAGTTCCTGTGGCAGAAATGACTCATCTTCGGCCTTA
CAAAAATCAGGTGACAACCATGTTGCCTGCCAATCAGGACAACCACCTCT
GGCTGTGCATACTGAGCTCCAACATGACACTTCTATTGTAATATCCAGTG
GTGAAGAGAAGGTCCTTTTTGACCTTAATGTGCCAGCTGAAAGCATTGAC
ATGGAATCAACAATAACCAGTAATAGTTTTAGAGATAAGCTAGTGAAAAA
TGATGGAAGTGAAGAAACAGTAACCGATCATTCTTTCTCCAAGAGAAACG
GTGTGCATGCTGAAACTTCTATAGAAGAACGAACTGTTGGAGAACATCAT
ATATCAGTCAGCAAGGATGGAAACACCACATTTTTCCAAGAATCAATAAA
TAATGAAATTGATAAGGCGCAGTCTTCAGACCTTATAAGTGTTAGCAGCA
AACATTTGATTGCAGAAACTCCTCATGTTGACAATATTGTGTGTCCAGAA
CTGCGAGCATCTCCTGATGGA
View all "STS007" genotypes
Mudgo IRGC6663 indica   RA5282 STS012 AAAGGTTTCAAGTACAAAAGTCGAAGAGCTCCAAGTAGATGTGGCGTCTA
TGGATGTTGAAATCTCTGCGTTAATGAAGCTATTTAGAAAAATAACAGAA
AACGACCGAGCCCCTTACTCGAGGGAGAGAGCCGATGATTCATCTTTGGA
ATGTGAACCGGTTCAACTTGACGTAAGCTCATTTTTTCCTTGTTATAGTT
TCCTTTCGCTCTTCAACCCAAAGTACGTCATGTAGTTTTACCACCTCTTT
GATGAGCGATTGTTTTT-CCTCAATACAATTGGCTAAACGTCCTACTTGA
TATGGGCAGGATATGGTTGGTGACATCGACATGGAGAAGATGGAGCAGGA
AATGTCTGCATACGCTACAGCTCTCGCTGCCGCGAAAGACAATCCTACTG
A
View all "STS012" genotypes
Mudgo IRGC6663 indica   RA5282 STS012 AAAGGTTTCAAGTACAAAAGTCGAAGAGCTCCAAGTAGATGTGGCGTCTA
TGGATGTTGAAATCTCTGCGTTAATGAAGCTATTTAGAAAAATAACAGAA
AACGACCGAGCCCCTTACTCGAGGGAGAGAGCCGATGATTCATCTTTGGA
ATGTGAACCGGTTCAACTTGACGTAAGCTCATTTTTTCCTTGTTATAGTT
TCCTTTCGCTCTTCAACCCAAAGTACGTCATGTAGTTTTACCACCTCTTT
GATGAGCGATTGTTTTT-CCTCAATACAATTGGCTAAACGTCCTACTTGA
TATGGGCAGGATATGGTTGGTGACATCGACATGGAGAAGATGGAGCAGGA
AATGTCTGCATACGCTACAGCTCTCGCTGCCGCGAAAGACAATCCTACTG
A
View all "STS012" genotypes
Mudgo IRGC6663 indica   RA5282 STS040 AAGAACTAATGGAGAAGGTGTGCCCTTGATTCAACCTTTATATTAGACTA
GTTCTATGATATGCTTGCTTTATTGTCTATTTATGGATGATGAGTGTACT
TTAGCCGGCATTAGTTAATGGATATCTTGTGATAACAGGAAATCTTGTTA
TGACAATCAACTGCTGATGGTGATATTGGTATCCTGTGGTATACATCTTT
AGATTGCTAGCCACATTGTGATTATGATCTAAATTAGAAAATTTGCTGCA
CAAAGTAGAATGATGATTTTGGACATAGTAATTTGTTAATTCTTTGCACC
AATACATCCATTGTTGATATGATGATATCTACTTCTGTTTCAGGAATGAT
TTGATGCCTTTGTATTTAGTGGCAAAGCTACCAACCACATGATTTAACTG
TTGTTTTTGGCATGTATTCAGACAGGATTTGACATGGATGATGTAGTAAG
GAAGTACATTCGATACACACTGAATGAAAAA
View all "STS040" genotypes
Mudgo IRGC6663 indica   RA5282 STS040 AAGAACTAATGGAGAAGGTGTGCCCTTGATTCAACCTTTATATTAGACTA
GTTCTATGATATGCTTGCTTTATTGTCTATTTATGGATGATGAGTGTACT
TTAGCCGGCATTAGTTAATGGATATCTTGTGATAACAGGAAATCTTGTTA
TGACAATCAACTGCTGATGGTGATATTGGTATCCTGTGGTATACATCTTT
AGATTGCTAGCCACATTGTGATTATGATCTAAATTAGAAAATTTGCTGCA
CAAAGTAGAATGATGATTTTGGACATAGTAATTTGTTAATTCTTTGCACC
AATACATCCATTGTTGATATGATGATATCTACTTCTGTTTCAGGAATGAT
TTGATGCCTTTGTATTTAGTGGCAAAGCTACCAACCACATGATTTAACTG
TTGTTTTTGGCATGTATTCAGACAGGATTTGACATGGATGATGTAGTAAG
GAAGTACATTCGATACACACTGAATGAAAAA
View all "STS040" genotypes
Mudgo IRGC6663 indica   RA5282 STS089 AAGCTGTGAAGGTGGTCGACATTGTGGACACCTTCCGTCTTCAGGTTGCT
CTCTCTTCCATTACCTTGGCTCTTGTATATGATACTGTCTGCACTTTATT
TTTGTGCTTACATTCCATGTGTGTTTGGCAGGAGCAACCTCCTTTTGACA
AGAAGCAGTTTGTGACCTTCATGAAGCGCTACATCAAGAACCTCTCCGCC
AAGCTGGATGCGGAAAAGCAAGAGGAATTCAAGAAGAACATTGAGGGTGC
CACCAAGTACTTGCTTGGAAAGCTCAAGGACCTTCAGTTGTAAGTTCACT
ATAATTGCTTGCCACAGGCCCAGGAAATAGTAACATATGCGATGCCATGA
ACATGTCTCACCATTAGTGCCTACAAATTCCAGTTTAAATGATTTGCTAT
GTTCTATCACATTAAATTCTTGAAGCAAGAACAGGACTCAGCCATATATG
ATATGACTCGTGCTGCTCTGTTTGCAAGACTTGTATTCAGGTATGCTTCT
TATGCTGTCTCTTGTGATCTGTTTCAGCTTTGT
View all "STS089" genotypes
Mudgo IRGC6663 indica   RA5282 STS089 AAGCTGTGAAGGTGGTCGACATTGTGGACACCTTCCGTCTTCAGGTTGCT
CTCTCTTCCATTACCTTGGCTCTTGTATATGATACTGTCTGCACTTTATT
TTTGTGCTTACATTCCATGTGTGTTTGGCAGGAGCAACCTCCTTTTGACA
AGAAGCAGTTTGTGACCTTCATGAAGCGCTACATCAAGAACCTCTCCGCC
AAGCTGGATGCGGAAAATCAAGAGGAATTCAAGAAGAACATTGAGGGTGC
CACCAAGTACTTGCTTGGAAAGCTCAAGGACCTTCAGTTGTAAGTTCACT
ATAATTGCTTGCCACAGGCCCAGGAAATAGTAACATATGCGATGCCATGA
ACATGTCTCACCATTAGTGCCTACAAATTCCAGTTTAAATGATTTGCTAT
GTTCTATCACATTAAATTCTTGAAGCAAGAACAGGACTCAGCCATATATG
ATATGACTCGTGCTGCTCTGTTTGCAAGACTTGTATTCAGGTATGCTTCT
TATGCTGTCTCTTGTGATCTGTTTCAGCTTTGT
View all "STS089" genotypes
Mudgo IRGC6663 indica   RA5282 STS078 AAGGTCAGGCATCTCTTCGGCGTGTGCTTGTTGGTTACTCATTTCGTGAC
TCAGAAGTTGGATATTGCCAGGTAGGCATAAAGCAATGCTTTTCAAATGT
AACTGTTTTATAGAGAAGCTCCATTACTAACACCATGCAATGCAGGGTTT
AAATTATGTAGCTGCATTGTTGTTGCTTGTTATGAAGACAGAGGAAGATG
CATTCTGGATGCTTGCTGTACTACTGGAAAATGTACTTGTCAATGATTGC
TATACTGATAATCTTTCTGGATGCCATGTCGAGCAGAGAGTTTTCAAAGA
CCTCCTAGCTAAAAAGTGCCCCAGGTATTTCCCCCCTGTTATGTTTATGG
CTTTTATGCTATGATTTTTCATCAGTCGCTGGCAATAACAAGCATTACCA
TT-ATAAGATGATTGTGAATCATTGGATTACCCAAATGATGCAGGATTGC
TGCTCATCTTGAAGCAATGGGGTTTGATGTTTCTCTTGTTGCCACAGAAT
GGTTCTTGTG
View all "STS078" genotypes
Mudgo IRGC6663 indica   RA5282 STS078 AAGGTCAGGCATCTCTTCGGCGTGTGCTTGTTGGTTACTCATTTCGTGAC
TCAGAAGTTGGATATTGCCAGGTAGGCATAAAGCAATGCTTTTCAAATGT
AACTGTTTTATAGAGAAGCTCCATTACTAACACCATGCAATGCAGGGTTT
AAATTATGTAGCTGCATTGTTGTTGCTTGTTATGAAGACAGAGGAAGATG
CATTCTGGATGCTTGCTGTACTACTGGAAAATGTACTTGTCAATGATTGC
TATACTGATAATCTTTCTGGATGCCATGTCGAGCAGAGAGTTTTCAAAGA
CCTCCTAGCTAAAAAGTGCCCCAGGTATTTCCCCCCTGTTATGTTTATGG
CTTTTATGCTATGATTTTTCATCAGTCGCTGGCAATAACAAGCATTACCA
TT-ATAAGATGATTGTGAATCATTGGATTACCCAAATGATGCAGGATTGC
TGCTCATCTTGAAGCAATGGGGTTTGATGTTTCTCTTGTTGCCACAGAAT
GGTTCTTGTG
View all "STS078" genotypes
Mudgo IRGC6663 indica   RA5282 STS094 ACAAGTTGAGGGTGGAGATCGGGAATTTGCCCGAGGAGAAAATGGGGAAT
GTGCTACAGATTGTGCAGAAGAGGAATACCGATCCGGCGCTAATGGGAGA
GGTCGTTGAGCTTGATTTCGACGAAATGGATGTCGAGACGCTGTGGGAGC
TCGATCGATTTGTGGTCAATTGCAAGAAAGCGCTCAGCAAGAGCCGGAGG
ACTGTCGCGATGAACGGTGATGCTGTTGATGCGACTGCTATTGTTCCAAT
TGAGGACGATACCCTGCAGGTGAATGTGCATCATCAGCCTGCGGTGGTTG
AAATTGGGGATTCGGTATGGCAATGTTGCAATCCTTTGTTCTGTGTAATG
ACTAATGCTTGAATTGTGTTCTCATGTTTTGTTTATGTTGCACTTTTGCA
GGAGAATGACACGCCGGAGAAGAGGGTTTCAGAGGTTGATATGGTTGATG
AGTATGTTGATATTGGCGATGAGATGCC
View all "STS094" genotypes
Mudgo IRGC6663 indica   RA5282 STS094 ACAAGTTGAGGGTGGAGATCGGGAATTTGCCCGAGGAGAAAATGGGGAAT
GTGCTACAGATTGTGCAGAAGAGGAATACCGATCCGGCGCTAATGGGAGA
GGTTGTTGAGCTTGATTTCGACGAAATGGATGTCGAGACGCTGTGGGAGC
TCGATCGATTTGTGGTCAATTGCAAGAAGGCGCTCAGCAAGAGCCGGAGG
ACTGTCGCGATGAACGGTGATGCTGTTGATGCGACTGCTATTGTTCCAAT
TGAGGACGATACCGTGCAGGTGAATGTGCATCATCAGCCTTCGGTGGTTG
AAATTGGGGACTCGGTATGGCAATGTTGCAATCCTTTGTTCTGTGTAATG
ACTAATGCTTGAATTGTGTTCTCATGTTTTGTTTATGTTGCACTTTTGCA
GGAGAATGACACGCCGGAGAAGAGGGTTTCAGAGGTTGATATGGTTGATG
AGTATGTTGATATTGGCGATGAGATGCC
View all "STS094" genotypes
Mudgo IRGC6663 indica   RA5282 STS096 ACCCCCTACTTCATCTGCTCCTCCAATGGTACACAATTCCTCAGTTTTGA
TTTAATATGCTCATATTTTGATTTTTCAATATGTGACCCAAGTGAGATGT
TATCATCAACTGAATATGGCAGTTTTGTCTGCACAATAATTCTCACCCAT
GTTCTTGATTGCACTGGATTTTCTGCTTTCTTAGCTTAAAT-AAACCTTG
TCTCATGTGCTTTTACATATTCCATTTTCATAACCATAAGTGCAATCTAT
AATTTCAAATTATAGGTGCAAATATAATTTAGAGTAGCTCCCGGTGCTAA
CATGGGCATATTTGCAACATTCTGTTGATCTTATGG----AAT----ATG
AATAGCTTGAATTGAATATTGTGTTCTGTTCTCAGTATAGTGCAACCAGT
GTCCCAGTCAGTGAAGACAACAATGTTGTCCATAAGGCTGAGGATGTTGT
CAGCACCATGCTTGCTAAGGGGTTCACCCTGGGGAAAGATGCCGTTGGCA
AGGCAAAAGCTTTTGATGAGAAGC
View all "STS096" genotypes
[ Download ]