grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "IRGC6663" from the experiment "Genome-wide patterns of nucleotide polymorphism in domesticated rice".

E.g., Germplasm "IRGC9542", RA4969, Basmati 1, Marker/locus RM22.

Items 26 to 50 of 204.       Previous | of 9 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
Mudgo IRGC6663 indica   RA5282 STS014 CCGGAGGAGGACGAGAAGCTGTTCAACCACATCAGCCGCTATGGCGTCGG
CTGCTGGAGCTCCGTCCCAAAGCTCGCCGGTACGCCCATCGATCAGTGTA
TGCATTAGTAACCAAAAT----GGCAAACTGACAAGCTAAGCTAAACTTG
GGTTAATTA--ATCACTTCTTTTCTCCTGAATAATAATGCTAATTGCTTA
CATCAATGTGTTTATAGTATTTCAGTTTATTATTTCATCAATTTCTGTCC
TGCTGCATAATGCTCACT------ATAGAAATGTGTTTATATC-------
----------------------------------------GTAATTTAGT
TGCTATACCTCTCTCTTTGTATCTC------ACTCTCTGACAGTGTGTGA
ATAATATAATGTGTGTTGCTGAGTTGCTGTGTACAGGATTGGAGAGGTGT
GGCAAGAGTTGCAGGCTGAGATGGATCAACTACCTGAGGCCTGATCTCAA
GAGAGGCAGCTTCTCCCAGCAGGAGGAGGAGCTCATCATCAG
View all "STS014" genotypes
Mudgo IRGC6663 indica   RA5282 STS015 TTATAATGCCAGACGGCCTATGAAACAAAGGTACTTTTTCTTATGAGGCC
CGAAAGTTTTAGTTTATAGTTAGCTATATGATCCACCTTTGTTAATGCAG
TACAATGCAACATACATGTTCTATATTTTGCAGGTATCACTACAACGTTG
CAGATTCAAGGCTTGTACAACACATTGACAAAGGGAATGAAGATGGTCTG
TTTATCAGTTGCATAACATCTTGCTCAAATCTGTGGGCTCTAATCATGGA
TGCTGGCACTGGGTTCACTTCCCAGGTTTATGAACTTTCACCACATTTTC
TTCACAAGGTGAGTAGCTTGCTCCTTGTTTAACTGGTGGAAAATCTTAGC
AAACTAATCACATAACTTTTCAAGGCAAAGTTACATATAAGGAAGCTCTT
GTATACATTGTCAAATGTGATTCCATGGTTTTCTGGTCATT
View all "STS015" genotypes
Mudgo IRGC6663 indica   RA5282 STS015 TTATAATGCCAGACGGCCTATGAAACAAAGGTACTTTTTCTTATGAGGCC
CGAAAGTTTTAGTTTATAGTTAGCTATATGATCCACCTTTGTTAATGCAG
TACAATGCAACATACATGTTCTATATTTTGCAGGTATCACTACAACGTTG
CAGATTCAAGGCTTGTACAACACATTGACAAAGGGAATGAAGATGGTCTG
TTTATCAGTTGCATAACATCTTGCTCAAATCTGTGGGCTCTAATCATGGA
TGCTGGCACTGGGTTCACTTCCCAGGTTTATGAACTTTCACCACATTTTC
TTCACAAGGTGAGTAGCTTGCTCCTTGTTTAACTGGTGGAAAATCTTAGC
AAACTAATCACATAACTTTTCAAGGCAAAGTTACATATAAGGAAGCTCTT
GTATACATTGTCAAATGTGATTCCATGGTTTTCTGGTCATT
View all "STS015" genotypes
Mudgo IRGC6663 indica   RA5282 STS016 GAGCGGAGTTACCATCAATGGGAAGCGAGCGGTCGTGGTTGGCCGCAGCA
ACATTGTCGGGCTACCTGTATCCCTGCTTCTTCTGAAGGCGGATGCGACC
GTATCCATTGTTCACTCCCGGACCCCAAACCCTGAAAGTATTGTCCGCGA
AGCAGACATTGTCATTGCAGCGGCTGGCCAGGCTATGATGGTACATTGTT
CTACCACCAAATTATGACATGGTTCATCACAAT--------CCA----CT
GCCCAGTTCTAACTGCAAATTTCTTGGTTGCCAGATCAAAGGAGACTGGA
TCAAACCAGGCGCTGCTGTCATCGACGTTGGGACGAACTCCATCAGTGAC
CCAACCAGGAAATCGGGGTACAGACTCGTCGGCGATGTGGATTTCGCAGA
GGTGAGCAAGGTTGCTGGTCACCTGACTCCAGTCCCAGGTGGCGTTGGCC
CCATGACGGTGGCGATGTTGCTGAAGAACACGG
View all "STS016" genotypes
Mudgo IRGC6663 indica   RA5282 STS016 GAGCGGAGTTACCATCAATGGGAAGCGAGCGGTCGTGGTTGGCCGCAGCA
ACATTGTCGGGCTACCTGTATCCCTGCTTCTTCTGAAGGCGGATGCGACC
GTATCCATTGTTCACTCCCGGACCCCAAACCCTGAAAGTATTGTCCGCGA
AGCAGACATTGTCATTGCAGCGGCTGGCCAGGCTATGATGGTACATTGTT
CTACCACCAAATTATGACATGGTTCATCACAAT--------CCA----CT
GCCCAGTTCTAACTGCAAATTTCTTGGTTGCCAGATCAAAGGAGACTGGA
TCAAACCAGGCGCTGCTGTCATCGACGTTGGGACGAACTCCATCAGTGAC
CCAACCAGGAAATCGGGGTACAGACTCGTCGGCGATGTGGATTTCGCAGA
GGTGAGCAAGGTTGCTGGTCACCTGACTCCAGTCCCAGGTGGCGTTGGCC
CCATGACGGTGGCGATGTTGCTGAAGAACACGG
View all "STS016" genotypes
Mudgo IRGC6663 indica   RA5282 STS017 CATTTCTTTCTGCTAAACTTTGCAAGACTCGTCCCCTGGTAGTAGCAGCA
GCTATGGAGGTCTCGAAGGAAGCCCCTTCTGCTGACTTTGCCAATCGCCA
GCCTTCCAAAGGTTGTTGCTGAGAACTCCATCTTATTAAATTGATTGATA
TGCCTCTGCGGGTTGCACTGTTTCCAGTTCTAAATTTAATATAACTTTTG
TCCTTGCATGATTCTGTTAGGGGTTCTTGAGACATGGTGCAATGCCGATG
CAGTGTGTTTTGATGTTGATAGCACGGTCTGCTTGGATGAGGGTATTGAT
GAACTCGCTGATTTCTGTGGGGCTGGGAAGGCTGTTGCTGAGTGGACTGC
AAAGTAAATAACATGTTATGAACATTAGTTTTGAAGTGTGTTTGTTGCTT
AGTGCATAAAATTCATTCAGGATGCTCATTGGTTTAATATTCTTAGGGCA
ATGACAGGAAN
View all "STS017" genotypes
Mudgo IRGC6663 indica   RA5282 STS017 CATTTCTTTCTGCTAAACTTTGCAAGACTCGTCCCCTGGTAGTAGCAGCA
GCTATGGAGGTCTCGAAGGAAGCCCCTTCTGCTGACTTTGCCAATCGCCA
GCCTTCCAAAGGTTGTTGCTGAGAACTCCATCTTATTAAATTGATTGATA
TGCCTCTGCGGGTTGCACTGTTTCCAGTTCTAAATTTAATATAACTTTTG
TCCTTGCATGATTCTGTTAGGGGTTCTTGAGACATGGTGCAATGCCGATG
CAGTGTGTTTTGATGTTGATAGCACGGTCTGCTTGGATGAGGGTATTGAT
GAACTCGCTGATTTCTGTGGGGCTGGGAAGGCTGTTGCTGAGTGGACTGC
AAAGTAAATAACATGTTATGAACATTAGTTTTGAAGTGTGTTTGTTGCTT
AGTGCATAAAATTCATTCAGGATGCTCATTGGTTTAATATTCTTAGGGCA
ATGACAGGAAC
View all "STS017" genotypes
Mudgo IRGC6663 indica   RA5282 STS018 NNNNATTTTGCTCATTGCACGTCAGAGATGATATTCATTACTCATTTGCT
CACAGAACAACCTGAGAAACTTGCTGGCCCTCTGCTGGCTGATACTTATG
TTACTCTCCTGAAAGGTCGCAATGCGTGGTATGGGCAAATGCTAGCGAAG
GGAGAACTGAGCCCTGACATGGGCGACAGCATCAAGGGGAAGGGGATGAT
TCAGGTTATCTCATAAAACTACTCATTATTTTCCCCGAAAGTTATATGAA
TTTTGAGCGTATTTTTGAAGAATGCTTGAAGTCAAAACTTGCAAAAGATA
TCACATCATCCTGGATATAACCTGTTCACTTTTCACTCTACAGGGTATCT
CTGCTGTTGGTGCATTTTTTGAACTTCTCAGTCAACCCAGCTTAAGTGTG
CAACACCCAGAGGAAAATAAGCAAGTTGCAC
View all "STS018" genotypes
Mudgo IRGC6663 indica   RA5282 STS018 GTGTATTTTGCTCATTGCACGTCAGAGATGATATTCATTACTCATTTGCT
CACAGAACAACCTGAGAAACTTGCTGGCCCTCTGCTGGCTGATACTTATG
TTACTCTCCTGAAAGGTCGCAATGCGTGGTATGGGCAAATGCTAGCGAAG
GGAGAACTGAGCCCTGACATGGGCGACAGCATCAAGGGGAAGGGGATGAT
TCAGGTTATCTCATAAAACTACTCATTATTTTCCCCGAAAGTTATATGAA
TTTTGAGCGTATTTTTGAAGAATGCTTGAAGTCAAAACTTGCAAAAGATA
TCACATCATCCTGGATATAACCTGTTCACTTTTCACTCTACAGGGTATCT
CTGCTGTTGGTGCATTTTTTGAACTTCTCAGTCAACCCAGCTTAAGTGTG
CAACACCCAGAGGAAAATAAGCAAGTTGCAC
View all "STS018" genotypes
Mudgo IRGC6663 indica   RA5282 STS019 TAGCAAATCATTCCAGTTGGGTATCAGCTTTGCTGGTGGTTACATTGCCG
GTGTCTTCTGTGCTATTGTTTCTCACCCGGCAGATAATCTAGTCTCTTTC
CTGAACAATGCCAAGGGTGCTACAGTGGGTGATGTGAGTTTATTACTTAT
TACAATGCTCTGGTATTAATGCATTGTGGTGCTTTGCTTTTGAAGTTTTG
TTGATGAGCAACTGATTACAGTTATGTATTTCTGTAGGCTGTTAAGAAGC
TTGGTCTCTGGGGTCTATTCACTCGTGGACTGCCCCTACGTATTGTCATG
ATCGGTACCCTTACTGGAGCTCAATGGGGAATTTATGATGCATTCAAAGT
CATGGTTGGATTGTAAGTATCTTTCTTTATTATTACTGTCATTAGAACAG
CGTCATTATCTTTCGATTGAATCAGTAAATTGAGAATTCACTTTATAATT
TAACAGGCCAACTACCGGTGGTGTTACGCCAGCACCAGCCACTTC
View all "STS019" genotypes
Mudgo IRGC6663 indica   RA5282 STS019 TAGCAAATCATTCCAGTTGGGTATCAGCTTTGCTGGTGGTTACATTGCCG
GTGTCTTCTGTGCTATTGTTTCTCACCCGGCAGATAATCTAGTCTCTTTC
CTGAACAATGCCAAGGGTGCTACAGTGGGTGATGTGAGTTTATTACTTAT
TACAATGCTCTGGTATTAATGCATTGTGGTGCTTTGCTTTTGAAGTTTTG
TTGATGAGCAACTGATTACAGTTATGTATTTCTGTAGGCTGTTAAGAAGC
TTGGTCTCTGGGGTCTATTCACTCGTGGACTGCCCCTACGTATTGTCATG
ATCGGTACCCTTACTGGAGCTCAATGGGGAATTTATGATGCATTCAAAGT
CATGGTTGGATTGTAAGTATCTTTCTTTATTATTACTGTCATTAGAACAG
CGTCATTATCTTTCGATTGAATCAGTAAATTGAGAATTCACTTTATAATT
TAACAGGCCAACTACCGGTGGTGTTACGCCAGCACCAGCCACTTC
View all "STS019" genotypes
Mudgo IRGC6663 indica   RA5282 STS021 TGGTTCCAGTCACTATGACATTGAGGTGGCACCCCGCCGGTTGGAAAGCT
TGATAATTTCTAGCGGTGAGGTCATCTACTCACTTGAGTTCTCATACATT
GACCACAGTGGGCAGCAGCACACATCAGGCACATGGGGCGGCTATGGCCC
AAATAAAGGGAACAAACGTACTAAGGTGACTATGAATCTTATTATTCAAT
TCTTGCATTTTTCTTTTAGATAAAATGATTGGTATACATTCATTATCTCT
GCACACAACTAGTGAAATTTATAATAGGTTTACTAGTAGTATTATGTTAT
TTTGAAACTTTTCTTGCAGATTCAGCTTGGTCTTATAGAGTATGTAACGG
AAGTTTCTGGGACAATCGGACCATTTGATAGGGCACCCGCTGGTGTTATT
ACATCGCTTACGTTTATCACTAATAAGGGAAGCTACGGACCTTTTGGAGA
AGTAAGAGGAACTCCTTTCCACATCCCAGTGCAGGACAATGGCAGCATTG
TTGGCTTTTTTGCACGTGC
View all "STS021" genotypes
Mudgo IRGC6663 indica   RA5282 STS021 TGGTTCCAGTCACTATGACATTGAGGTGGCACCCCGCCGGTTGGAAAGCT
TGATAATTTCTAGCGGTGAGGTCATCTACTCACTTGAGTTCTCATACATT
GACCACAGTGGGCAGCAGCACACATCAGGCACATGGGGCGGCTATGGCCC
AAATAAAGGGAACAAACGTACTAAGGTGACTATGAATCTTATTATTCAAT
TCTTGCATTTTTCTTTTAGATAAAATGATTGGTATACATTCATTATCTCT
GCACACAACTAGTGAAATTTATAATAGGTTTACTAGTAGTATTATGTTAT
TTTGAAACTTTTCTTGCAGATTCAGCTTGGTCTTATAGAGTATGTAACGG
AAGTTTCTGGGACAATCGGACCATTTGATAGGGCACCCGCTGGTGTTATT
ACATCGCTTACGTTTATCACTAATAAGGGAAGCTACGGACCTTTTGGAGA
AGTAAGAGGAACTCCTTTCCACATCCCAGTGCAGGACAATGGCAGCATTG
TTGGCTTTTTTGCACGTGC
View all "STS021" genotypes
Mudgo IRGC6663 indica   RA5282 STS022 TGTTGGATCATTATTACAAGAGTGCTGTTTGGCACTGAATAAATTGCATC
CCTAGTTGAACATAAGAGTCAATCTTTGCTTTTCCTCCAGTTAAGCGAGC
TAAGAAGTACGTATATCATACCTGAGCCTGCCTTTTCTTTGCTCTTATGA
AGCTTGCTGGAAAAAACTCACACCATATTATTGAGGCAACTTTCAAAGCA
TTTGCTAGAGCCCTTCGACAAGCAACAGAATATGACTTGCGCCGACGCGG
CACTGTCCCCAGGTTCGTTTTAGCTTATTGCAAATAGCGTTTAGGAAATT
CTATGTTGTGCCCAACTACACTGTTGATGCCTGATTCAAAAACTTCACAC
CTGCTAAGCATATGGTTTATCTCTGACCTGTGCTGATATTGAAACATTAA
CGTATCTTTCTTGACTTGATCGCAGCTCAAAAGGTGTGTTGTCAAGGTCA
TAGTGTTGCAGGTTTGGAAAACAAGGGGTGCATGCTACTGTTCCTTGTAG
ATTGCAATATTCAAAGGAAACAAATGGAATGGCCTCTACAGCT
View all "STS022" genotypes
Mudgo IRGC6663 indica   RA5282 STS022 TGTTGGATCATTATTACAAGAGTGCTGTTTGGCACTGAATAAATTGCATC
CCTAGTTGAACATAAGAGTCAATCTTTGCTTTTCCTCCAGTTAAGCGAGC
TAAGAAGTACGTATATCATACCTGAGCCTGCCTTTTCTTTGCTCTTATGA
AGCTTGCTGGAAAAAACTCACACCATATTATTGAGGCAACTTTCAAAGCA
TTTGCTAGAGCCCTTCGACAAGCAACAGAATATGACTTGCGCCGACGCGG
CACTGTCCCCAGGTTCGTTTTAGCTTATTGCAAATAGCGTTTAGGAAATT
CTATGTTGTGCCCAACTACACTGTTGATGCCTGATTCAAAAACTTCACAC
CTGCTAAGCATATGGTTTATCTCTGACCTGTGCTGATATTGAAACATTAA
CGTATCTTTCTTGACTTGATCGCAGCTCAAAAGGTGTGTTGTCAAGGTCA
TAGTGTTGCAGGTTTGGAAAACAAGGGGTGCATGCTACTGTTCCTTGTAG
ATTGCAATATTCAAAGGAAACAAATGGAATGGCCTCTACAGCT
View all "STS022" genotypes
Mudgo IRGC6663 indica   RA5282 STS023 GAGCAACTCAGGGTATAGATAATCTGAAAACAAACCACTTGAATCCCATG
ATGAAAACCATTTCACACTTCGAGTTTACTGATGATCTGTTCACTTCTGC
AGAAAGAACATTTTGATATCAGGAAAGGTAAAGCGCCTGAAGATGCCATC
GACTGGAATGATTTCAAGTCCATGACCTTCACTCGAGCTGTAAGTTTGAT
GATGATAAACTCAGAAAGCAGCCACAGTAACAGTGTAGTCTGATCATGAT
GAACTCATGGGCACTTTTACTATGCAGGTTATCTTTGAGACATTAAGATT
AGCTACAGTTGTGAATGGGCTGCTGAGGAAAACTACCCAAGATGTTGAAA
TGAATGGTGAGATATGCATGATATATATGCTGCTGCAATTAGCATCTTTT
TGATAAATCTTTGGATAGCCCTAATGCAGTGCTTATTTGTTTCTTCCAGG
GTATGTTATCCCAAAAGGTTGGAGAATATATGTTTACACAAGGGAAATAA
ATTA
View all "STS023" genotypes
Mudgo IRGC6663 indica   RA5282 STS023 GAGCAACTCAGGGTATAGATAATCTGAAAACAAACCACTTGAATCCCATG
ATGAAAACCATTTCACACTTCGAGTTTACTGATGATCTGTTCACTTCTGC
AGAAAGAACATTTTGATATCAGGAAAGGTAAAGCGCCTGAAGATGCCATC
GACTGGAATGATTTCAAGTCCATGACCTTCACTCGAGCTGTAAGTTTGAT
GATGATAAACTCAGAAAGCAGCCACAGTAACAGTGTAGTCTGATCATGAT
GAACTCATGGGCACTTTTACTATGCAGGTTATCTTTGAGACATTAAGATT
AGCTACAGTTGTGAATGGGCTGCTGAGGAAAACTACCCAAGATGTTGAAA
TGAATGGTGAGATATGCATGATATATATGCTGCTGCAATTAGCATCTTTT
TGATAAATCTTTGGATAGCCCTAATGCAGTGCTTATTTGTTTCTTCCAGG
GTATGTTATCCCAAAAGGTTGGAGAATATATGTTTACACAAGGGAAATAA
ATTA
View all "STS023" genotypes
Mudgo IRGC6663 indica   RA5282 STS024 TTCTTTTATAAGGTAATTCTAATTTTGTCCTGAAATGCATTAATTATTTA
CTCTACTTGTATTGCTAGCTAGCTAGCTAACAACATCATCGTGCTCTTCT
TCTTAGCTTTTCTCAAATGGCATGAAAGAATCTGATCAGAGGCATGCTAC
TCTTAGAATAACTGCTTCAGGTAATTCTGTAGTTCATTGTTCATTGTTTG
GTTCTGTTTGACAAAAACTATAATTTCTGCACTATCCTATGACTGTCTGT
AACGTTTTTCTTTATATTGCTGATATGATCAGTTTTGGTGGAACTTAAAG
CTTATATCGATCTGATATTTAATAGTCCTGAATATTTATTCAAATTGATA
TTCTAGAATTCAATGTTGTGCATTTTCCTATATCATCTCTCAAGAATTAT
CAAGAAGTGTATGCTTCATTTGAAACTTTTCCAAATGAGAATAAGGGAGA
TTTTTCTGCTATTTGATTTTCTTGTAAACAGAT--AGCTTTTATCTGATC
ATTGTATGTCTATCTGAAACAGA
View all "STS024" genotypes
Mudgo IRGC6663 indica   RA5282 STS024 TTCTTTTATAAGGTAATTCTAATTTTGTCCTGAAATGCATTAATTATTTA
CTCTACTTGTATTGCTAGCTAGCTAGCTAACAACATCATCATGCTCTTCT
TGTTAGCTTTTCTCAAATGGCATGAAAGAATCTGATCAGAGGCATGCTAC
TCTTAGAATAACTGCTTCAGGTAATTCTGTAGTTCATTGTTCATTGTTTG
TTTCTGTTTGACAAAAACTATAATTTCTGCACTATCCTGTGACTGTCTGT
AACGTTTTTCTTTATATTACTGATATGATCAGTTTTGGTGGAACTTAAAG
CTTATATCGATCTGATATTTAATAGTCCTGAATATTTATTCAAATTGATA
TTCTAGAATTCAATGTTGTGCATTTTCCTATATCATCTCTCAAGAATTAT
CAAGAAGTGTATGCTTCATTTGAAACTTTTCCAAATGAGAATAAGGGAGA
TTTTTCTGCTATTTGATTTTCTTGTAAACAGAT--AGCTTTTATCTGATC
ATTGTATGTCTATCTGAAACAGA
View all "STS024" genotypes
Mudgo IRGC6663 indica   RA5282 STS027 GTGAACACCGGTTTCCTTTCCTTGTTAAGGTACAAGGACCCAAGACTATG
ATACTAGTTGTAATTATTCTTTTCAAATTTCATGTAAGGCTGTAACTGTT
ACAACCCTGGCAGGTTAACAATTGGAATAGGTTCAATTGCAACAGTGGAG
GAACTCTTGTTGAGAAGTGCTGCCATTTTTTTGATTTGATGAGATTGTTT
GCAGCTGCAAACCCTGTTCGTGTGATGGCTTCTGGAGCCATTGATGTCAA
CCACAAGGATGAAATTTATGATGGGAAGGTCAGGTTAATTGACTACAAGA
TCGCTGATTTATAAGCTGGATGGCATTTTCACTCATGTGATTATTTATAA
GCTTATAAAGGCTATATTTATAAGCTGCAGCGCATTTTTTGTGCTTATCG
GGTTATGGTGGTCTCAGTTTAAACAGCAGTCCCTGATTTTAACTTCTTTC
TCAATGCAGGTTCCAGATATTATAGACAATGCATATGTAATAGTAGAATT
TGATAATG
View all "STS027" genotypes
Mudgo IRGC6663 indica   RA5282 STS027 GTGAACACCGGTTTCCTTTCCTTGTTAAGGTACAAGGACCCAAGACTATG
ATACTAGTTGTAATTATTCTTTTCAAATTTCATGTAAGGCTGTAACTGTT
ACAACCCTGGCAGGTTAACAATTGGAATAGGTTCAATTGCAACAGTGGAG
GAACTCTTGTTGAGAAGTGCTGCCATTTTTTTGATTTGATGAGATTGTTT
GCAGCTGCAAACCCTGTTCGTGTGATGGCTTCTGGAGCCATTGATGTCAA
CCACAAGGATGAAATTTATGATGGGAAGGTCAGGTTAATTGACTACAAGA
TCGCTGATTTATAAGCTGGATGGCATTTTCACTCATGTGATTATTTATAA
GCTTATAAAGGCTATATTTATAAGCTGCAGCGCATTTTTTGTGCTTATCG
GGTTATGGTGGTCTCAGTTTAAACAGCAGTCCCTGATTTTAACTTCTTTC
TCAATGCAGGTTCCAGATATTATAGACAATGCATATGTAATAGTAGAATT
TGATAATG
View all "STS027" genotypes
Mudgo IRGC6663 indica   RA5282 STS028 GTGAACACCGGTTTCCTTTCCTTGTTAAGGTACAAGGACCCAAGACTATG
ATACTAGTTGTAATTATTCTTTTCAAATTTCATGTAAGGCTGTAACTGTT
ACAACCCTGGCAGGTTAACAATTGGAATAGGTTCAATTGCAACAGTGGAG
GAACTCTTGTTGAGAAGTGCTGCCATTTTTTTGATTTGATGAGATTGTTT
GCAGCTGCAAACCCTGTTCGTGTGATGGCTTCTGGAGCCATTGATGTCAA
CCACAAGGATGAAATTTATGATGGGAAGGTCAGGTTAATTGACTACAAGA
TCGCTGATTTATAAGCTGGATGGCATTTTCACTCATGTGATTATTTATAA
GCTTATAAAGGCTATATTTATAAGCTGCAGCGCATTTTTTGTGCTTATCG
GGTTATGGTGGTCTCAGTTTAAACAGCAGTCCCTGATTTTAACTTCTTTC
TCAATGCAGGTTCCAGATATTATAGACAATGCATATGTAATAGTAGAATT
TGATAATG
View all "STS028" genotypes
Mudgo IRGC6663 indica   RA5282 STS028 GTGAACACCGGTTTCCTTTCCTTGTTAAGGTACAAGGACCCAAGACTATG
ATACTAGTTGTAATTATTCTTTTCAAATTTCATGTAAGGCTGTAACTGTT
ACAACCCTGGCAGGTTAACAATTGGAATAGGTTCAATTGCAACAGTGGAG
GAACTCTTGTTGAGAAGTGCTGCCATTTTTTTGATTTGATGAGATTGTTT
GCAGCTGCAAACCCTGTTCGTGTGATGGCTTCTGGAGCCATTGATGTCAA
CCACAAGGATGAAATTTATGATGGGAAGGTCAGGTTAATTGACTACAAGA
TCGCTGATTTATAAGCTGGATGGCATTTTCACTCATGTGATTATTTATAA
GCTTATAAAGGCTATATTTATAAGCTGCAGCGCATTTTTTGTGCTTATCG
GGTTATGGTGGTCTCAGTTTAAACAGCAGTCCCTGATTTTAACTTCTTTC
TCAATGCAGGTTCCAGATATTATAGACAATGCATATGTAATAGTAGAATT
TGATAATG
View all "STS028" genotypes
Mudgo IRGC6663 indica   RA5282 STS029 CCGGCGAGGGTGCCCCGGCGGCTGACCGCCGCCGAGCTCCTGCCGGTGAC
CCCGACTCCCCCCGCCGCCGAGAGGAGAACCACCCGGAAGCGCAAGTCCG
ACGTCGACTTCGAGGCGGAGTTCGAGCTTTTCGAG------------GAC
GACGACGACGACGATGAGTTCGAGCTTTCCGACGATGGCGACGAGAGTTT
GGCCGTGTCATGTGTGTCGTCCCCCAAGTCGAAGGCAGTACCTTCGTTTT
CTTGTACGATGAGATGGAGAAATCTTGCCTGCTTTCTTGAAGGATTTTCA
CCTGACGGCAACCTGAACTTTACACGATTTCTTCTCCTGCTGTTGATTTC
ATCGATCGCCGGCGGCAGTTTCGTCGGATGTCTCCTCGAGCTCCAGGCCG
CGGCGGCGCGTGGCGGCGGCGGCGGCCGGTCGTCGGAAGGCGAGCAAGAA
GAG---------CAAGTACAGGGGCGTCCGGCTTCGGCCGTCGGGGAGGT
TCGCGGC
View all "STS029" genotypes
Mudgo IRGC6663 indica   RA5282 STS029 CCGGCGAGGGTGCCCCGGCGGCTGACCGCCGCCGAGCTCCTGCCGGTGAC
CCCGACTCCCCCCGCCGCCGAGAGGAGAACCACCCGGAAGCGCAAGTCCG
ACGTCGACTTCGAGGCGGAGTTCGAGCTTTTCGAG------------GAC
GACGACGACGACGATGAGTTCGAGCTTTCCGACGATGGCGACGAGAGTTT
GGCCGTGTCATGTGTGTCGTCCCCCAAGTCGAAGGCAGTACCTTCGTTTT
CTTGTACGATGAGATGGAGAAATCTTGCCTGCTTTCTTGAAGGATTTTCA
CCTGACGGCAACCTGAACTTTACACGATTTCTTCTCCTGCTGTTGATTTC
ATCGATCGCCGGCGGCAGTTTCGTCGGATGTCTCCTCGAGCTCCAGGCCG
CGGCGGCGCGTGGCGGCGGCGGCGGCCGGTCGTCGGAAGGCGAGCAAGAA
GAG---------CAAGTACAGGGGCGTCCGGCTTCGGCCGTCGGGGAGGT
TCGCGGC
View all "STS029" genotypes
[ Download ]